CN110231480B

CN110231480B - Biological chip

Info

Publication number: CN110231480B
Application number: CN201910556357.0A
Authority: CN
Inventors: 杨华卫; 曾冀; 杨化莉
Original assignee: Individual
Current assignee: Individual
Priority date: 2017-06-14
Filing date: 2017-06-14
Publication date: 2023-03-28
Anticipated expiration: 2037-06-14
Also published as: CN110231479A; CN107389933B; CN110231480A; CN107389933A

Abstract

The invention relates to a biochip, and belongs to the technical field of biological detection. The biochip includes: a base and a plurality of chip handles mounted on the base in an array, the chip handles extending from the base in a direction perpendicular to the base in parallel with each other, and a chip reaction interface for labeling detection probes arranged at a free end of each chip handle. When the biochip is used for detection, all samples, reaction solution and washing solution are prepared and placed in the reaction tank, and the samples, the reaction solution and the washing solution are not required to be added or removed in a reciprocating manner, and the biochip is only required to be moved back and forth among the reaction tanks containing the samples, the reaction solution and the washing solution. A large number of detection steps and operating time can be saved.

Description

Biological chip

The application is a divisional application of a Chinese invention patent with the application date of 06 and 14 months in 2017 and the application number of 201710446886.6, and the invention name of the invention is 'a biochip'.

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a biochip.

Background

In the conventional membrane chip assay, each assay sample is added to the wells or grooves of the chip one by one in order to be incubated. Then, the incubated samples are removed from the wells or wells of the chip one by one, and washing solutions are sequentially added to the wells or wells for detection a plurality of times to wash. After washing, the reaction liquids are sequentially added to the wells or tanks for reaction, and the liquids after reaction need to be sequentially removed one by one. After the liquid after the reaction is removed, it is necessary to wash the well or tank for detection a plurality of times, remove the liquid in the well or tank, and keep it dry. Then, it is necessary to add the liquid as a detection signal to the reaction sequentially one well or one groove by one well. After the reaction, the assay data is read by adding the stop solution to each well or tank in sequence and mixing.

In the conventional detection of glass chips, each reaction sample solution is applied to the surface of the chip, and then the glass chip is enclosed in a plastic chip case and clamped. The chip box is placed in a water bath and heated for several hours or heated in an air bath overnight. And then taking out the chip box, detaching the chip box, taking out the chip and placing the chip into a beaker. Adding washing liquid for shaking washing twice, and then taking out the chip and drying. Then the chip scanner is put in for reading.

Therefore, the traditional chip has more detection steps and long detection time in the whole detection process.

Disclosure of Invention

In order to solve the technical problems, the technical scheme provided by the invention is as follows:

a biochip, comprising: a base and a plurality of chip handles mounted in an array on the base, the chip handles extending from the base in parallel with each other in a direction perpendicular to the base, and a chip reaction interface for labeling detection probes disposed at a free end of each chip handle.

As a further improvement of the above technical solution:

in one embodiment, the chip handle is a plastic rod and the detection probes are directly labeled at the free end of the chip handle.

The chip handle is made of plastic, the detection probe is directly marked at the free end of the plastic rod, the structure is simple, and the manufacturing cost is low.

In one embodiment, the chip reaction interface is arranged in a plane perpendicular to the longitudinal direction of the chip handle.

The chip reaction interface is arranged in a plane perpendicular to the longitudinal direction of the chip handle, and has a large cross-sectional area, and is therefore particularly suitable for use in a case where the reaction chamber is a flat shallow vessel. Therefore, the reaction interfaces of all the chips can be arranged on the same plane, and during detection, all the chip reaction interfaces can simultaneously form images once when displaying a detection result, so that the reading efficiency of the detection result is high, the design of a reader is simpler, and the cost can be reduced. Secondly, the shallow container enables the heating speed of the reaction liquid to be fast in the detection process, so that the reaction speed of the chip is also accelerated, and the detection efficiency is further improved. Moreover, because the chip reaction interface is perpendicular to the longitudinal direction of the chip handle, that is, regardless of the reaction step of the probe and the biomolecule to be detected, or the probe is in other steps such as washing, when the chip reaction interface is immersed in the solution, all the detection probes are maintained at the same level in the solution, so that the contact conditions of all the chip reaction interfaces and the solution are the same, and the contact conditions of all the probes on the chip reaction interfaces and the solution are also the same, the efficiency of measurement and the accuracy of the detection result are further increased to some extent, and the accuracy of the transverse comparison of the detection result of each solution to be detected is further increased.

In one embodiment, the chip handle is in the shape of a long strip, and a clamp for fixing the chip reaction interface is arranged on the end face of the free end of the chip handle.

The chip reaction interface is ensured to be in a plane perpendicular to the longitudinal direction of the chip handle and firmly fixed on the chip handle by the clamp.

The fixture is comprised of a first bracket mounted on the free end of the chip handle and a second bracket capable of cooperating with the first bracket to secure the chip reaction interface therebetween.

The two mutually matched supports have simple structure and convenient use, and can realize the effects of simply and quickly assembling and replacing the chip reaction interface.

In one embodiment, the chip handle is elongated and is provided with mounting holes on an end surface of a free end thereof. A chip reaction interface is disposed within the mounting hole.

The structure that the chip reaction interface is directly arranged in the mounting hole on the section of the free end of the chip handle is simple. The chip reaction interface can be arranged in the mounting hole in a clamping, bonding and other modes.

In one embodiment, the chip handle is a plastic rod and is provided with a fixing hole at its free end. The chip reaction interface is a sheet and is provided with a fixing column which is matched with the fixing hole. In this embodiment, the chip reaction interface is particularly easy to replace, which can be replaced together with the fixing posts. The installation is simple, as long as insert the fixed column on the chip reaction interface the fixed orifices of chip handle can. In addition, the reaction interface of the chip is a sheet, so that the reaction area is large enough, a large number of detection probes can be fixed on the chip, and the simultaneous detection of various biomolecules is realized. In addition, as mentioned above, all the probes are always on the same level during the detection process, so that the detection result is more accurate.

In one embodiment, the chip reaction interface is configured as a magnetic bead. The chip handle comprises a non-magnetic sleeve with a closed end surface at the free end and a magnetic rod arranged in the sleeve. This embodiment is particularly advantageous because advanced biomolecule detection can be achieved by magnetic beads using magnetic principles, for example, double antibody sandwich detection can be used in conjunction with chemiluminescent immunoassay to efficiently and accurately measure biomolecules. Secondly, in the invention, the magnetic bead can be adsorbed or desorbed on the non-magnetic sleeve by the magnetic rod at any time by adopting a matching mode of the magnetic rod, the non-magnetic sleeve and the magnetic bead, so that in the detection process, the magnetic bead can be separated from the non-magnetic sleeve and freely dispersed in the solution, and stirring or other measures can be taken during the process, so that the magnetic bead and the solution are fully contacted and reacted, the reaction effect of the probe on the magnetic bead and the to-be-detected biological molecules in the solution is optimized, and the detection accuracy is further improved. In addition, in this embodiment, the chip reaction interface, that is, the magnetic beads on which the detection probes are immobilized, is particularly easy to replace, and does not require any additional detachment or attachment process, and therefore, is more suitable for mass measurement.

The number of probes labeled on the reaction interface of the chip is 1 to 500, preferably 1 to 50.

The base support is a rectangular base support with a plurality of holes, and each hole is detachably clamped with the mounting end of one corresponding chip handle.

When the biochip is used for detection, all samples, reaction liquid and washing liquid are prepared and placed in the reaction tank, and the samples, the reaction liquid and the washing liquid do not need to be added or removed in a reciprocating manner, and the biochip only needs to be moved back and forth among the reaction tanks containing the samples, the reaction liquid and the washing liquid. Compared with the prior art that the detection of the chip requires a plurality of steps of adding each sample one by one, adding each reaction solution one by one, removing the reacted liquids one by one, and adding and removing the washing solutions one by one, the biochip saves a large number of detection steps and operation time. Also, such movement of the biochip back and forth between the reaction chambers can be performed by an automated chip detection apparatus, and the operation time can be further reduced.

Meanwhile, the chip handles connected with the chip reaction interface can be connected in series by the base, so that different chips can be combined. In this way, the same group of chips for detecting the same batch of samples can be ensured to operate synchronously in each step, and the steps and the detection time in the detection can be further saved. Secondly, the base can ensure that the same group of chips can keep a certain distance, and can prevent the mutual pollution of the chips caused by the cross of different reaction liquids. The combined three-dimensional chip synchronous operation can eliminate the reaction time difference among different samples and reduce the error rate of the operation. Compared with the prior art, the frequency of using the pipettor is reduced, and the consumption of tip heads is reduced, so that the cost is reduced.

Drawings

The invention will be described in more detail hereinafter on the basis of embodiments and with reference to the accompanying drawings. Wherein:

FIG. 1 schematically shows a biochip according to example 1 of the present invention;

FIG. 2 shows a schematic diagram of arrangement of the probes on the membrane and the detection results in example 1 of the present invention. Wherein FIG. 2a is a schematic diagram of arrangement of probes on the membrane, FIG. 2b is a graph of detection signal of the sample 01, and FIG. 2c is a graph of detection signal of the sample 02;

FIG. 3 schematically shows a biochip according to example 2 of the present invention;

FIG. 4 shows the arrangement of the probes on the reaction interface of the chip and the detection results in example 2 of the present invention. Wherein, FIG. 4a is a schematic diagram of the arrangement of the probes on the membrane, and FIGS. 4b, 4c, and 4d are graphs of the detection signals of the samples 03, 04, and 05, respectively;

FIG. 5 schematically illustrates another chip handle 3 that may be used in the present invention;

FIG. 6 schematically illustrates another chip handle 4 that may be used in the present invention;

FIG. 7 shows the arrangement of the probes on the reaction interface of the chip and the detection results in example 4 of the present invention. Wherein, FIG. 7a is a schematic diagram of the arrangement of the probes on the membrane, and FIGS. 7b and 7c are graphs of the detection signals of the samples 08 and 09, respectively;

FIG. 8 schematically illustrates another chip handle 5 that can be used in the present invention;

FIG. 9 is a line graph showing the results of thyroid hormone assay in example 5.

In the drawings, like parts are given like reference numerals. The figures are not drawn to scale.

Detailed Description

The invention will be described in further detail with reference to the following figures and specific examples, without thereby limiting the scope of protection of the invention.

Example 1

FIG. 1 schematically shows a biochip 10 according to an embodiment of the present invention. As shown in FIG. 1, the biochip 10 of the present embodiment includes a base 3. In this embodiment, the base 3 has the shape of an elongated plate in which a plurality of holes 8 are formed. The holes 8 are preferably arranged in an array. The biochip 10 further comprises several chip handles 2. In this embodiment, the chip handles 2 are elongated rectangular parallelepipeds, the number of which preferably corresponds one-to-one to the number of holes 8. Each chip handle 2 can be inserted into a corresponding hole 8 and held fixedly. It will be readily appreciated that a variety of means may be used to secure the chip handle 2 in the base 3, such as snapping, gluing, etc. In an embodiment not shown, the chip handle 2 is fixed to the base 3 in a removable manner.

According to the present invention, the biochip 10 further includes a chip reaction interface 1 for labeling detection probes. The chip reaction interface 1 is arranged in a plane perpendicular to the longitudinal direction of the chip handle 2. As shown in the figure, a clamp 4 for fixing a chip reaction interface is arranged on the end surface of the free end of the chip handle 2. The fixture can ensure that the chip reaction interface is in a plane perpendicular to the longitudinal direction of the chip handle and is firmly fixed on the chip handle. The fixture 4 includes a first support 41 mounted on the free end of the chip handle 2, and a second support 42 capable of cooperating with the first support 41 to secure the chip reaction interface 1 therebetween. The first and

second supports

41 and 42 are configured as supports having hollow regions, such as i-shaped supports, so that the chip reaction interface 1 can be exposed through the hollow regions thereof. Such a jig 4 has a simple structure, is easy to use, and can achieve the effect of easily and quickly assembling and replacing the chip reaction interface 1.

The chip reaction interface 1 may be an NC membrane labeled with a detection probe, or may be a nylon membrane, plastic, glass, ceramic, or the like. The number of probes labeled on the reaction interface 1 of the chip may be 1 to 500, preferably 1 to 50.

When the biochip is used for detection, the above-mentioned base can connect the chip handles connected with the reaction interface of the chip in series, so as to realize the combination of different chips. Thus, the same group of chips for detecting the same batch of samples can be ensured to be synchronously operated in each step, and the steps and the detection time in the detection can be saved.

The substrate can ensure that the same group of chips can keep a certain distance from each other, and can prevent the mutual pollution between the chips caused by the cross of different reaction liquids. The combined three-dimensional chip synchronous operation can eliminate the reaction time difference among different samples and reduce the error rate of the operation. Compared with the prior art, the frequency of using the pipettor is reduced, and the consumption of tip heads is reduced, so that the cost is reduced.

Secondly, when the biochip is used for detection, all samples, reaction solution and washing solution are prepared and placed in the reaction tank, and do not need to be moved back and forth for addition or removal, and the biochip only needs to be moved back and forth among the reaction tanks containing the samples, the reaction solution and the washing solution. Compared with the prior art that the detection of the biochip requires a plurality of steps of adding each sample one by one, adding each reaction solution one by one, removing the reacted liquids one by one, and adding and removing the washing solutions one by one, the invention saves a large number of detection steps and operation time. In addition, the biochip of the present invention can be moved back and forth between the reaction chambers by an automated chip detection apparatus, and the operation time can be further reduced.

Again, the chip reaction interface is disposed in a plane perpendicular to the longitudinal direction of the chip handle, and has a large cross-sectional area, and is therefore particularly useful where the reaction chamber is a flat, shallow vessel. Therefore, the reaction interfaces of all the chips can be arranged on the same plane, and during detection, all the chip reaction interfaces can simultaneously form images once when the detection results are displayed, so that the reading efficiency of the detection results is high, the design of the reader is simpler, and the cost can be reduced. Secondly, the shallow container enables the heating speed of the reaction liquid to be fast in the detection process, so that the reaction speed of the chip is also accelerated, and the detection efficiency is further improved.

The application of the biochip according to the embodiment of the present invention is described below by way of a specific example in which the biochip shown in FIG. 1 is used.

Example 1

In this example, the identification of human papillomavirus genotypes, in particular for detecting common types of HPV nucleic acids (HPV 16, HPV18, HPV6, HPV 11) is performed using a biochip as shown in fig. 1.

HPV16 and HPV18 belong to the most common high-risk human papilloma viruses, which cause cervical cancer in women; HPV6 and HPV11 belong to the most common low-risk type of human papillomavirus, causing condyloma acuminatum. There are currently vaccines against these 4 types of human papillomavirus.

The steps of the method for human papillomavirus identification using the biochip shown in FIG. 1 are described below.

Step 1: preparation of chip reaction interface with immobilized HPV genotyping probes

Design synthesis of each HPV probe:

HPV16 probe sequence: TTTTTTTTCTGAAGTAGATATGGCAGC

HPV18 probe sequence: TTTTTTTTTATTGCCCAGGTACAGGA

HPV6 probe sequence: TTTTTTTTTTGGAAGATGTAGTTACGGA

HPV11 probe sequence: TTTTTTTTTTCAGATTTAGACACACAKACATGC

Positive control probe: TTTTTTTTTTTTAACTGCAGCTTGGACTACGC

Negative control probe: TTTTTTTTTTATGCCTTTAAGCATGGCA

Positive control target sequence: GCGTAGTCCAAGCTGCAGTT (biotin label, capable of hybridization reaction with positive control probe)

Preparing a probe solution: probes were prepared and diluted to 10 μ M concentration using TE buffer (buffer formulated with Tris and EDTA).

Immobilization of probe on membrane chip (chip reaction interface 1): spotting on nitrocellulose membrane (10 XSSC buffer solution for 5min, oven drying), spotting 1 μ L of the above 6 probe solutions on the membrane, oven drying at 80 deg.C for 2hr. Two membranes were prepared in which the above-mentioned probes were immobilized.

The arrangement of the probes on the membrane is schematically shown in FIG. 2a.

The film for fixing the probe is clamped at the tail end of a plastic rod (a chip handle 2), is vertical to the plastic rod, is clamped by an I-shaped bracket, and is connected to the tail end of a base support for fixing. Drying, sealing and storing. During detection, the membrane at the tail end of the plastic rod is soaked in a solution to perform operations such as chip hybridization, washing, color development and the like.

And 2, step: test sample preparation

Sample 01

Sample 02 hpv11 nucleic acid sample

HPV universal primer sequences, taq enzymes and the like are used for preparing PCR system amplification samples 01 and 02. The upstream primer sequence Y03: gaaataaactgtaaatcatattc (biotin label); the downstream primer sequence Y04 is TTTGTTACTGTGGTAGATACTACAC and is prepared into 20 mu M concentration.

Preparation of PCR amplification reaction system (50. Mu.L):

PCR reaction procedure: 95 ℃ for 5min;95 ℃,1min,50 ℃,0.5min,65 ℃,1min,35cycles;72 ℃ for 5min. The PCR product was stored at-20 ℃ until use.

And 3, step 3: detection

1) 2 1.5ml EP tubes were labeled and added with 1ml of the usual phosphate buffer (3 XSSPE) and 10. Mu.L (10. Mu.M) of the positive control sequence target. Then 20. Mu.L of PCR products from 2 samples (01 and 02) were added, denatured by heating at 95 ℃ for 10min, removed and treated with an ice-water mixture.

2) Preparing a 24-well plate, selecting 2 wells for marking, and correspondingly adding the samples processed in the step 1) into the wells.

3) 2 prepared film chips were taken out and marked. Then inserted into the two holes, and incubated in a water bath at 48 deg.C for 1hr.

4) The membrane chip was removed and transferred to two other cells to which 1ml of buffer 1 (0.1M Tris-HCl, pH7.5;0.1M NaCl) for 2min.

5) The detection step 4) is repeated once.

6) The membrane chip was removed and transferred to two additional wells containing 1ml streptavidin solution (1. Mu.g/ml diluted with buffer 1 containing 3% Bovine Serum Albumin (BSA)), and incubated in a 42 ℃ water bath for 30min.

7) The membrane chip was taken out and transferred to another two cells to which 1ml of buffer 2 (0.1M Tris-HCl, pH9.5;0.1M NaCl;50M MgCl ₂ ) In the holeAnd then shaken for 2min.

8) The detection step 7) is repeated once.

9) The membrane chip was taken out, transferred to two other wells to which 0.5ml of a developing solution (mixed solution of NBT solution and BCIP solution) was added, and developed at room temperature for 10min.

10 Take out the membrane chip, rinse twice in water, and read the result.

The results are shown in FIG. 2 and Table 1 below.

TABLE 1

The sample detection method has the advantages that two chip reaction interfaces are used for simultaneously detecting two samples respectively, the number of the chip reaction interfaces and the number of the samples to be detected can be increased according to needs by analogy, all the samples to be detected can be simultaneously detected through simultaneous operation, and the detection efficiency is improved.

Example 2

FIG. 3 schematically shows a biochip 11 according to an embodiment of the present invention. As shown in FIG. 3, the biochip 11 of the present embodiment includes a base 31. In this embodiment, the base 31 has a plate shape in which a plurality of holes 81 are opened. The holes 81 are preferably arranged in an array. The biochip 11 further comprises several chip handles 21. In this embodiment, the chip handles 21 are elongated rectangular parallelepipeds, the number of which preferably corresponds one-to-one to the number of holes 81. Each chip handle 21 is inserted into a corresponding hole 81 and is fixedly held. It will be readily appreciated that a variety of means may be used to secure the die shank 21 in the base 31, such as snapping, gluing, etc. In an embodiment not shown, the chip handle 21 is fixed to the base 31 in a removable manner.

According to the present invention, the biochip 11 further comprises a chip reaction interface 12 for labeling detection probes. The chip reaction interface 12 is arranged in a plane perpendicular to the longitudinal direction of the chip handle 21. As shown in the drawing, the chip handle 21 is elongated and is provided with a mounting hole 5 on an end face of a free end thereof. Each chip reaction interface 12 is arranged in a corresponding mounting hole 5. The chip handle 21 has a simple structure and is easy to mount.

The chip reaction interface 12 is a glass chip. The number of probes labeled on the reaction interface 12 of the chip may be 1 to 8.

The application of the biochip according to the embodiment of the present invention is described below by way of a specific example, in which the biochip shown in FIG. 3 is used.

Example 2

In this example, 4 mycobacterial nucleic acids were detected using the biochip shown in FIG. 3 for mycobacterial identification. There are many kinds of clinically induced mycobacterium species, and among them, mycobacterium tuberculosis, mycobacterium avium, mycobacterium intracellulare, mycobacterium kansasii and the like are frequently found.

The reaction interface of the chip in this example 2 is a glass chip, and the detection signal is labeled with fluorescence. In this example 2, the slide glass on which the mycobacterial probe was immobilized was inserted into the end hole of the plastic rod, perpendicular to the plastic rod. During detection, the slide at the tail end of the plastic rod is soaked in the solution to perform operations such as chip hybridization, washing, fluorescence signal scanning and the like.

The steps of the method for identifying and identifying Mycobacterium using the biochip shown in FIG. 3 are described below.

Step 1: preparation of mycobacterium identification gene typing glass chip

Probes were designed to synthesize each mycobacterium species:

mycobacterium tuberculosis probe TBTTTTTTTTTTTTTTTTTTAAGACATGCATCCGT

Mycobacterium avium probe: TTTTTTTTTTTTTTTTCATGCGGTCTGAGGTC

M. intracellulare probe: TTTTTTTTTTTTTTTTTTTTAAGACATGCGCCCTAAA

Mycobacterium kansasii probe: TTTTTTTTTTTTTTTTCGCCAAGTGGTCCTAT

Positive control probe: TTTTTTTTTTTTTTTTTTAACTGCAGCTTGGACTACGC

Negative control probe: TTTTTTTTTTTTTTTTTTTTATGCCTTTAAGCATGGCA

Positive control target sequence: GCGTAGTCCAAGCTGCAGTT (5' fluorescein CY3 label capable of hybridizing with a positive control probe)

Preparing a probe solution: the probe was prepared and diluted to a concentration of 10. Mu.M using TE solution.

Immobilization of probe on slide: spotting, 0.2. Mu.L of each of the above 6 probe solutions was spotted on an amino-modified slide glass. And placing the spotted substrate in an oven at 80 ℃ for heat preservation for 80 minutes to enhance the fixing effect. The chip with the probe fixed thereon is immersed in ultrapure water at 60 ℃ for shaking for 1 minute, and then dried for standby.

The probe arrangement is shown in FIG. 4a.

The probe-fixing slide is inserted into the end hole of the plastic rod and connected to the plastic rod for fixing. Drying and sealing, and storing at-20 deg.C.

Step 2: test sample preparation

Sample 03 Mycobacterium avium nucleic acid sample

Sample 04: m. intracellulare nucleic acid sample

Negative sample 05 sterile water

PCR system amplification samples 03 and 04 were prepared using primer sequences of 16SDNA gene, taq enzyme, and the like.

The upstream primer sequence Y01 is GG TGG CTC AGG ACG AAC G (5' end fluorescein CY3 mark); downstream primer sequence Y02 GGCT TGC GCC CAT TGT G, prepared to 20 μ M concentration.

Preparation of PCR amplification reaction system (50. Mu.L):

PCR reaction procedure: at 95 ℃ for 10min;95 ℃,2min,50 ℃,1min,68 ℃,1min,35cycles;72 ℃ for 5min. The PCR product was stored at-20 ℃ until use.

And step 3: detection of

1) 3 1.5ml EP tubes were labeled and 1ml of the usual phosphate buffer (3 XSSPE) and 10. Mu.L (10. Mu.M) of the positive control sequence target were added. Then 20. Mu.L of PCR products from 2 samples (03, 04, and 05) were added, denatured by heating at 95 ℃ for 10min, removed and treated with an ice-water mixture.

2) Preparing a 24-well plate, selecting 3 wells for marking, and correspondingly adding the samples processed in the step (1) into the wells.

3) 3 prepared chips were taken out and labeled. Then inserted into the above 3 holes respectively, and incubated in a water bath at 48 deg.C for 0.5hr.

4) The glass chip was removed, transferred to another 3 wells to which 1ml of 0.2 XSSC solution (pH 7.0, containing 1.75g NaCl per 1000ml solution, 0.88g sodium citrate) was added, and washed with shaking for 2min.

5) The glass chip was transferred to pure water and shaken for 2min.

6) And taking out the glass chip, drying, taking down the embedded glass slide, and putting the glass slide into a chip fluorescence scanner to scan a fluorescence signal to interpret the result.

The results of the measurements are shown in Table 2 and FIG. 4 below.

TABLE 2

The sample analyzer uses three chip reaction interfaces to respectively and simultaneously measure three samples, and by analogy, the number of the chip reaction interfaces and the number of the samples to be detected can be increased according to needs, and all the samples to be detected can be simultaneously detected by simultaneous operation, so that the detection efficiency is improved.

Fig. 5 schematically illustrates another chip handle 22 that may be used in the present invention. The chip handle 22 is constructed as a plastic rod. One end of each plastic rod is arranged on the base, and the detection probe is directly marked at the free end of the plastic rod. The structure is simple and the manufacturing cost is low.

The application of the biochip using the present chip handle configuration will be described below by way of a specific example, in which the biochip shown in FIG. 5 is used.

Example 3

In this example, a biochip of the chip handle configuration as shown in FIG. 5 was used for the hepatitis B surface antigen (HBsAg) double antibody sandwich assay. The chip handle is made of Polystyrene (Polystyrene, abbreviated as PS) with the diameter of 1-10 mm, and the tail end of the chip handle is marked with anti-HBsAg antibody.

The steps of the method for detecting hepatitis B surface antigen (HBsAg) by the double antibody sandwich method using the biochip having the chip handle structure shown in FIG. 5 will be described below.

Step 1: anti-HBsAg antibody coated on the end of plastic chip rod

In a test tube, the anti-HBsAg is diluted to a working concentration of 3 mu g/ml by using 0.05mol/L, pH9.6 carbonate buffer solution, and the coating solution is obtained. Immersing the end of the plastic chip rod in the coating solution, and incubating at 37 deg.C for 2hr; transferring the chip rod into a test tube added with carbonate solution, and shaking and washing; transferring the chip rod into BSA carbonate solution (250. Mu.l/tube) containing 1% (v/v), and incubating at 37 ℃ for 2hr; and transferring the chip rod into a test tube added with carbonate solution, shaking and washing, and drying for later use.

Step 2: detection

1) 3 chip detection bars were removed and labeled. Samples to be tested H1, H2, and H0 were added to 3 tubes (or 3 wells of a 96-well plate). Wherein H0 is the sample dilution 5% BSA-0.1MPBS, pH7.2. These chip rods were added to different tubes and incubated at 37 ℃ for 30min.

2) Transferring 3 chip detection rods into a group of test tubes (3) containing 0.1% Tween20, and washing with Tris-HCl solution (pH 7.4) containing 0.02M for 3min; then the chip detection rod is transferred into a second group of test tubes (3) containing washing liquid, and is shaken and washed for 3min; the chip detection bar is then transferred to a third group of test tubes (3) containing the washing solution, and the test tubes are shaken and washed for 3min.

3) The 3 chip detection rods were transferred to a set of tubes (3) to which a diluted (1.

4) Repeating the detection step 2).

5) Transferring 3 chip detection rods into the detection rods with color development liquid H ₂ O ₂ And a set of 3 test tubes (labeled) with color developing solution Tetramethylbenzidine (TMB). The reaction was carried out at room temperature for 15min.

6) The chip detection rod was removed, a stop solution (0.1M sulfuric acid solution) was added and mixed, and the OD value of each well was measured at a wavelength of 450 nm.

The results of the measurements are shown in Table 3 below.

TABLE 3

Therefore, the detection method provided by the invention is used for detecting the hepatitis B surface antigen, and an accurate detection result is obtained. In example 3, three chip reaction interfaces are used to simultaneously measure three samples respectively, and by analogy, the number of the chip reaction interfaces and the number of the samples to be measured can be increased as required, and by simultaneous operation, all the samples to be measured can be simultaneously detected, thereby improving the detection efficiency.

Comparative example 1: traditional ELISA method for detecting hepatitis B surface antigen

Step 1: enzyme label plate coating

The anti-HBsAg is diluted to the working concentration of 3 mu g/ml by 0.05mol/L and 0.05mol/L, pH9.6 carbonate buffer solution, and the coating solution is obtained. Adding coating solution into blank 96-well enzyme-labeled plate, and incubating at 37 deg.C for 2hr; discarding the coating solution and washing with carbonate solution and then adding a solution containing 1% BSA carbonate (250. Mu.l/well) and incubating at 37 ℃ for 2hr; the blocking solution was discarded and washed with carbonate solution and dried for use.

And 2, step: detection of

1) And taking out the enzyme label plate and marking. Individually adding the test samples H4, H5 and H0b to the three wells, wherein H0b is the specimen dilution 5% BSA-0.1M PBS, pH7.2. Incubate at 37 ℃ for 30min. The compositions of H4, H5 and H0b are the same as H1, H2 and H0, respectively.

2) The liquid in the three wells is washed out one by using a pipette gun and discarded, and then the washing liquid is sucked by using the pipette gun to wash the three wells one by one for 3 times, and then the washing liquid is sucked out one by one.

3) Diluted enzyme-labeled antibody (anti-HBsAg-HRP, 100. Mu.l/well, 1 dilution) was added well by well with a pipette gun and incubated at 37 ℃ for 30min.

4) Repeating the detection step 2), and beating the liquid in the hole dry.

5) Adding developing solution H hole by using pipette ₂ O ₂ And reacting with tetramethyl benzidine (TMB) as color development liquid at room temperature for 15min.

6) Add the stop solution (0.1M sulfuric acid solution) well by well with a pipette and read the optical density.

The results are shown in table 4 below:

TABLE 4

As can be seen from the results in tables 3 and 4, the detection result of the biochip of the present invention for hepatitis B surface antigen is comparable to the detection result of the biochip prepared by the traditional ELISA method. However, in terms of the detection process, the detection method provided by the invention is obviously more convenient than the traditional ELISA detection method, and the complicated steps that each processing step needs to be carried out hole by hole are omitted, so that the detection efficiency is greatly improved; moreover, due to the synchronization of each processing step of the plurality of samples, the detection method of the present invention avoids the possibility of cross-contamination between samples, as compared to conventional one-by-one processing. Example 3 and comparative example 1 only schematically test 3 samples, and the above advantages of the present invention will be more prominent when a large displacement is required to test a plurality of samples, for example, tens or even hundreds of samples.

Fig. 6 schematically shows another chip handle 23 that can be used in the present invention. The chip handle 23 is constructed as a plastic rod and is provided with a fixing hole 6 at its free end. The chip reaction interface 13 is a sheet and is provided with fixing posts 7 for cooperating with the fixing holes 6. The chip reaction interface 13 is arranged in a plane perpendicular to the longitudinal direction of the chip shank 23.

The application of the biochip using the present chip handle configuration is described below by way of a specific example.

Example 4

In this example, 4 HPV nucleic acids, HPV16, HPV18, HPV6 and HPV11, were detected using a biochip of the chip handle configuration as shown in fig. 6.

In this example 4, a plastic chip is used as a chip reaction interface, and an HRP catalyzed chemiluminescence method is adopted as a signal detection method. The circular thin sheet made of Polystyrene (PS) material on which the HPV probe nucleic acid is fixed is inserted into a fixing hole 7 at the end of the plastic rod through a fixing column at the center and is perpendicular to the plastic rod. During detection, the fixed membrane is soaked in solution for chip hybridization, washing, chemiluminescence and other operations. The PS material can adsorb proteins including Streptavidin (SA) and the like, and then immobilize the probe by binding biotin-labeled nucleic acid to SA.

The steps of the method for detecting 4 HPV nucleic acids, HPV16, HPV18, HPV6 and HPV11, using the biochip of the chip handle configuration shown in FIG. 6 are described below.

Step 1: manufacturing of HPV genotyping horizontal plastic chip

Design synthesis of each HPV probe:

HPV16 probe sequence: bio-CTGAAGTAGATATGGCAGC

HPV18 probe sequence: bio-ATTGCCCAGGTAACAGGA

HPV6 probe sequence: bio-GGAAGATGTAGTTACGA

HPV11 probe sequence: bio-CAGATTTAGACACACAKATGC

Positive control probe: bio-AACTGCAGCTTGGACTACGC

Negative control probe: bio-ATGCCTTTAAGCATGGCA

Positive control target sequence: DIg-GCGTAGTCCAAGCTGCAGTT (digoxin label, capable of hybridization reaction with positive control probe)

Preparing a probe solution: the probe was prepared and diluted to 5. Mu.M concentration using TE solution.

Pre-treatment of circular plastic (PS material) sheets for custom processing: the ultrasonically cleaned plastic chips were air-dried, transferred to a streptavidin solution (diluted with 100mM Tris solution at pH 7.0) at a concentration of 1. Mu.g/ml, incubated at 37 ℃ for 1hr, transferred to 100mM Tris solution at pH7.0, shaken for 5min, and then transferred to pure water for 5min.

Fixing the probe on a circular plastic sheet: 0.5. Mu.L of each of the above 6 probe solutions was applied to a plastic plate, and incubated at 37 ℃ for 1hr while keeping moisture. The disc is transferred into pure water to be shaken and washed for 2min and dried.

The probe arrangement is shown in FIG. 7a.

The circular plastic piece for fixing the probe is embedded into the end of the plastic rod. Drying, sealing and storing.

Step 2: test sample preparation

Sample 08: HPV16 nucleic acid samples

Sample 09: HPV11 nucleic acid sample

HPV universal primer sequences, taq enzymes and the like are used for preparing PCR system amplification samples 08 and 09. The upstream primer sequence Y03D: gaaataaactgtaaatcatattc (digoxin marker); the downstream primer sequence Y04 is TTTGTTACTGTGGTAGATACTAC, and is prepared into 20 mu M concentration.

Preparation of PCR amplification reaction system (50. Mu.L):

And step 3: detection of

1) 2 1.5ml EP tubes were labeled and added with 1ml of the usual phosphate buffer (3 XSSPE) and 10. Mu.L (10. Mu.M) of the positive control sequence target. Then 20. Mu.L of the PCR products of 2 samples (08 and 09) were added, denatured by heating at 95 ℃ for 10min, and taken out and placed in an ice-water mixture.

2) Preparing a 24-well plate, selecting 2 wells for marking, and correspondingly adding the sample treated in the step 1) into the wells.

3) 2 prepared plastic chips were taken out and marked. Then inserted into the two holes, and incubated in a water bath at 48 deg.C for 1hr.

4) The plastic chip was removed and transferred to another two chips containing 1ml of buffer 3 (0.1M Tris-HCl, pH7.5;0.15M NaCl) for 2min.

5) The detection step 4) is repeated once.

6) The plastic chip was removed and transferred to two additional anti-DIG-HRP diluted with buffer 3 to 150mU/ml (explain: 150 milliunits per ml) and incubated at room temperature for 30min.

7) The plastic chip was removed, transferred to two additional wells containing buffer 3 and shaken for 2min.

8) The plastic chip was removed and transferred to two other chips containing 1ml of buffer 4 (0.1M Tris-HCl, pH9.5; 0.15M NaCl,10mM MgCl ₂ ) The wells were then washed with shaking for 2min.

9) The plastic chip was taken out, transferred into two other wells to which 0.2ml of a luminescent liquid (comprising luminescent liquid I (aminophthalimide, enhancer) and luminescent liquid II (oxidant) was mixed) was added, and a luminescence signal was recorded from the empty bottom using a chemiluminescence apparatus. Imaging with a cold CCD (e.g. a solar chemiluminescence imaging system) from the bottom.

The results of the measurements are shown in Table 5 and FIG. 7 below.

TABLE 5

In this example, one chip can detect multiple indexes simultaneously, which is an excellent choice for clinical detection.

Fig. 8 schematically illustrates another chip handle 24 that may be used in the present invention. The chip handle 24 includes a non-magnetic sleeve 241 with a closed end at the free end, and a magnetic rod 242 disposed within the sleeve. The chip reaction interface 14 is configured as a magnetic bead. When the magnetic rod 242 is inserted into the sleeve 241, the magnetic rod 242 may apply a magnetic attraction force to the magnetic beads, causing the magnetic beads to be attracted to the end surface of the sleeve 241. Thereby, the subsequent operation can be performed. When the operation is finished, the magnetic rod 242 can be pulled out from the sleeve 241, and the magnetic beads can fall off from the sleeve 241 for subsequent processing.

Example 5

In this example, thyroid hormone (TSH) was detected using a biochip constructed with a chip handle as shown in FIG. 8.

Thyroid hormone (TSH) is a main factor for regulating and controlling growth of thyroid cells and synthesis and secretion of thyroid hormone, can reflect thyroid function state by detecting blood TSH level, and is beneficial to screening, diagnosis, treatment effect judgment and prognosis judgment of thyroid diseases.

The relevant parameters of this example 5 are as follows: double antibody sandwich method; enzymatic chemiluminescence, in which TSH antibody is labeled with horseradish peroxidase (HRP), luminol, hydrogen peroxide, is chosen as the luminescent substrate. When the magnetic rod is inserted into the bottom of the hollow plastic rod, the magnetic beads are adsorbed at the tail end of the plastic rod, and when the magnetic rod is pulled away, the magnetic beads can be separated from the plastic rod and fall off. The anti-TSH monoclonal antibody used for capturing is coated on the magnetic beads, the antibody is connected to the carboxylated magnetic beads through carbodiimide, and the other antibody is used for labeling HRP.

The steps of the method for detecting thyroid hormone (TSH) using the biochip of the chip handle configuration shown in FIG. 8 are described below.

Step 1: coating of magnetic beads and assembly of magnetic bead adsorption chip

Activation of magnetic beads: 1mg of carboxyl magnetic beads (about 100 mu l of magnetic suspension) are put into a centrifuge tube and are vibrated on a sample mixer for 5-10 min; placing the centrifugal tube on a magnetic separation frame, and taking out supernatant when the magnetic beads are completely adsorbed; the beads were washed by adding 1ml of a 15mM MES (pH 6.0) solution and the washing was repeated once; resuspending the magnetic beads using 100. Mu.L of 15mM MES (pH 6.0), adding 100. Mu.L (10 mg/ml) of carbodiimide (EDC) solution, and preparing with the pre-cooled solution, wherein the solution is ready for use; mixing, and activating at room temperature for 30min.

Coating magnetic beads: washing the activated magnetic beads once with 1ml of 15mM MES (pH 6.0), magnetically separating, and discarding the supernatant; mu.L of a 15mM MES (pH 6.0) solution containing anti-TSH monoclonal antibody (50. Mu.g) was added thereto and reacted at room temperature overnight to obtain immunomagnetic beads.

And (3) storage: the coated beads were washed 2 times with 1ml of PBST and resuspended in 1ml of PBS containing 0.1% bovine serum albumin. And (3) inserting the magnetic rod into a hollow plastic rod, inserting the magnetic rod into the bottom of a centrifuge tube storing anti-TSH marked magnetic beads, taking out the magnetic rod after complete adsorption, sealing and keeping at 4 ℃ for later use.

Step 2: preparation of horseradish peroxidase-labeled TSH antibody

The horseradish peroxidase-labeled TSH antibody was prepared by the sodium periodate method, and then dialyzed overnight against 0.01M phosphate buffer (pH7.4), followed by storage at-20 ℃ with the addition of an equal amount of glycerol. The feeding ratio of the horseradish peroxidase to the anti-TSH monoclonal antibody is 1.

And step 3: detection of

1) Preparation of TSH antigen standard

The TSH antigen is dissolved in inactivated calf serum after being calibrated to prepare a standard solution with TSH of 0, 0.1, 0.5, 4, 10, 20 and 50 mIU/L.

2) And 6 magnetic bead adsorption chip detection rods are taken out and marked. 100 μ L of each of the above 6 standard samples were added to 6 wells of the chemiluminescent plate, and 100 μ L of each of horseradish peroxidase-labeled TSH antibody diluted to 1. And correspondingly adding the chip rods into different tubes, pumping out the chip rods, dispersing the magnetic beads into the solution, removing the plastic rods, uniformly mixing by oscillation to disperse the magnetic beads into the solution, and incubating at 37 ℃ for 40min.

3) The magnetic rod is inserted into the hollow plastic rod, transferred into the reaction solution, and stirred gently to enable the magnetic beads in the solution to be adsorbed to the tail end of the plastic rod again.

4) Transferring the 6 magnetic bead adsorption chip detection rods into 6 wells containing 0.02M Tris-HCl solution (pH 7.4) with washing solution, wherein the washing solution contains 0.1% Tween20, and each well contains 250 μ L. The chip rod was removed, the magnetic beads were dispersed into the solution, the plastic rod was removed, shaken and mixed to disperse the magnetic beads into the solution, and shaken for 3min.

5) Repeating the step 3) and the step 4) for 2 times.

6) The magnetic rod is inserted into the hollow plastic rod, transferred into the reaction solution, and stirred gently to enable the magnetic beads in the solution to be adsorbed to the tail end of the plastic rod again.

7) Transferring the 6 chip detection rods into holes with 200 mu L luminol chemiluminescence solution, taking away the chip rods, scattering magnetic beads into the solution, removing the plastic rods, vibrating and mixing uniformly to disperse the magnetic beads into the luminescence solution, and placing the chemiluminescence plate into a chemiluminescence instrument for luminescence counting.

The results of the measurements are shown in Table 6 below:

TABLE 6

It can be seen that the biochip with the chip handle structure shown in fig. 8 provided by the present invention is used to detect human thyroid stimulating hormone in cooperation with a multi-sample synchronous measurement detection method, and an accurate detection result is obtained (a good linear relationship is obtained, as shown in fig. 9). In example 5, six chip reaction interfaces are used to simultaneously measure six samples, and so on, the number of the chip reaction interfaces and the number of the samples to be measured can be increased as required, and all the samples to be measured can be simultaneously detected by simultaneous operation, thereby improving the detection efficiency.

Furthermore, the light emitting counting rates of 20 'zero' standards are measured simultaneously, and the lowest detection limit of the method is checked to be 0.02mIU/L on a standard curve by finding sigma x =2SD, which shows that the method obtains higher sensitivity.

While the invention has been described with reference to a preferred embodiment, various modifications may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In particular, the technical features mentioned in the embodiments can be combined in any way as long as there is no structural conflict. It is intended that the invention not be limited to the particular embodiments disclosed, but that the invention will include all embodiments falling within the scope of the appended claims.

Claims

1. A biochip, comprising:

a base support;

a plurality of chip handles mounted in an array on the base, the chip handles extending from the base in a direction perpendicular to the base and parallel to each other; and

a chip reaction interface disposed at a free end of each of the chip handles for labeling a detection probe;

the chip reaction interface is arranged in a plane perpendicular to the longitudinal direction of the chip handle;

the chip handle is strip-shaped, the end surface of the free end of the chip handle is provided with a mounting hole, the chip reaction interface is arranged in the mounting hole,

2. The biochip according to claim 1, wherein the number of probes labeled on the reaction interface of the biochip is 1 to 500.