CN109234408A - A kind of primer, probe and the method for the mutation of detection aedes albopictus drug resistance gene - Google Patents
A kind of primer, probe and the method for the mutation of detection aedes albopictus drug resistance gene Download PDFInfo
- Publication number
- CN109234408A CN109234408A CN201811296130.9A CN201811296130A CN109234408A CN 109234408 A CN109234408 A CN 109234408A CN 201811296130 A CN201811296130 A CN 201811296130A CN 109234408 A CN109234408 A CN 109234408A
- Authority
- CN
- China
- Prior art keywords
- signal
- channel
- reaction product
- probe
- vic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides primer, probe and the methods of a kind of detection aedes albopictus drug resistance gene mutation.Primer, TaqMan-MGB probe and detection method provided by the invention, quick, easy, sensitive, accurate monitoring kdr allelic gene type, genotype frequency etc. can be achieved, the situation of aedes albopictus kdr allele relevant to pyrethroid insecticides resistance can be fast and accurately grasped, state of the resistant gene in Genetic Constitution of Population is understood.Therefore, primer provided by the invention, TaqMan-MGB probe, kit and detection method are that a kind of energy is accurate, facilitate the new product and new method of prediction aedes albopictus drug resistance occurrence and development.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to it is a kind of detection aedes albopictus drug resistance gene mutation primer,
Probe and method.
Background technique
Aedes albopictus (Aedes albopictus) is also referred to as Asia tiger mosquito, is a kind of very strong mosquito of aggressiveness, together
When be also a kind of important viral transmission medium, the viruses such as multiple pathogens, including dengue fever, stockaded village's card can be propagated.It steps at present
Leather heat and stockaded village's card have become two important insect-borne infectious diseases, seriousness in global range and are also increasing year by year.Have every year and is more than
50000000 people dies of mosquito matchmaker's disease, and there is presently no vaccines or particular treatment drug for controlling dengue fever and stockaded village's card.Traditional
The measure of control insect-borne diseases is the population that transmitting carrier mosquito is reduced using chemical insecticide, but is not had for control insect-borne diseases
Play good effect.Chemical insecticide makes mosquito be easy to produce drug resistance, and very big problem is brought to environment and public health.
Currently, the detection method of mosquito class drug resistance, unanimously continues to use the bioassary method of 1970 world health organisation recommendations, survey
Sensitive Toxicity baseline and LD50 or LC50 value of the pest to medicament out.Acquire pest population of the same race from test area again, using with
The identical bioassay method of sensitive strain and control condition are measured, LD50 the or LC50 value of population to be measured is obtained, with to be measured kind
Ratio between group and LD50 the or LC50 value of people's sensitive population strain indicates resistance level.But this method is to obtained data
There is stringent statistical requirements, it is necessary to which strict control experiment condition needs repeated multiple times experiment, and also shows that in practice brighter
Aobvious limitation.Traditional bioassary method is comparatively laborious, is difficult to accomplish really to standardize from worm sources, raising to measurement, and
And LD50 the or LC50 value found out by LD-p line is repeated lower with accuracy, when population resistance is lower and resistant population multiplicity
When be difficult Accurate Determining, therefore the resistance level measured often has hysteresis quality, is not suitable for getting up early Resistance detecting, is unfavorable for formulating
Corresponding Preventing Countermeasures.
The early detection of resistance, therefore the research of resistance monitoring and detection technique are depended in view of current many antagonism games
It is particularly important.With the diversification of resistance monitoring and testing goal, resistance monitoring means and method are also sent out towards diversification direction
Exhibition.Pest resistance to insecticide molecular detection technology is utilized based on setting up on the basis of understanding pest resistance to insecticide mechanism
Protocols in Molecular Biology detects the resistance locus of insecticide action target or the Enhanced expressing of metabolic detoxification enzyme gene.Based on can grasp
The reason of property made, practicability and economy etc., in terms of almost all of Resistance detecting research all concentrates on target resistance at present,
Detect the mutation of target gene.
Kdr gene can be used as the molecular labeling that insect generates resistance to pyrethroid, by monitoring kdr equipotential
Gene or genotype frequency understand state of the resistant gene in Genetic Constitution of Population.It is multinomial statistics indicate that discovery LC50 be generation
There are positive correlations between the effective cypermethrin resistance and aedes albopictus kdr gene frequency of table.Research illustrates Kdr base
A molecular labeling for generating resistance to pyrethroid because can be used as aedes albopictus, passes through monitoring kdr allele or base
Because of type frequency, understands state of the resistant gene in Genetic Constitution of Population, can predict the occurrence and development of resistance.
Summary of the invention
The present invention provides primer, probe and the methods of a kind of detection aedes albopictus drug resistance gene mutation, it can be achieved that fast
Prompt, easy, sensitive, accurate monitoring kdr allele or genotype frequency understand resistant gene in Genetic Constitution of Population
State is a kind of new method that is accurate, facilitating prediction aedes albopictus drug resistance occurrence and development.
It is described it is an object of the present invention to provide a kind of special primer pair of detection aedes albopictus drug resistance gene mutation
Primer pair is made of F and R, and the F has nucleotide sequence shown in SEQ ID №: 1 in sequence table, and the R has in sequence table
Nucleotide sequence shown in SEQ ID №: 2.
It is a further object to provide a kind of probe of detection aedes albopictus drug resistance gene mutation, the probes
At least one of including following 1) -6):
1) probe P1 has nucleotide sequence shown in SEQ ID №: 3 in sequence table；
2) probe P2 has nucleotide sequence shown in SEQ ID №: 4 in sequence table；
3) probe P3 has nucleotide sequence shown in SEQ ID №: 5 in sequence table；
4) probe P1 is that the 3 ' ends that will have the nucleotide of nucleotide sequence shown in SEQ ID №: 3 in sequence table increase MGB
It is prepared after group, 5 ' end flag F AM luminophores；
5) probe P2 is that the 3 ' ends that will have the nucleotide of nucleotide sequence shown in SEQ ID №: 4 in sequence table increase MGB
It is prepared after group, 5 ' end flag F AM luminophores；
6) probe P3 is that the 3 ' ends that will have the nucleotide of nucleotide sequence shown in SEQ ID №: 5 in sequence table increase MGB
It is prepared after group, 5 ' end label VIC luminophores.
It is also another object of the present invention to provide a kind of kit of detection aedes albopictus drug resistance gene mutation, the examinations
Agent box includes special primer pair of the present invention and/or at least one probe of the present invention.
At least one of specifically, the kit includes following 1) -3):
1) reagent A, the reagent A include special primer pair of the present invention, the present invention 5) described in probe P2 and this
Probe P3 described in invention 6)；
2) reagent B, the reagent B include special primer pair of the present invention, the present invention 4) described in probe P1 and this
Probe P3 described in invention 6)；
3) TaqMan reaction buffer.
It is also another object of the present invention to provide a kind of mutational sites of kdr gene in detection or auxiliary detection aedes albopictus
Method, the method includes use special primer pair of the present invention, at least one probe of the present invention and/or this
Invention at least one kit is detected.
Specifically, the described method includes:
TaqMan pcr amplification reaction is carried out to aedes albopictus to be measured using reagent A of the present invention, A reaction is obtained and produces
Object；TaqMan pcr amplification reaction is carried out to aedes albopictus to be measured using reagent B of the present invention, obtains B reaction product；
Detect A reaction product and B reaction product:
If A reaction product is in the equal no signal in the channel FAM and VIC, and B reaction product only has signal in the channel FAM, then described
Kdr gene is free of or candidate is without containing the mutational site, and the base of mutational site position is TTG/TTG；
If A reaction product in the channel FAM has signal and in the channel VIC no signal, and B reaction product is in the channel FAM and VIC
Equal no signal, then the kdr gene mutation site is or candidate is L1014C, and the base of mutational site position is TGT/
TGT；
If A reaction product has signal in the channel FAM no signal and in the channel VIC, and B reaction product only has in the channel VIC
Signal, then the mutational site of the kdr gene is or candidate is L1014F, and the base of mutational site position is TTT/TTT；
If A reaction product in the channel FAM has signal and in the channel VIC no signal, and B reaction product only has in the channel FAM
Signal, then the mutational site of the kdr gene is or candidate is L1014C, and the base of mutational site position is TTG/TGT；
If A reaction product has signal in the channel FAM no signal and in the channel VIC, and B reaction product is in the channel FAM and VIC
There is signal in channel, then the kdr gene mutation site is or candidate is L1014F, and the base of mutational site position is
TTG/TTT；
If A reaction product has signal in the channel FAM and the channel VIC, and B reaction product only has signal in the channel VIC, then
The kdr gene mutation site is or candidate is L1014F and L1014C；The base of mutational site position is TTT/TGT.
At least one of again specifically, the method also includes following 1) -4):
1) in the reaction system of the TaqMan pcr amplification reaction, the respective final concentration of primer is 9 μM；
2) in the reaction system of the TaqMan pcr amplification reaction, the respective final concentration of probe is 5 μM；
3) in the reaction system of the TaqMan pcr amplification reaction, using the genomic DNA of aedes albopictus to be measured as template；
4) annealing temperature of the TaqMan pcr amplification reaction is 60 DEG C -65 DEG C；It is preferred that annealing temperature is 60 DEG C.
It is also another object of the present invention to provide the genotype of kdr gene in a kind of detection or auxiliary detection aedes albopictus
Method, the method includes using special primer pair, at least one probe of the present invention and/or this hair of the present invention
Bright at least one kit is detected.
Specifically, the described method includes:
TaqMan pcr amplification reaction is carried out to aedes albopictus to be measured using reagent A of the present invention, A reaction is obtained and produces
Object；TaqMan pcr amplification reaction is carried out to aedes albopictus to be measured using reagent B of the present invention, obtains B reaction product；
Detect A reaction product and B reaction product:
If A reaction product is in the equal no signal in the channel FAM and VIC, and B reaction product only has signal in the channel FAM, then described
Kdr gene is to be free of or the candidate homozygous gene for not containing the mutational site；
If A reaction product in the channel FAM has signal and in the channel VIC no signal, and B reaction product is in the channel FAM and VIC
Equal no signal, then the kdr gene is or candidate is the homozygous gene containing mutational site L1014C；
If A reaction product has signal in the channel FAM no signal and in the channel VIC, and B reaction product only has in the channel VIC
Signal, then the kdr gene is or candidate is the homozygous gene containing mutational site L1014F；
If A reaction product in the channel FAM has signal and in the channel VIC no signal, and B reaction product only has in the channel FAM
Signal, then the kdr gene is or candidate is the heterozygous gene containing mutational site L1014C；
If A reaction product has signal in the channel FAM no signal and in the channel VIC, and B reaction product is in the channel FAM and VIC
There is signal in channel, then the kdr gene is or candidate is the heterozygous gene containing mutational site L1014F；
If A reaction product has signal in the channel FAM and the channel VIC, and B reaction product only has signal in the channel VIC, then
The kdr gene is or candidate is the heterozygous gene containing mutational site L1014F and L1014C.
At least one of again specifically, the method also includes following 1) -4):
1) in the reaction system of the TaqMan pcr amplification reaction, the respective final concentration of primer is 9 μM；
2) in the reaction system of the TaqMan pcr amplification reaction, the respective final concentration of probe is 5 μM；
3) in the reaction system of the TaqMan pcr amplification reaction, using the genomic DNA of aedes albopictus to be measured as template；
4) annealing temperature of the TaqMan pcr amplification reaction is 60 DEG C -65 DEG C；It is preferred that annealing temperature is 60 DEG C.
Of the invention a further object is offer special primer pair of the present invention, at least one spy of the present invention
The application of needle, at least one kit of the present invention, and/or any the method for the present invention.
At least one of specifically, the application includes following 1) -3):
1) application in detection aedes albopictus in kdr gene mutation site；
2) application in detection aedes albopictus drug resistance；
3) application in preparation detection aedes albopictus drug resistance product.
Any application does not include the diagnostic and therapeutic method of disease described in Patent Law Article 25.
Specifically, the mutational site is specially L1014F or L1014C.
Specifically, the drug resistance is anti-chrysanthemum esters medicine；The chrysanthemum esters medicine be specially decis, Permethrin or
Effective cypermethrin.
Specifically, the reagent A and the reagent B are independent packaging.
Specifically, the special primer pair, probe P1, probe P2 and probe P3 are independent packaging.
The beneficial effect comprise that
The experiment proves that the present invention provides a kind of quick, easy, sensitive aedes albopictus kdr to be mutated equipotential
Genetic test primer, probe, kit and method can be used to grasp aedes albopictus related to pyrethroid insecticides resistance
The situation of kdr allele monitor kdr allele or genotype frequency, understand resistant gene in Genetic Constitution of Population
State, can it is quick, easy, sensitive, accurate prediction resistance occurrence and development.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Do not make the experimental methods of molecular biology illustrated in following embodiments, referring to " Molecular Cloning:A Laboratory guide "
Listed specific method carries out in one book of (third edition) J. Pehanorm Brooker, or carries out according to kit and product description.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Following embodiments and its illustrate for explanation and understanding the present invention, do not constitute to improper limit of the invention
It is fixed.
Embodiment 1, the design of primer and probe
1, primer and the design of TaqMan-MGB probe
For resistance aedes albopictus sodium channel kdr two kinds of point mutation, three kinds of allele the case where, according to sequence signature,
Using three probes of PrimerExpress2.0 software design, it is directed to three kinds of allelic gene types respectively, in order to improve annealing
Temperature increases the specificity of sequence, increases the annealing temperature that MGB group improves probe sequence in 3 ' end of probe.
On 48 orifice plates of quantitative PCR apparatus, the parallel two pipes amplification of each sample design, the first pipe plus probe P1, P3 and
Non-specific primer F and R, the second pipe plus probe P2, P3 and non-specific primer F and R, according to ABI7500fast real-timePCR
The operating instruction of instrument, the FAM group of the first pipe are designed as brown, and VIC group is designed as green, the FAM group design of the second pipe
For red, VIC group is designed as green, the amplification curve of two pipes is read after end of run, and the color shown according to two pipes can be with
The allelic gene type of amplification is easily read, i.e. the probe 1 of detection L1014 and L1014C allele and probe 2 is in 5 ' labels
FAM luminophore, the probe 3 for detecting L1014F allele mark VIC luminophore 5 '.It will be in the first pipe when detection
FAM is set as red, and the FAM of the second pipe is set as brown, and VIC is set as green.TaqMan Universal Master Mix by
Taraka company provides.Probe 1-3 corresponds respectively to TGT, TTG and TTT codon.Primer that the present embodiment specifically designs and
TaqMan-MGB probe is as shown in table 1.
Table 1
| Title | Sequence | Tm value | Length | Number in sequence table |
| F | 5’GATCCAGATCATGAACGATGCCA 3’ | 58.4 | 23 | SEQ ID №: 1 |
| R | 5’CCCGCAGATGATGAAGAACACG 3’ | 59.1 | 22 | SEQ ID №: 2 |
| P1 | FAM 5’CACCACACAGTTTC 3’MGB | 70 | 14 | SEQ ID №: 3 |
| P2 | FAM 5’TCACCACCAAGTTT 3’MGB | 69.6 | 14 | SEQ ID №: 4 |
| P3 | VIC 5’CACCACAAAGTTTC 3’MGB | 68.5 | 14 | SEQ ID №: 5 |
In table 1, probe P1, P2 are respectively will have nucleotides sequence shown in SEQ ID №: 3, SEQ ID №: 4 in sequence table
3 ' the end of nucleotide of column is prepared after increasing MGB group, 5 ' end flag F AM luminophores.Probe P3 is will have sequence table
It is made after increasing MGB group, 5 ' end label VIC luminophores the 3 ' end of nucleotide of nucleotide sequence shown in middle SEQ ID №: 5
It is standby to obtain.
2, reaction system designs
In order to save again can testing goal sequence, devise double-tube method to detect aedes albopictus pair mutation alleles,
Probe P2, P3 and primers F and R form one group, for detecting allele L (TTG) and F (TTT)；Probe P1 and probe P3 and draw
Object F, R form one group, for detecting allele C (TGT) and F (TTT) mutation.
Reaction system (1) A group:
Reaction system (2) B group:
In above-mentioned reaction system (1) A group and reaction system (2) B group, the final concentration of primer is 9 μM, and the end of probe is dense
Degree is 5 μM.
TaqMan Universal Master Mix is 5 μ l/10 μ l, is purchased from Takara company.
Reaction condition:
Embodiment 2, the allele extraction of three kinds of sodium channel of TaqMan-MGB probe in detecting aedes albopictus mutation type are wild
The genomic DNA of 20 samples of aedes albopictus Natural Population of outer capture obtains the sample DNA that number is 1-20, by above-mentioned sample
Product DNA respectively with embodiment 1 design primer and probe, according to the reaction system of embodiment 1, reaction condition carry out it is two-tube simultaneously
Carry out the TaqMan PCR detection of A group and B group.
L1014F contains TTT for the allele of the 1014th amino acids in kdr gene；
L1014C contains TGT for the allele of the 1014th amino acids in kdr gene；
If without FAM group, VIC group signal in the first pipe, and only having FAM group signal in the second pipe, then sample is
L1014 homozygote, mutational site base are TTG；
If having FAM group in the first pipe, without VIC group signal, and without FAM group and VIC group signal in the second pipe, then
Sample is L1014C homozygote, base TGT；
If in the first pipe without FAM group, have VIC group signal, and in the second pipe only have VIC group signal, then be then sample
Product are L1014F homozygote, and mutational site base is TTT；
If having FAM group in the first pipe, having FAM group without VIC group signal, and in the second pipe, without VIC group signal,
Then sample is L1014C heterozygote, and mutational site base is TTG/TGT；
If in the first pipe without FAM group, have VIC group signal, and have FAM group and VIC group signal in the second pipe, then
Sample is L1014F heterozygote, and mutational site base is TTG/TTT；
If having FAM group and VIC group signal in the first pipe, and there was only VIC group signal in the second pipe, then sample is
L1014F and L1014C mutation, mutational site base are TTT/TGT.
Testing result is as shown in table 2 below.Table 2 is that TaqMan-MGB probe parallel double tube method is prominent to aedes albopictus kdr gene
Become allelic gene typing result.
Table 2
Note: the first pipe TGT codon is with FAM1 labeled as red, and TTT codon is with VIC labeled as green；Second pipe TTG
Codon FAM2 is labeled as comprehensive color, and TTT codon is with VIC2 labeled as green.
Embodiments of the present invention above described embodiment only expresses, the description thereof is more specific and detailed, but can not
Therefore limitations on the scope of the patent of the present invention are interpreted as, as long as skill obtained in the form of equivalent substitutions or equivalent transformations
Art scheme should all be fallen within the scope and spirit of the invention.
Sequence table
<110>Ningbo international travel health care center
<120>a kind of primer, probe and the method for the mutation of detection aedes albopictus drug resistance gene
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gatccagatc atgaacgatg cca 23
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
cccgcagatg atgaagaaca cg 22
<210> 3
<211> 14
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
caccacacag tttc 14
<210> 4
<211> 14
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
tcaccaccaa gttt 14
<210> 5
<211> 14
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
caccacaaag tttc 14
Claims (10)
1. a kind of special primer pair of detection aedes albopictus drug resistance gene mutation, the primer pair are made of F and R, feature
It is, the F has nucleotide sequence shown in SEQ ID №: 1 in sequence table, and the R has SEQ ID №: 2 in sequence table
Shown nucleotide sequence.
2. a kind of probe of detection aedes albopictus drug resistance gene mutation, which is characterized in that the probe includes following 1) -6) in
At least one:
1) probe P1 has nucleotide sequence shown in SEQ ID №: 3 in sequence table；
2) probe P2 has nucleotide sequence shown in SEQ ID №: 4 in sequence table；
3) probe P3 has nucleotide sequence shown in SEQ ID №: 5 in sequence table；
4) probe P1 is that the 3 ' ends that will have the nucleotide of nucleotide sequence shown in SEQ ID №: 3 in sequence table increase MGB base
It is prepared after group, 5 ' end flag F AM luminophores；
5) probe P2 is that the 3 ' ends that will have the nucleotide of nucleotide sequence shown in SEQ ID №: 4 in sequence table increase MGB base
It is prepared after group, 5 ' end flag F AM luminophores；
6) probe P3 is that the 3 ' ends that will have the nucleotide of nucleotide sequence shown in SEQ ID №: 5 in sequence table increase MGB base
It is prepared after group, 5 ' end label VIC luminophores.
3. a kind of kit of detection aedes albopictus drug resistance gene mutation, which is characterized in that the kit includes that right is wanted
Special primer pair described in asking 1 and/or at least one probe as claimed in claim 2.
4. kit according to claim 3, which is characterized in that the kit includes following 1) -3) at least one
Kind:
1) reagent A, the reagent A include special primer pair described in claim 1, claim 2 5) described in probe P2
With the 6 of claim 2) described in probe P3；
2) reagent B, the reagent B include special primer pair described in claim 1, claim 2 4) described in probe P1
With the 6 of claim 2) described in probe P3；
3) TaqMan reaction buffer.
5. a kind of method in the mutational site of kdr gene in detection or auxiliary detection aedes albopictus, which is characterized in that the method
Including use special primer pair described in claim 1, at least one probe as claimed in claim 2 and/or claim 3 or
At least one kit described in 4 is detected.
6. according to the method described in claim 5, it is characterized in that, which comprises
TaqMan pcr amplification reaction is carried out to aedes albopictus to be measured using reagent A as claimed in claim 4, A reaction is obtained and produces
Object；TaqMan pcr amplification reaction is carried out to aedes albopictus to be measured using reagent B as claimed in claim 4, B reaction is obtained and produces
Object；
Detect A reaction product and B reaction product:
If A reaction product is in the equal no signal in the channel FAM and VIC, and B reaction product only has signal in the channel FAM, then the kdr
Gene is free of or candidate is without containing the mutational site, and the base of mutational site position is TTG/TTG；
If A reaction product in the channel FAM has signal and in the channel VIC no signal, and B reaction product is in the equal nothing in the channel FAM and VIC
Signal, then the kdr gene mutation site is or candidate is L1014C, and the base of mutational site position is TGT/TGT；
If A reaction product has signal in the channel FAM no signal and in the channel VIC, and B reaction product only has signal in the channel VIC,
Then the mutational site of the kdr gene is or candidate is L1014F, and the base of mutational site position is TTT/TTT；
If A reaction product in the channel FAM has signal and in the channel VIC no signal, and B reaction product only has signal in the channel FAM,
Then the mutational site of the kdr gene is or candidate is L1014C, and the base of mutational site position is TTG/TGT；
If A reaction product has signal in the channel FAM no signal and in the channel VIC, and B reaction product is in the channel FAM and the channel VIC
There is signal, then the kdr gene mutation site is or candidate is L1014F, and the base of mutational site position is TTG/
TTT；
If A reaction product has signal in the channel FAM and the channel VIC, and B reaction product only has signal in the channel VIC, then described
Kdr gene mutation site is or candidate is L1014F and L1014C；The base of mutational site position is TTT/TGT.
At least one of 7. according to the method described in claim 6, it is characterized in that, the method also includes following 1) -4):
1) in the reaction system of the TaqMan pcr amplification reaction, the respective final concentration of primer is 9 μM；
2) in the reaction system of the TaqMan pcr amplification reaction, the respective final concentration of probe is 5 μM；
3) in the reaction system of the TaqMan pcr amplification reaction, using the genomic DNA of aedes albopictus to be measured as template；
4) annealing temperature of the TaqMan pcr amplification reaction is 60 DEG C -65 DEG C.
8. a kind of method of the genotype of kdr gene in detection or auxiliary detection aedes albopictus, which is characterized in that the method packet
It includes using special primer pair described in claim 1, at least one probe as claimed in claim 2 and/or claim 3 or 4
At least one kit is detected.
9. according to the method described in claim 8, it is characterized in that, which comprises
TaqMan pcr amplification reaction is carried out to aedes albopictus to be measured using reagent A as claimed in claim 4, A reaction is obtained and produces
Object；TaqMan pcr amplification reaction is carried out to aedes albopictus to be measured using reagent B as claimed in claim 4, B reaction is obtained and produces
Object；
Detect A reaction product and B reaction product:
If A reaction product is in the equal no signal in the channel FAM and VIC, and B reaction product only has signal in the channel FAM, then the kdr
Gene is to be free of or the candidate homozygous gene for not containing the mutational site；
If A reaction product in the channel FAM has signal and in the channel VIC no signal, and B reaction product is in the equal nothing in the channel FAM and VIC
Signal, then the kdr gene is or candidate is the homozygous gene containing mutational site L1014C；
If A reaction product has signal in the channel FAM no signal and in the channel VIC, and B reaction product only has signal in the channel VIC,
Then the kdr gene is or candidate is the homozygous gene containing mutational site L1014F；
If A reaction product in the channel FAM has signal and in the channel VIC no signal, and B reaction product only has signal in the channel FAM,
Then the kdr gene is or candidate is the heterozygous gene containing mutational site L1014C；
If A reaction product has signal in the channel FAM no signal and in the channel VIC, and B reaction product is in the channel FAM and the channel VIC
There is signal, then the kdr gene is or candidate is the heterozygous gene containing mutational site L1014F；
If A reaction product has signal in the channel FAM and the channel VIC, and B reaction product only has signal in the channel VIC, then described
Kdr gene is or candidate is the heterozygous gene containing mutational site L1014F and L1014C.
At least one of specifically, the method also includes following 1) -4):
1) in the reaction system of the TaqMan pcr amplification reaction, the respective final concentration of primer is 9 μM；
2) in the reaction system of the TaqMan pcr amplification reaction, the respective final concentration of probe is 5 μM；
3) in the reaction system of the TaqMan pcr amplification reaction, using the genomic DNA of aedes albopictus to be measured as template；
4) annealing temperature of the TaqMan pcr amplification reaction is 60 DEG C -65 DEG C.
10. described in special primer pair described in claim 1, at least one probe as claimed in claim 2, claim 3 or 4
At least one kit, and/or claim 5,6,7,8 or 9 any the methods application.
At least one of specifically, the application includes following 1) -3):
1) application in detection aedes albopictus in kdr gene mutation site；
2) application in detection aedes albopictus drug resistance；
3) application in preparation detection aedes albopictus drug resistance product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811296130.9A CN109234408B (en) | 2018-11-01 | 2018-11-01 | Primer, probe and method for detecting drug resistance gene mutation of aedes albopictus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811296130.9A CN109234408B (en) | 2018-11-01 | 2018-11-01 | Primer, probe and method for detecting drug resistance gene mutation of aedes albopictus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109234408A true CN109234408A (en) | 2019-01-18 |
| CN109234408B CN109234408B (en) | 2021-08-20 |
Family
ID=65080166
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811296130.9A Active CN109234408B (en) | 2018-11-01 | 2018-11-01 | Primer, probe and method for detecting drug resistance gene mutation of aedes albopictus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109234408B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242215A (en) * | 2011-07-13 | 2011-11-16 | 中国人民解放军军事医学科学院微生物流行病研究所 | Kit for detecting drug resistance of culex pipiens and special primer thereof |
| CN102373280A (en) * | 2011-11-03 | 2012-03-14 | 中国人民解放军军事医学科学院微生物流行病研究所 | Anopheles sinensis drug resistance AS-PCR (Polymerase Chain Reaction) detection kit and special primers thereof |
| CN105039563A (en) * | 2015-08-14 | 2015-11-11 | 珠海国际旅行卫生保健中心 | Probe identifying three aedes simultaneously on the basis of gene chip and kit |
| CN108707682A (en) * | 2018-06-21 | 2018-10-26 | 宁波国际旅行卫生保健中心 | One kind is for detecting the active fluorescence RAA primers of salmonella, probe and detection method |
-
2018
- 2018-11-01 CN CN201811296130.9A patent/CN109234408B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242215A (en) * | 2011-07-13 | 2011-11-16 | 中国人民解放军军事医学科学院微生物流行病研究所 | Kit for detecting drug resistance of culex pipiens and special primer thereof |
| CN102373280A (en) * | 2011-11-03 | 2012-03-14 | 中国人民解放军军事医学科学院微生物流行病研究所 | Anopheles sinensis drug resistance AS-PCR (Polymerase Chain Reaction) detection kit and special primers thereof |
| CN105039563A (en) * | 2015-08-14 | 2015-11-11 | 珠海国际旅行卫生保健中心 | Probe identifying three aedes simultaneously on the basis of gene chip and kit |
| CN108707682A (en) * | 2018-06-21 | 2018-10-26 | 宁波国际旅行卫生保健中心 | One kind is for detecting the active fluorescence RAA primers of salmonella, probe and detection method |
Non-Patent Citations (2)
| Title |
|---|
| HONG-WEI ZHANG等: "Knockdown resistance of Anopheles sinensis in Henan province, China", 《MALARIA JOURNAL》 * |
| SHINJI KASAI等: "First Detection of a Putative Knockdown Resistance Gene in Major Mosquito Vector, Aedes albopictus", 《JPN. J. INFECT. DIS.》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109234408B (en) | 2021-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Artika et al. | Real-time polymerase chain reaction: Current techniques, applications, and role in COVID-19 diagnosis | |
| Fang et al. | Comparison of real-time, quantitative PCR with molecular beacons to nested PCR and culture methods for detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples | |
| Struelens | Consensus guidelines for appropriate use and evaluation of microbial epidemiologic typing systems | |
| Huijsmans et al. | Single-nucleotide-polymorphism genotyping of Coxiella burnetii during a Q fever outbreak in The Netherlands | |
| Weller et al. | Evaluation of two multiplex real-time PCR screening capabilities for the detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis in blood samples generated from murine infection models | |
| Garg et al. | Evaluation of pan-dermatophyte nested PCR in diagnosis of onychomycosis | |
| Nörz et al. | Evaluation of a fully automated high-throughput SARS-CoV-2 multiplex qPCR assay with built-in screening functionality for del-HV69/70-and N501Y variants such as B. 1.1. 7 | |
| Wen et al. | Development of a PCR assay for the rapid detection and differentiation of ‘Candidatus Liberibacter solanacearum’haplotypes and their spatiotemporal distribution in the United States | |
| BR112012023698B1 (en) | MULTIPLEX TESTS, METHOD AND KIT FOR IDENTIFYING AND DIFFERENTIATING MRSA, MSSA, MRSE, MSSE, MSSE, MRCNS OR MSCNS | |
| Larsen et al. | Development of a rapid real-time PCR assay for quantitation of Pneumocystis carinii f. sp. carinii | |
| WO2006107670A2 (en) | In vitro association studies | |
| Yang et al. | Conversion strategy using an expanded genetic alphabet to assay nucleic acids | |
| Noh et al. | A high-throughput marker-assisted selection system combining rapid DNA extraction high-resolution melting and simple sequence repeat analysis: Strawberry as a model for fruit crops | |
| CN106555012A (en) | For the reagent of A type animal influenza Viral diagnosis, detection method and application | |
| Zhao et al. | A real-time PCR assay for rapid detection and quantification of Exserohilum rostratum, a causative pathogen of fungal meningitis associated with injection of contaminated methylprednisolone | |
| CN109468377A (en) | For the primer sets of antipsychotics related gene polymorphism site primer, kit and method | |
| Derzelle et al. | Use of high-resolution melting and melting temperature-shift assays for specific detection and identification of Bacillus anthracis based on single nucleotide discrimination | |
| Palladino et al. | Real-time PCR for the rapid detection of vanA and vanB genes | |
| Tibayrenc | Bridging the gap between molecular epidemiologists and evolutionists | |
| US20200332345A1 (en) | Methods of detecting and typing pathogenic strains of francisella tularensis | |
| Jones et al. | High‐throughput allelic discrimination of B and Q biotypes of the whitefly, Bemisia tabaci, using TaqMan allele‐selective PCR | |
| Frade et al. | Rapid quantification of drug resistance gene expression in Candida albicans by reverse transcriptase LightCycler PCR and fluorescent probe hybridization | |
| Gemmill et al. | Inter-simple sequence repeats (ISSR), microsatellite-primed genomic profiling using universal primers | |
| CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
| CN108531627A (en) | One kind is for detecting the streptococcic RPA fluorescent quantitations primer pair of B races, probe, kit and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |