CN107418874B

CN107418874B - Biological chip

Info

Publication number: CN107418874B
Application number: CN201710446841.9A
Authority: CN
Inventors: 杨华卫; 曾冀; 杨化莉
Original assignee: Individual
Current assignee: Individual
Priority date: 2017-06-14
Filing date: 2017-06-14
Publication date: 2021-05-07
Anticipated expiration: 2037-06-14
Also published as: CN107418874A

Abstract

The invention relates to a biochip, and belongs to the technical field of biological detection. The biochip of the present invention comprises: a base, a plurality of chip handles mounted on the base in an array, the chip handles extending from the base in parallel with each other in a direction perpendicular to the base, and chip reaction interfaces for labeling detection probes arranged at free ends of the respective chip handles, a longitudinal direction of the chip reaction interfaces being arranged to coincide with a longitudinal direction of the chip handles. Using such a biochip for detection can save a large number of detection steps and operation time. The chip reaction interface is vertically arranged at the end part of the chip handle, so that more reaction tanks and chips can be arranged in unit area, the number of detected samples is increased, and the detection efficiency is high. When detecting less clinical sample quantity, can use the detection equipment that the volume is littleer just can accomplish the detection, and it is convenient to detect, can also reduce cost.

Description

Biological chip

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a biochip.

Background

In the conventional membrane chip assay, each assay sample is added to the wells or grooves of the chip one by one in order to be incubated. Then, the incubated samples are removed from the wells or wells of the chip one by one, and washing solutions are sequentially added to the wells or wells for detection a plurality of times to wash. After washing, the reaction liquids are sequentially added to the wells or tanks for reaction, and the liquids after reaction need to be sequentially removed one by one. After the liquid after the reaction is removed, it is necessary to wash the well or tank for detection a plurality of times, remove the liquid in the well or tank, and keep it dry. Then, it is necessary to add the liquid as a detection signal to the reaction sequentially one well or one groove by one well. After the reaction, a stop solution is sequentially added into each hole or groove and mixed to read detection data.

In the conventional detection of glass chips, each reaction sample solution is applied to the surface of the chip, and then the glass chip is enclosed in a plastic chip case and clamped. The chip box is placed in a water bath and heated for several hours or heated in an air bath overnight. And then taking out the chip box, detaching the chip box, taking out the chip and placing the chip into a beaker. Adding washing liquid for shaking washing twice, and then taking out the chip and drying. Then the chip scanner is put in for reading.

Therefore, the traditional chip has more detection steps and long detection time in the whole detection process.

Disclosure of Invention

In order to solve the technical problems, the technical scheme provided by the invention is as follows:

a biochip, comprising: a base support; a plurality of chip handles mounted on the base in an array, the chip handles extending from the base in parallel with each other in a direction perpendicular to the base; and a chip reaction interface for labeling the detection probe disposed at a free end of each chip handle, a longitudinal direction of the chip reaction interface being disposed to coincide with a longitudinal direction of the chip handle.

As a further improvement of the above technical solution:

in one embodiment, the chip reaction interface is attached to the side of the chip handle near the free end of the chip handle.

The chip reaction interface is directly attached to the side surface of the chip handle, the structure is simple, and the manufacturing cost is low.

The chip handle is a plastic rod.

The chip handle made of plastic has low manufacturing cost.

In one embodiment, the chip handle is elongated and is provided with a clamp on a first side thereof for securing the chip reaction interface.

The clamp can ensure that the longitudinal direction of the chip reaction interface is coincident with the longitudinal direction of the chip handle and is firmly fixed on the chip handle.

The clamp is a folding clamping sheet and is used for clamping and fixing the chip reaction interface on the first side surface.

The folding type clamping piece is simple in structure and convenient to use, and can achieve the effects of simply and quickly assembling and replacing the chip reaction interface.

In one embodiment, the chip handle is elongated, a mounting hole is provided on a first side of the chip handle, and the chip reaction interface is disposed within the mounting hole.

The number of probes marked on the reaction interface of the chip is 1-50, preferably 1-10.

The reaction interface of the chip is an NC membrane marked with a detection probe.

The base support is a rectangular base support with a plurality of holes, and each hole is detachably clamped with the mounting end of one corresponding chip handle.

When the biochip is used for detection, all samples, reaction liquid and washing liquid are prepared and placed in the reaction tank, and the samples, the reaction liquid and the washing liquid do not need to be added or removed in a reciprocating manner, and the biochip only needs to be moved back and forth among the reaction tanks containing the samples, the reaction liquid and the washing liquid. Compared with the prior art that the detection of the biochip requires a plurality of steps of adding each sample one by one, adding each reaction solution one by one, removing the reacted liquids one by one, and adding and removing the washing solutions one by one, the invention saves a large number of detection steps and operation time. Also, such movement of the biochip back and forth between the reaction chambers can be performed by an automated chip detection apparatus, and the operation time can be further reduced. The chip reaction interface is vertically arranged at the free end of the chip handle, and the cross-sectional area is small, so the chip reaction interface is particularly suitable for the case that the reaction tank is a long and thin deep tank container such as a centrifugal tube. Therefore, more reaction tanks and chips can be arranged in unit area, the number of detected samples is large, and the detection efficiency is high. When detecting less clinical sample quantity, can use the detection equipment that the volume is littleer just can accomplish the detection, and it is convenient to detect, can also reduce cost.

Meanwhile, the chip handles connected with the chip reaction interface can be connected in series by the base, so that the combination of different chips is realized. In this way, the same group of chips for detecting the same batch of samples can be ensured to operate synchronously in each step, and the steps and the detection time in the detection can be further saved. Meanwhile, the base support can ensure that the same group of chips can keep a little distance from each other, and can prevent the mutual pollution between the chips caused by the cross of different reaction liquids. The combined three-dimensional chip synchronous operation can eliminate the reaction time difference among different samples and reduce the error rate of the operation. Compared with the prior art, the frequency of using the pipettor is reduced, and the consumption of tip heads is reduced, so that the cost is reduced.

Drawings

The invention will be described in more detail hereinafter on the basis of embodiments and with reference to the accompanying drawings. Wherein:

FIG. 1 schematically shows a biochip according to an embodiment of the present invention;

FIG. 2 schematically illustrates another chip handle that may be used in the present invention;

FIG. 3 schematically illustrates another chip handle that may be used in the present invention;

FIG. 4 shows the arrangement of the probes on the reaction interface of the chip and the detection results in example 1 of the present invention. Wherein, FIG. 4a is a schematic diagram of the arrangement of the probes on the membrane, and FIGS. 4b, 4c, and 4d are graphs of the detection signals of the samples 01, 02, and 03, respectively.

FIG. 5 shows a schematic diagram of arrangement of the probes on the membrane and the detection results in example 2 of the present invention. Wherein, FIG. 5a is a schematic diagram of the arrangement of the probes on the membrane, and FIGS. 5b and 5c are graphs of the detection signals of the samples 04 and 05, respectively.

In the drawings, like parts are provided with like reference numerals. The figures are not drawn to scale.

Detailed Description

The invention will be further explained in detail with reference to the figures and the embodiments without thereby limiting the scope of protection of the invention.

FIG. 1 schematically shows a biochip 10 according to an embodiment of the present invention. As shown in FIG. 1, the biochip 10 of the present embodiment includes a base 3. In this embodiment the base 3 is plate-shaped with a number of holes 8 therein. The holes 8 are preferably arranged in an array. The biochip 10 further comprises several chip handles 2. In this embodiment, the chip handles 2 are elongated rectangular parallelepipeds, the number of which preferably corresponds one-to-one to the number of holes 8. Each chip handle 2 can be inserted into a corresponding hole 8 and held fixedly. It will be readily appreciated that a variety of means may be used to secure the chip handle 2 in the base 3, such as snapping, gluing, etc. In an embodiment not shown, the chip handle 2 is fixed to the base 3 in a removable manner.

According to the present invention, the biochip 10 further comprises a chip reaction interface 1 for labeling detection probes. As shown, a mounting hole 5 is provided on one side of the chip handle 2 in the region near the free end thereof, and the chip reaction interface 1 is arranged in the mounting hole 5. The chip reaction interface 1 is arranged in a vertical direction, that is, the longitudinal direction of the chip reaction interface 1 coincides with the longitudinal direction of the chip handle 2. The number of probes labeled on the chip reaction interface 1 can be 1 to 50, and preferably 1 to 10.

When the biochip is used for detection, the chip handles connected with the reaction interface of the chip can be connected in series by the base, so that different chips can be combined. Thus, the same group of chips for detecting the same batch of samples can be ensured to operate synchronously in each step, and the steps and the detection time in the detection can be saved.

The substrate can ensure that the same group of chips can keep a certain distance from each other, and can prevent the mutual pollution between the chips caused by the cross of different reaction liquids. The combined three-dimensional chip synchronous operation can eliminate the reaction time difference among different samples and reduce the error rate of the operation. Compared with the prior art, the frequency of using the pipettor is reduced, and the consumption of tip heads is reduced, so that the cost is reduced.

Secondly, when the biochip is used for detection, all samples, reaction solution and washing solution are prepared and placed in the reaction tank, and do not need to be moved back and forth for addition or removal, and the biochip only needs to be moved back and forth among the reaction tanks containing the samples, the reaction solution and the washing solution. Compared with the prior art that the detection of the biochip requires a plurality of steps of adding each sample one by one, adding each reaction solution one by one, removing the reacted liquids one by one, and adding and removing the washing solutions one by one, the invention saves a large number of detection steps and operation time. In addition, the movement of the biochip between the reaction chambers can be performed by an automated chip detection apparatus, and the operation time can be further reduced.

Thirdly, when the biochip is used for detection, the reaction interface of the biochip is vertically arranged at the free end of the chip handle, and the cross-sectional area of the reaction interface is small, so that the biochip is particularly suitable for the condition that the reaction tank is a long and thin deep-groove container such as a centrifugal tube. Therefore, more reaction tanks and chips can be arranged in unit area, the number of detected samples is large, and the detection efficiency is high. When detecting less clinical sample quantity, can use the detection equipment that the volume is littleer just can accomplish the detection, and it is convenient to detect, can also reduce cost.

In addition, the chip reaction interface 1 shown in fig. 1 is arranged in a way that it can be stably and firmly fixed on the chip handle 2, and the problems of falling off of the chip reaction interface 1 with a very thin thickness or damage caused by other uncertain factors are reduced.

Fig. 2 schematically shows another chip handle 12 that can be used in the present invention. The chip handle 12 is constructed as a plastic rod. One end of each plastic rod is arranged on the base. The chip reaction interface 11 is arranged vertically on the side of the chip handle 12 in the region close to its free end. The biochip has simple structure and low cost.

Fig. 3 schematically shows another chip handle 22 according to the invention. The chip handle 22 is configured as an elongated strip, one end (upper right end in the drawing) of which is mounted on the base. The chip reaction interface 21 is arranged vertically at a region of a first side (i.e., the upper surface in fig. 3) of the chip handle 22 near its free end. The die shank 22 also includes a clamp 24 configured as a thin sheet having a hollow region. The sheet is configured to be folded in half so as to fixedly hold the chip reaction interface 21, but so that the chip reaction interface 21 is exposed through a hollow region thereof. The chip reaction interface 21 may be an NC membrane labeled with a detection probe, a nylon membrane, plastic, glass, ceramic, or the like. Such a jig 24 has a simple structure, is easy to use, and can achieve the effect of easily and quickly assembling and replacing the chip reaction interface 21.

The application of the biochip according to the invention is described below by way of a specific example.

Example 1

In this example, 4 mycobacterial nucleic acids were detected using the biochip shown in FIG. 1 for mycobacterial identification. There are many kinds of mycobacterium which can cause tuberculosis clinically, and mycobacterium tuberculosis, mycobacterium avium, mycobacterium intracellulare, mycobacterium kansasii and the like are common.

The reaction interface of the chip in this example is a glass chip, and the signal is detected by fluorescence labeling. In this example, a slide glass on which a mycobacterial probe is immobilized is embedded in a mounting hole provided at a region near the free end thereof on one side of a chip handle. During detection, the slide is soaked in the solution to perform operations such as chip hybridization, washing, fluorescence signal scanning and the like.

The steps of the method for identifying and identifying Mycobacterium using the biochip shown in FIG. 1 are described below.

Step 1: preparation of mycobacterium identification gene typing glass chip

Probes were designed to synthesize each mycobacterium species:

mycobacterium tuberculosis Probe TBTTTTTTTTTTTTTTTTTTAAGACATGCATCCGT

Mycobacterium avium probe: TTTTTTTTTTTTTTTTTTTTCATGCGTCTTGAGGTC

M. intracellulare probe: TTTTTTTTTTTTTTTTTTTTAAGACATGCGCCTAAA

Mycobacterium kansasii probe: TTTTTTTTTTTTTTTTTTTTCGCCAAGTGGTCCTAT

Positive control probe: TTTTTTTTTTTTTTTTTTTTAACTGCAGCTTGGACTACGC

Negative control probe: TTTTTTTTTTTTTTTTTTTTATGCCTTTAAGCATGGCA

Positive control target sequence: GCGTAGTCCAAGCTGCAGTT (5' fluorescein CY3 label capable of hybridizing with a positive control probe)

Preparing a probe solution: the probe was prepared and diluted to a concentration of 10. mu.M using TE solution.

Immobilization of probes on slides: spotting, 0.2. mu.L of each of the above 6 probe solutions was spotted on an amino-modified slide glass. And placing the spotted substrate in an oven at 80 ℃ for heat preservation for 80 minutes to enhance the fixing effect. The chip with the fixed probe is soaked in ultrapure water at 60 ℃, shaken for 1 minute, and dried for later use.

The probe arrangement is shown in FIG. 4 a.

And embedding the probe-fixing glass slide into the mounting hole on the side surface of the free end of the plastic rod for fixing. Drying and sealing, and storing at-20 deg.C.

Step 2: test sample preparation

Sample 01 Mycobacterium avium nucleic acid sample

Sample 02: m. intracellulare nucleic acid sample

Negative sample 03 sterile water

PCR system amplification samples 01 and 02 were prepared using primer sequences of 16SDNA gene, taq enzyme, and the like.

The upstream primer sequence Y01: GG TGG CTC AGG ACG AAC G (5' end fluorescein CY3 mark)

Note); the downstream primer sequence Y02: GGCT TGC GCC CAT TGT G, formulated at a concentration of 20. mu.M.

Preparation of PCR amplification reaction system (50. mu.L):

PCR reaction procedure: at 95 ℃ for 10 min; 95 ℃, 2min, 50 ℃, 1min, 68 ℃, 1min, 35 cycles; 72 ℃ for 5 min. The PCR product was stored at-20 ℃ until use.

And step 3: detection of

1) 3 1.5ml EP tubes were labeled and 1ml of the usual phosphate buffer (3 XSSPE) and 10. mu.L (10. mu.M) of the positive control sequence target were added. Then 20. mu.L of PCR products from 2 samples (01, 02) were added, denatured by heating at 95 ℃ for 10min, taken out and treated with an ice-water mixture.

2) Preparing a 24-well plate, selecting 3 wells for marking, and correspondingly adding the samples processed in the step 1) into the wells.

3) 3 prepared chips were taken out and labeled. Then inserted into the above 3 holes respectively, and incubated in a water bath at 48 deg.C for 0.5 hr.

4) The glass chip was removed, transferred to another 3 wells to which 1ml of 0.2 XSSC solution (pH7.0, containing 1.75g NaCl per 1000ml solution, 0.88g sodium citrate) was added, and washed with shaking for 2 min.

5) The glass chip was transferred to pure water and shaken for 2 min.

6) And taking out the glass chip, drying, taking down the embedded glass slide, and putting the glass slide into a chip fluorescence scanner to scan a fluorescence signal to interpret the result.

The results of the measurements are shown in Table 1 and FIG. 4 below.

TABLE 1

The sample analyzer uses three chip reaction interfaces to respectively and simultaneously measure three samples, and by analogy, the number of the chip reaction interfaces and the number of the samples to be detected can be increased according to needs, and all the samples to be detected can be simultaneously detected by simultaneous operation, so that the detection efficiency is improved.

Example 2

In this example, the biochip of the chip handle configuration shown in FIG. 3 was used for Mycobacterium tuberculosis identification. The nitrocellulose membrane sheet on which the mycobacterial probe is immobilized is fixed to the end of a plastic rod, and the plastic sheet at the end can be folded to sandwich the membrane chip. During detection, the tail end is soaked in the solution to complete the processes of chip hybridization, washing, color development and the like. The relevant parameters are as follows: the nucleic acid membrane array adopts 2 detection points and comprises 2 detection nucleic acid probes (mycobacteria probes and mycobacterium tuberculosis probes); spots were developed and the results were read by eye.

The steps of the method for identifying Mycobacterium tuberculosis using a biological core constructed with a chip handle as shown in FIG. 3 are described below.

Step 1: manufacture of membrane chip

Design of synthetic mycobacterial probes:

mycobacterium probe sequence MY: TTTTTTTTTTGTATTAGACCCAGTTTCCC

Mycobacterium tuberculosis probe TB: TTTTTTTTTTAAGACATGCATCCCGT

Negative control probe YX: TTTTTTTTTTATGCCTTTAAGCATGGCA

Immobilization of the probe on the membrane chip: spotting on nitrocellulose membrane (soaked in 10 XSSC buffer for 5min, oven-dried), spotting 1 μ L of the above 3 probe solutions on the membrane, and oven-drying at 80 deg.C for 2 hr.

The probe arrangement is schematically shown in FIG. 5 a.

And clamping the membrane chip to the tail end of the plastic rod, and fixing. Drying, sealing and storing.

Step 2: test sample preparation

Sample 04 Mycobacterium tuberculosis nucleic acid

Sample 05 sterile Water

PCR system amplification samples 04 and 05 were prepared using primer sequences of 16SDNA gene, taq enzyme, and the like.

The upstream primer sequence Y01: GG TGG CTC AGG ACG AAC G (biotin labeling); downstream primer sequence Y02GGCT TGC GCC CAT TGT G, formulated at 20. mu.M concentration.

Preparation of PCR amplification reaction system (50. mu.L):

And step 3: detection of

1) 2 1.5ml EP tubes were labeled, 1ml of a conventional phosphate buffer (3 XSSPE) was added, 20. mu.L of the PCR product of 2 samples was added, denatured by heating at 95 ℃ for 10min, removed and treated with an ice-water mixture.

2) 2 prepared vertical membrane chips were taken out and marked. The vertical membrane chips were inserted into the above 2 EP tubes, and incubated in a 50 ℃ water bath for 1 hr.

3) The vertical membrane chip was removed and transferred to two other wells containing 1ml of buffer 1(0.1M Tris-HCl, pH 7.5; 0.1M NaCl) EP tubes, rinsed 2 times.

4) The vertical membrane chip was removed and transferred to two additional EP tubes containing 1ml streptavidin solution (1. mu.g/ml diluted with buffer 1 containing 3% Bovine Serum Albumin (BSA)), and incubated in a 42 ℃ water bath for 30 min.

5) The vertical membrane chip was removed and transferred to two other wells containing 1ml of buffer 2(0.1M Tris-HCl, pH 9.5; 0.1M NaCl; 50M MgCl₂) The EP tube of (1) was rinsed 2 times.

6) The vertical membrane chip was taken out and transferred to another two EP tubes containing 1ml of color developing solution (mixed solution of NBT solution and BCIP solution), and color development was carried out for 10min at room temperature.

7) Taking out the vertical film chip, washing twice in water and interpreting the result.

The results are shown in FIG. 5 and Table 2 below.

TABLE 2

Sample(s)	MY probe signal	TB Probe Signal	YX Probe Signal
				Sample 04	+	+	－
Sample 05	－	－	－

The sample analyzer uses two chip reaction interfaces to respectively and simultaneously measure two samples, the number of the chip reaction interfaces and the number of samples to be detected can be increased as required, all the samples to be detected can be simultaneously detected through simultaneous operation, and the detection efficiency is improved.

In the biochip of the above embodiment, the substrate may connect the chip handles connected to the chip reaction interfaces in series to realize the combination of different chips, so that the same group of chips for detecting the same batch of samples can be operated synchronously in each step, and the steps and detection time in the detection can be further saved. Meanwhile, the base support can ensure that the same group of chips can keep a bit of distance from each other, and can prevent the mutual pollution between the chips caused by the cross of different reaction liquids. The combined three-dimensional chip synchronous operation can eliminate the reaction time difference among different samples and reduce the error rate of the operation. Compared with the prior art, the frequency of using the pipettor is reduced, and the consumption of tip heads is reduced, so that the cost is reduced.

The biochip in the above embodiments can be operated using an automated chip detection instrument. The biochip is moved back and forth between the reaction tanks and operated by an automatic chip detection instrument, so that the detection efficiency can be further improved, the reaction time difference among different samples can be eliminated, and the error rate of operation is reduced.

While the invention has been described with reference to a preferred embodiment, various modifications may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In particular, the technical features mentioned in the embodiments can be combined in any way as long as there is no structural conflict. It is intended that the invention not be limited to the particular embodiments disclosed, but that the invention will include all embodiments falling within the scope of the appended claims.

Claims

1. A biochip, comprising:

a base support;

a plurality of chip handles mounted on the base in an array, the chip handles extending from the base in a direction perpendicular to the base in parallel with each other, the chip handles being plastic rods; and

a chip reaction interface for labeling detection probes arranged at a free end of each of the chip handles, a longitudinal direction of the chip reaction interface being arranged to coincide with a longitudinal direction of the chip handles,

the chip handle is in a long strip shape, and a clamp used for fixing the chip reaction interface is arranged on the first side face of the chip handle.

2. The biochip of claim 1, wherein the chip reaction interface is attached to a side of the chip handle.

3. The biochip of claim 1, wherein the holder is a folded clamping sheet for clamping the chip reaction interface onto the first side.

4. The biochip of claim 1, wherein a mounting hole is provided on the first side of the chip handle, the chip reaction interface being disposed within the mounting hole.

5. The biochip according to any one of claims 1 to 4, wherein the number of probes labeled on the reaction interface of the biochip is 1 to 50.

6. The biochip according to any one of claims 1 to 4, wherein the chip reaction interface is an NC membrane labeled with detection probes.

7. The biochip according to any one of claims 1 to 4, wherein the base is a rectangular base with a plurality of holes, each hole being configured to detachably snap-fit with the mounting end of a corresponding one of the chip handles.