CN107340388B - A kind of biomolecule detecting method - Google Patents
A kind of biomolecule detecting method Download PDFInfo
- Publication number
- CN107340388B CN107340388B CN201710446617.XA CN201710446617A CN107340388B CN 107340388 B CN107340388 B CN 107340388B CN 201710446617 A CN201710446617 A CN 201710446617A CN 107340388 B CN107340388 B CN 107340388B
- Authority
- CN
- China
- Prior art keywords
- chip
- detection
- probe
- reaction interface
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
- G01N33/54326—Magnetic particles
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
Abstract
The present invention relates to a kind of biomolecule detecting methods, belong to technical field of biological.Method provided by the invention uses the synchronous detection that multiple samples to be tested are realized including the biochip with lower component: base；Several chip handles being mounted on base in an array manner, chip handle are stretched out from the base in parallel to each other along the direction perpendicular to base；And it is arranged in the chip reaction interface for being used to mark detection probe of the free end of each chip handle.Biomolecule is detected using method provided by the invention, all sample, reaction solution and cleaning solutions pre-assigned can be all placed in reactive tank, it does not need to move back and forth addition or removal, only it need to move back and forth biochip between the reactive tank for holding sample, reaction solution and cleaning solution, a large amount of detecting steps and operating time can be saved, detection accuracy is improved, and improves the accuracy of the lateral comparison of multiple pattern detection results.
Description
Technical field
The invention belongs to technical field of biological, and in particular to a kind of biomolecule detecting method.
Background technique
In the biomolecule detection of traditional membrane DNA chip, need each sample to be tested being one by one added sequentially to chip
It is incubated in hole or slot.Then, the sample after incubation is one by one removed from chip hole or slot, and in multiple times will washing
Liquid is sequentially added to be washed in hole or slot for detecting.After washing, reaction solution is sequentially added in hole or slot and is carried out instead
It answers, the liquid needs after reaction one by one successively remove.After removing the liquid after reaction, need repeatedly to be washed
For the hole detected or slot, and by the liquid removal in hole or slot.Later, needing will be as the liquid hole one by one of detection signal
Or trough is sequentially added and is reacted.After reaction, needs to sequentially add suspension liquid in each hole or slot and mix to read inspection
Measured data.
In the biomolecule detection of traditional glass chip, need each reaction sample solution to be added to chip surface, so
Glass-chip is enclosed in clamping in plastic core film magazine afterwards.Chip cartridges are placed in water-bath heating a few houres or air bath heating
Overnight.Chip cartridges are taken out later, dismantle chip cartridges and take out chip, are put into beaker.Cleaning solution is added in two portions to be shaken
It washes, take out chip later and dries up.Chip scanner reading is placed into later.
Traditional detection method operating procedure of biomolecule is various, detection time is long, and due to depositing between different samples
In processing time interval, cause testing result error big.Therefore, it is necessary to propose new biomolecule detecting method to improve
Detection efficiency reduces detection error.
Summary of the invention
In order to solve the above technical problems, the invention proposes a kind of new biomolecule detecting method, including following step
It is rapid:
Step 1: providing biochip (or being biochip device), the biochip includes:
Base,
Several chip handles being mounted on base in an array manner, chip handle is along the side perpendicular to base
To being stretched out from the base in parallel to each other, and
It is arranged in the chip reaction interface of the free end of each chip handle；
Step 2: being fixed for the detection of specific detection biomolecule to be measured respectively in each chip reaction interface
Probe；
Step 3: contacting each chip reaction interface with sample to be tested, to detect the biology point to be measured in sample to be tested
Son；With
Step 4: obtaining the detection signal of each chip reaction interface.
The detection mode provided according to the present invention is combined by several by chip handle and chip reaction interface using one kind
The biochip unit of formation is mounted on the biochip formed on base in an array manner in one-dimensional, two-dimentional or three-dimensional
Device detects biomolecule.
, can be individually to each chip reaction interface fixed test probe in step 2, it can also be simultaneously to all
Chip reaction interface carry out detection probe fixation.Preferably, while in each chip reaction interface it is fixed for respectively
The detection probe of specific detection biomolecule to be measured.
In detection sample to be tested, needs to enter chip reaction interface in sample to be tested solution, make chip reaction interface
The detection probe of upper fixation comes into full contact with the biomolecule in sample to be tested reacts.In step 3, all chip reactions
Interface can be immersed in the same sample to be tested, realize that each detection probe is to the biology in sample to be tested in chip reaction interface
The detection of molecule；Each chip reaction interface can also be made to be immersed in respective sample to be tested respectively, i.e., chip handle and chip are anti-
The biochip unit and sample to be tested for answering interface combinations to be formed correspond, and realize multiple chip reaction interfaces simultaneously to more
The detection of the identical or different sample to be tested of a composition.In some preferred embodiments of the invention, in step 3, make
Each chip reaction interface is contacted with each sample to be tested respectively simultaneously.
As it is well known to the skilled in the art, being contacted in chip with sample to be tested in the detection process of biomolecule
After reaction, the post-processing such as it can be washed, be dried to chip as needed, detection signal detection then is carried out to it again.According to
Some preferred embodiments of the invention, in step 3, make each chip reaction interface and meanwhile respectively with each sample to be tested
Contact, and each chip reaction interface is implemented to post-process simultaneously.I.e. in the detection process, it can be achieved that waiting for test sample to several
This synchronization detection, to realize batch processing in the shortest time.Due to either in the contact with sample to be tested still to core
Piece carries out time difference (each chip reaction interface being eliminated in last handling process between each sample to be tested detection such as washing
Synchronizing moving simultaneously) so that the testing result between sample to be tested minimizes ratio error, to improve testing result standard
True property, and greatly improve detection efficiency.
Due to using the biochip device of specific structure, single core is equally may be implemented in step 4 in the present invention
The signal acquisition of piece reaction interface or the detection signal for obtaining all chip reaction interfaces simultaneously.As of the invention some excellent
Embodiment is selected, in step 4, while obtaining the detection signal of each chip reaction interface.The present invention is eliminated as a result, to mention
It is poor to the detection time of each sample to be tested in each step of the detection method of confession, to be conducive to each to test sample
This biomolecule content situation carries out accurate lateral comparison.
According to the present invention, the detection probe is the probe biomolecule of the specificity of biomolecule to be measured, such as can be with
It is nucleic acid probe (such as oligonucleotide probe) and/or albumen probe (such as antigen probe, antibody probe) or other lifes
Object molecular probe.
According to the present invention, chip reaction interface can for plane, curved surface, the shapes such as granular, rodlike；When its work
It can be horizontal, upright, inclined etc..For example, the chip reaction interface can be plastic foil (such as cellulose nitrate
Plain film, nylon membrane, polystyrene film), sheet glass, plastic sheet, ceramic member or magnetic part (such as magnetic bead) etc..It should be understood that at this
In invention, film/diaphragm is that thickness is thinner than piece, and with certain flexibility, can for example be bent the film of even folding property
Body；And piece refers to the sheet body of hard.
According to the present invention, the material of chip handle can be plastics, glass etc. and not occur with sample to be tested or other treatment fluids
The material of reaction.
According to the present invention it is possible to pass through chromogenic reaction method, fluorescence method, chemoluminescence method and with regard to colloidal gold method (nanogold
Method) etc. modes obtain detection information.Therefore, in step 4, the detection signal can be color signal, fluorescence signal or change
Learn any one in luminous signal.
In certain embodiments of the present invention, chip handle is sticking plaster, and detection probe is directly anchored to oneself of chip handle
By constituting chip reaction interface at end.Material is the chip handle of plastics, and detection probe is marked directly on the free end of sticking plaster
Place, structure is simple, low manufacture cost.
Some preferred embodiments according to the present invention, chip reaction interface are arranged in vertical in the longitudinal direction with chip handle
In straight plane.
Chip reaction interface is arranged in the longitudinally perpendicular plane with chip handle, and cross-sectional area is big, therefore outstanding
It is suitable for reactive tank be flat shallow body container the case where.In this way, the reaction interface of all chips can be arranged in it is same
In plane, when detection, all chip reaction interfaces can once be imaged simultaneously when showing testing result, therefore detect knot
The reading efficiency of fruit is high, so as to reduce cost so that the design of reading apparatus is simpler.Secondly, shallow body container makes
It obtains in detection process, the heating speed of reaction solution is fast, therefore chip reaction speed also accelerates, to further increase inspection
Survey efficiency.Furthermore longitudinally perpendicular due to chip reaction interface and chip handle, i.e. either probe and biomolecule to be measured
Reaction step or probe are in other steps such as washing, and when chip reaction interface immerses in solution, all detections are visited
Needle all maintains in the same level in the solution, therefore all chip reaction interfaces are identical as the contact conditions of solution, chip
The contact conditions of all probes and solution in reaction interface are also identical, so measurement is further increased to a certain extent
Efficiency and testing result accuracy and each solution testing result to be measured lateral comparison accuracy.
In certain embodiments of the present invention, chip handle is strip, and is equipped with and uses on the end face of its free end
In the fixture of fixed chip reaction interface, which can be such that the chip reaction interface is arranged in and the chip
In the longitudinally perpendicular plane of handle, and it is clamped securely on chip handle.
Preferably, fixture be include the first support being mounted on the free end of chip handle, and can be with first support
Cooperate and the second support by the fixation of chip reaction interface therebetween.Two framework constructions worked in coordination are simple, user
Just, and it can be realized the effect for quickly and easily assembling and replacing chip reaction interface.
In certain embodiments of the present invention, chip handle is strip, and peace is equipped on the end face of its free end
Fill hole.Chip reaction interface is arranged in the mounting hole, and longitudinally perpendicular with the chip handle.Directly chip is reacted
Interface is arranged in the simple structure in the mounting hole on the section of chip handle free end.Chip reaction interface can be by being clamped, gluing
The modes such as knot are arranged in mounting hole.
In certain embodiments of the present invention, chip handle is rodlike, preferably sticking plaster or glass bar, and at it
Free end is equipped with fixation hole.Chip reaction interface be sheet material, and be equipped with for the mutually matched fixed column of fixation hole, Gu
Fixed column can be, for example, sticking plaster or glass bar.In the embodiment, chip reaction interface is especially susceptible to replace, can be with
Fixed column is replaced together.Installation is simple, as long as by the fixation hole of the fixed column insertion chip handle in chip reaction interface.
Also, since chip reaction interface can fix a large amount of detection probe so that response area is sufficiently large for sheet material on it,
It is detected while realizing various biomolecules.In addition, as previously mentioned, all probes are in the detection process always in same
In level, so that testing result is more accurate.
In certain embodiments of the present invention, chip reaction interface is configured to magnetic bead.Chip handle includes the end of free end
The non magnetic sleeve of face closure, and the magnetism stick being arranged in sleeve.The embodiment has particularly pertinent advantage, because
To can use magnetic principles, advanced biomolecule detection mode is realized by magnetic bead, such as can be using double antibodies sandwich
Detection mode efficiently and accurately measures biomolecule in conjunction with chemical luminous immune detection method.Secondly, in the present invention,
Using the fit system of the non magnetic sleeve-magnetic bead of magnetism stick-, magnetic bead can be invested by magnetism stick absorption or desorption non-magnetic at any time
On property sleeve, so that in the detection process, magnetic bead can be detached from non magnetic sleeve and freely disperse in the solution, during which may be used
To stir or take other measures, so that magnetic bead and solution fully haptoreaction, optimize in the probe and solution on magnetic bead
The reaction effect of biomolecule to be measured, and then improve detection accuracy.In addition, in the embodiment, chip reaction interface, i.e.,
It is fixed with the magnetic bead of detection probe, is particularly susceptible replacement, does not need to assist other disassemblies, mounting process, also therefore be more suitable for
The detection of more batches.
The method provided according to the present invention can satisfy and mark multiple detection probes in same chip reaction interface, can root
The number of detection probe is selected according to actual needs.For example, the probe of chip reaction interface label can be 1~500, it is excellent
It is selected as 1~50, more preferable 2~20.
The method provided according to the present invention, detection while can satisfy solution how to be measured can be set according to actual needs
Set the number of chip handle.For example, the number of chip handle can be 1~100, preferably 1~50, more preferable 2~20.
Some preferred embodiments according to the present invention, base are the rectangle base with several holes, and each hole is configured to
It can be removably clamped with the installation end of a corresponding chip handle.In this way, can facilitate the disassembly of biochip device,
Maintenance.
The detection method provided according to the present invention can also include that synthesis, sample to be tested preparation of detection probe etc. are conventional
Operating procedure.In the present invention, the synthesis of detection probe, detection probe fixation in chip reaction interface, sample to be tested
It prepares or the processing operations such as pretreatment and the washing of chip reaction interface is all that those of ordinary skill in the art can be according to reality
Border situation carrys out routine operation, and therefore not to repeat here.
According to the present invention, detection process can be the manual mode of hand-held biochip operation, be also possible to using machinery
The automatic detection mode of hand operation biochip.
When being detected using the biomolecule detection mode provided according to the present invention, all samples, reaction solution and wash
Washing liquid pre-assigned can all be placed in reactive tank, not need to move back and forth addition or removal, need to only hold sample, react molten
Move back and forth biochip between liquid and the reactive tank for washing solution.Chip detection needs each compared to the prior art
Sample sequentially adds one by one, each reaction solution sequentially adds one by one, and the liquid after reaction singly successively moves
It removes, the various step that cleaning solution is sequentially added one by one, removed, detection method of the invention saves a large amount of detecting steps
And the operating time, and tip movements of operational motion and replacement of numerous manual pipettors are avoided, and avoid this
Potential sample contamination caused by a little movements.Also, the moving back and forth between reactive tank of this biochip can pass through
The operation of chip detector device is automated, the operating time can be further reduced.
Meanwhile the chip handle for connecting chip reaction interface can be together in series by base recited above, realize different
The combination of chip chamber.In this way it can be ensured that same group of chip for detecting same lot sample sheet is synchronous behaviour in each step
Make, can further save the step and detection time in detection, and significantly improve detection efficiency and same batch of pattern detection
As a result lateral comparison accuracy.Secondly as base may insure same group of chip between each other can keep determining between
Away from can prevent the intersection between differential responses liquid from causing the mutual pollution of chip chamber.Furthermore this combined three-dimensional chip is same
Step operation, can eliminate the reaction time difference between different samples, reduce the error rate of operation.Simultaneously compared with prior art, by
In reducing the frequency using pipettor and reducing consumptive material tip usage amounts, to reduce costs.
Detailed description of the invention
The invention will be described in more detail below based on embodiments and refering to the accompanying drawings.
Fig. 1 schematically illustrates the biochip of embodiment 1 in the present invention.
Fig. 2 shows arrangement schematic diagram and testing result of 1 middle probe of the embodiment of the present invention on film.Wherein, Fig. 2 a is
Arrangement schematic diagram of the probe on film, Fig. 2 b are the detection signal graphs of sample 01, and Fig. 2 c is the detection signal graph of sample 02.
Fig. 3 schematically illustrates the biochip of embodiment 2 in the present invention.
Fig. 4 shows arrangement schematic diagram and testing result of 2 middle probe of the embodiment of the present invention on film.Wherein, Fig. 4 a is
Arrangement schematic diagram of the probe on film, Fig. 4 b, 4c, 4d are the detection signal graph of sample 03,04,05 respectively.
Fig. 5 schematically illustrates the biochip of embodiment 3 in the present invention.
Fig. 6 schematically illustrates the biochip of embodiment 4 in the present invention.
Fig. 7 shows arrangement schematic diagram and testing result of 4 middle probe of the embodiment of the present invention on film.Wherein, Fig. 7 a is
Arrangement schematic diagram of the probe on film, Fig. 7 b, 7c are the detection signal graph of sample 08,09 respectively.
Fig. 8 schematically illustrates the biochip of embodiment 5 in the present invention.
Fig. 9 shows thyroid hormone linear graph in embodiment 5.
In the accompanying drawings, identical component uses identical appended drawing reference.Attached drawing is not according to actual ratio.
Specific embodiment
Below in conjunction with the drawings and specific embodiments, invention is further described in detail, but does not therefore limit
Protection scope of the present invention.
Embodiment 1
Fig. 1 schematically illustrates the biochip 10 of one embodiment of the present of invention.As shown in Figure 1, the life of the present embodiment
Object chip 10 includes base 3.In this embodiment, base 3 is long strip shape, wherein being provided with several holes 8.Hole 8 is preferably
It is decorated in array.Biochip 10 further includes several chip handles 2.In this embodiment, chip handle 2 is elongated cuboid,
It can be plastic rectangular, quantity is preferably corresponded with the quantity in hole 8.Each chip handle 2 can be plugged into one it is right
In the hole 8 answered, and fixedly clamped.It is readily appreciated that, various ways can be used by chip handle 2 and be fixed on base 3
In, such as clamping, gluing etc..In a unshowned embodiment, chip handle 2 is removably secured to base 3
On.
According to the present invention, biochip 10 further includes the chip reaction interface 1 for marking detection probe.Chip reaction
Interface 1 is arranged in the longitudinally perpendicular plane with chip handle 2.As shown, in the end face of the free end of chip handle 2
It is equipped with the fixture 4 for fixed chip reaction interface.It may insure that chip reaction interface is in and chip handle by fixture
In longitudinally perpendicular plane and it is clamped securely on chip handle.Fixture 4 be include being mounted on the free end of chip handle 2
First support 41, and can cooperate with first support 41 and the second support 42 by the fixation of chip reaction interface 1 therebetween.
First support 41 and second support 42 are configured with the bracket of hollow region, such as I-shaped bracket, so as to keep chip anti-
Interface 1 is answered to expose by its hollow region.Mutually matched component can be equipped between first support 41 and second support 42,
Such as snap part, so that the two is capable of fixing chip reaction interface.The simple structure of this fixture 4, it is easy to use, and energy
It is enough to realize the effect for quickly and easily assembling and replacing chip reaction interface 1.
Chip reaction interface 1 can be the nitrocellulose filter that detection probe is marked, or nylon membrane, plastics,
Glass, ceramics, etc..The probe that chip reaction interface 1 marks can be 1 to 500, preferably 1~50.
Using when biochip is detected according to the present invention, connection chip can be reacted boundary by base recited above
The chip handle in face is together in series, and realizes the combination of different chip chambers.In this way it can be ensured that detecting the same of same lot sample sheet
Group chip is simultaneously operating in each step, can save step and detection time in detection.
Since base may insure that same group of chip keeps determining spacing between each other, differential responses liquid can be prevented
Between intersection cause the mutual pollution of chip chamber.This combined three-dimensional chip simultaneously operating can be eliminated between different samples
Reaction time difference reduces the error rate of operation.Simultaneously compared with prior art, due to reduce use pipettor frequency and
The usage amount for reducing consumptive material tip, to reduce costs.
Secondly, all samples, reaction solution and cleaning solution are all pre- using when biochip is detected according to the present invention
It prepares and is placed in reactive tank, do not need to move back and forth addition or removal, it is thus only necessary to hold sample, reaction solution and wash
It washs and moves back and forth biochip between the reactive tank of solution.Chip detection compared to the prior art needs each sample
Sequentially add one by one, each reaction solution sequentially adds one by one, the liquid after reaction singly successively removes,
The various step that cleaning solution is sequentially added one by one, removed, biochip of the present invention save a large amount of detecting steps
And the operating time.Also, biochip of the present invention moving back and forth between reactive tank can be by automating chip
Detecting instrument operation, operating time can be further reduced.
Again, chip reaction interface is arranged in the longitudinally perpendicular plane with chip handle, and cross-sectional area is big,
Therefore it is particularly suitable for the case where reactive tank is flat shallow body container.In this way, the reaction interface of all chips can be arranged in
In approximately the same plane, when detection, all chip reaction interfaces can once be imaged, therefore simultaneously when showing testing result
The reading efficiency of testing result is high, so as to reduce cost so that the design of reading apparatus is simpler.Secondly, shallow body
Container makes in detection process, and the heating speed of reaction solution is fast, therefore chip reaction speed also accelerates, to further increase
Detection efficiency is added.
The implementation process of the detection method provided according to the present invention is provided below by a specific example, wherein
Using biochip as shown in Figure 3.
Example 1
In this example, the identification of subtype of human papilomavirus gene is carried out using biochip as shown in Figure 1,
It is specific to be used to detect common type HPV nucleic acid (HPV16, HPV18, HPV6, HPV11).
HPV16 and HPV 18 belong to most common high-risk human mammilla papillomavirus, cause woman uterus cancer；HPV6 and HPV
11 belong to most common low risk danger type human papilloma virus, cause condyloma acuminatum.Have at present for this 4 types
Human-papilloma Vaccine.
Each step of the method introduced below that human papilloma virus identification is carried out using biochip as shown in Figure 1.
Step 1: being fixed with the production of the chip reaction interface of HPV Genotyping probes
Design synthesizes each HPV probe:
HPV16 probe sequence: TTTTTTTTTTCTGAAGTAGATATGGCAGC
HPV18 probe sequence: TTTTTTTTTTTATTGCCCAGGTACAGGA
HPV6 probe sequence: TTTTTTTTTTGGAAGATGTAGTTACGGA
HPV11 probe sequence: TTTTTTTTTTCAGATTTAGACACAkATGC
Positive control probe: TTTTTTTTTTAACTGCAGCTTGGACTACGC
Negative control probe: TTTTTTTTTTATGCCTTTAAGCATGGCA
Positive control target sequence: (biotin labeling, can be miscellaneous with positive control probe by GCGTAGTCCAAGCTGCAGTT
Hand over reaction)
Probe solution is prepared: being matched probe using TE buffer solution (preparing the buffer to be formed using Tris and EDTA)
It makes and is diluted to 10 μM of concentration.
Fixation of the probe in membrane DNA chip (chip reaction interface 1): in nitrocellulose filter, (10 × SSC buffer impregnates
5min, drying) point sample, it takes on each 1 μ L point to film of 6 probe solutions above, in 80 DEG C of drying 2hr.It is above-mentioned to manufacture two panels fixation
The film of probe.
Arrangement schematic diagram of the probe on film is shown in Fig. 2 a.
The diaphragm of fixed probe is clipped into sticking plaster (chip handle 2) end, and vertical with sticking plaster, with I-shaped bracket
It clamps, the end for being connected to base fixes.Dry sealing, saves.When detection, the diaphragm of sticking plaster end is immersed in solution
The operation such as middle progress chip hybridization, washing and colour developing.
Step 2: detection sample prepares
Sample 01:HPV16 sample of nucleic acid
Sample 02:HPV11 sample of nucleic acid
PCR system amplified sample 01, sample 02 are prepared using HPV universal primer sequence, taq enzyme etc..Upstream primer sequence
Y03:GAAAAATAAACTGTAAATCATATTC (biotin labeling)；Downstream primer sequence Y04:
TTTGTTACTGTGGTAGATACTAC is configured to 20 μM of concentration.
Pcr amplification reaction system prepares (50 μ L):
PCR response procedures: 95 DEG C, 5min；95 DEG C, 1min, 50 DEG C, 0.5min, 65 DEG C, 1min, 35cycles；72 DEG C,
5min.- 20 DEG C of PCR product storages are spare.
Step 3: detection
1) 2 1.5ml EP pipes are taken, are marked, common phosphate buffer (3 × SSPE) 1ml and positive control is added
10 μ L of sequence target column (10 μM).Then it takes the PCR product of 2 samples (01 and 02) of 20 μ L to be added, becomes in 95 DEG C of heating 10min
Property, taking-up is placed in mixture of ice and water processing.
2) prepare one piece of 24 orifice plate, 2 holes is selected to mark, sample correspondence is added in hole by 1) treated.
3) membrane DNA chip for taking out 2 preparations, marks.Then it is inserted into both the above hole respectively, is placed in 48 DEG C of water-baths
Interior incubation 1hr.
4) membrane DNA chip is taken out, is transferred to other two added with 1ml buffer 1 (0.1MTris-HCl, pH7.5；0.1M
NaCl it in hole), shakes and washes 2min.
5) detecting step 4 is come again).
6) membrane DNA chip is taken out, is transferred to other two added with 1ml streptavidin solution (1 μ g/ml, with added with 3%
The buffer 1 of bovine serum albumin(BSA) (BSA) dilutes) hole in, 30min is incubated in 42 DEG C of water-baths.
7) membrane DNA chip is taken out, is transferred to other two added with 1ml buffer 2 (0.1MTris-HCl, pH9.5；0.1M
NaCl；50M MgCl2) hole in, shake and wash 2min.
8) detecting step 7 is come again).
9) membrane DNA chip is taken out, being transferred to other two, (NBT solution and BCIP solution mix added with 0.5ml developing solution
Liquid) hole in, room temperature develop the color 10min.
10) membrane DNA chip is taken out, Yu Shuizhong is rinsed twice, interpretation result.
Testing result is shown in Fig. 2 and the following table 1.
Table 1
As it can be seen that detect HPV Genotyping nucleic acid using detection method provided by the invention, by spot display mode,
Obtain accurate testing result.This example has used two chip reaction interfaces respectively while having measured two samples, successively class
It pushes away, can according to need and increase chip reaction interface number and sample to be tested number, by operating simultaneously, all samples to be tested
It can be detected simultaneously, improve detection efficiency.
Embodiment 2
Fig. 3 schematically illustrates the biochip 11 of one embodiment of the present of invention.As shown in figure 3, the life of the present embodiment
Object chip 11 includes base 31.In this embodiment, base 31 is plate, wherein being provided with several holes 81.Hole 81 is preferably in
Array arrangement.Biochip 11 further includes several chip handles 21.In this embodiment, chip handle 21 is elongated cuboid,
Its quantity is preferably corresponded with the quantity in hole 81.Each chip handle 21 can be plugged into a corresponding hole 81, and by
Fixedly clamp.It is readily appreciated that, various ways can be used, chip handle 21 is fixed in base 31, such as clamping, glue
It glues.In a unshowned embodiment, chip handle 21 is removably secured on base 31.
According to the present invention, biochip 11 further includes the chip reaction interface 12 for marking detection probe.Chip reaction
Interface 12 is arranged in the longitudinally perpendicular plane with chip handle 21.As shown, chip handle 21 is strip, and
Mounting hole 5 is equipped on the end face of its free end.Each chip reaction interface 12 is arranged in a corresponding mounting hole 5.This
The simple structure of kind chip handle 21, it is easy for installation.
Chip reaction interface 12 is glass-chip.The probe that chip reaction interface 12 marks can be 1 to 8.
The implementation process of the detection method provided according to the present invention is provided below by a specific example, wherein
Using biochip as shown in Figure 3.
Example 2
In this example, mycobacteria identification is carried out using biochip as shown in Figure 3, detects 4 kinds of mycobacterias
Nucleic acid.Clinic can caused by there are many kinds of Mycobacteriums lungy, wherein common are mycobacterium tuberculosis, bird point
Branch bacillus, Mycobacterium intracellulare and mycobacterium kansasii etc..
Chip reaction interface in this example 2 is glass-chip, detects the mode of signal using fluorescent marker mode.This
In example 2, secure in the end aperture of slide insertion sticking plaster of mycobacteria probe, it is vertical with sticking plaster.When detection, make
The slide of sticking plaster end impregnates carries out the operations such as chip hybridization, washing and fluorescence signal scanning in the solution.
Each step of the method introduced below that mycobacteria identification identification is carried out using biochip as shown in Figure 3.
Step 1: the production of mycobacteria identification Genotyping glass-chip
Design synthesizes the probe of each mycobacteria kind:
Mycobacterium tuberculosis probe TBTTTTTTTTTTTTTTTTTTTTAAGACATGCATCCCGT
Mycobacterium avium probe: TTTTTTTTTTTTTTTTTTTTCATGCGTCTTGAGGTC
Mycobacterium intracellulare probe: TTTTTTTTTTTTTTTTTTTTAAGACATGCGCCTAAA
Mycobacterium kansasii probe:
TTTTTTTTTTTTTTTTTTTTCGCCAAGTGGTCCTAT
Positive control probe: TTTTTTTTTTTTTTTTTTTTAACTGCAGCTTGGACTACGC
Negative control probe: TTTTTTTTTTTTTTTTTTTTATGCCTTTAAGCATGGCA
Positive control target sequence: (5 ' end fluorescein CY3 labels, can be with positive control by GCGTAGTCCAAGCTGCAGTT
Probe hybridization reaction)
Probe solution is prepared: being prepared probe using TE solution, is diluted to 10 μM of concentration.
Fixation of the probe on slide: point sample takes on each 0.2 μ L point to amido modified slide of 6 probe solutions above.
Substrate after point sample is placed in 80 DEG C of baking ovens and keeps the temperature 80 minutes enhancing fixed effects.The chip of probe will be fixed, is immersed in 60
DEG C ultrapure water in shake and wash 1 minute, dry spare.
Probe arrangement mode is shown in Fig. 4 a.
The slide of fixed probe is embedded into sticking plaster end aperture, sticking plaster is connected to and fixes.Dry sealing, -20
DEG C save.
Step 2: test sample prepares
Sample 03: mycobacterium avium sample of nucleic acid
Sample 04: Mycobacterium intracellulare sample of nucleic acid
Negative sample 05: sterile water
PCR system amplified sample 03, sample 04 are prepared using the primer sequence of 16SDNA gene, taq enzyme etc..
Upstream primer sequence Y01:GG TGG CTC AGG ACG AAC G (5 ' end fluorescein CY3 label)；Downstream primer
Sequence Y02:GGCT TGC GCC CAT TGT G, is configured to 20 μM of concentration.
Pcr amplification reaction system prepares (50 μ L):
PCR response procedures: 95 DEG C, 10min；95 DEG C, 2min, 50 DEG C, 1min, 68 DEG C, 1min,
35cycles；72 DEG C, 5min.- 20 DEG C of PCR product storages are spare.
Step 3: detection
1) 3 1.5ml EP pipes are taken, are marked, common phosphate buffer (3 × SSPE) 1ml and positive control is added
10 μ L of sequence target column (10 μM).Then the PCR product of 2 samples (03,04 and 05) of 20 μ L is taken to be added, in 95 DEG C of heating 10min
Denaturation, taking-up are placed in mixture of ice and water processing.
2) prepare one piece of 24 orifice plate, 3 holes is selected to mark, it will (1) treated that sample corresponds to is added in hole.
3) chip for taking out 3 preparations, marks.Then it is inserted into 3 holes above, is placed in 48 DEG C of water-baths respectively
It is incubated for 0.5hr.
4) glass-chip is taken out, being transferred to other 3, (pH7.0, every 1000ml are molten added with 0.2 × SSC of 1ml solution
Liquid contains 1.75g NaCl, 0.88g sodium citrate) hole in, shake and wash 2min.
5) glass-chip is transferred to shake in pure water and washes 2min.
6) take out glass-chip, drying, remove the slide of insertion, slide is put into chip Fluorescence Scanner scan it is glimmering
Optical signal interpretation result.
Testing result see the table below 2 and Fig. 4.
Table 2
As it can be seen that detecting mycobacteria using detection method provided by the invention, by fluorescent marker mode, obtain
Accurate testing result.This example has used three chip reaction interfaces respectively while having measured three samples, and so on, it can
To increase chip reaction interface number and sample to be tested number as needed, by operating simultaneously, all samples to be tested can be same
When detect, improve detection efficiency.
Embodiment 3
Fig. 5 schematically illustrates the biochip that can be used in the present invention, and contains another chip handle 22.The chip
Handle 22 is configured to sticking plaster.One end of each sticking plaster is mounted on base, and detection probe is marked directly on the free end of sticking plaster
Place constitutes chip reaction interface.This simple structure, low manufacture cost.
The implementation process of the detection method provided according to the present invention is provided below by a specific example, wherein
Using biochip as shown in Figure 3.
Example 3
In this example, hepatitis B surface antigen is carried out using the biochip that chip handle as shown in Figure 5 constructs
(HBsAg) double antibody sandwich method detects.The material of chip handle is polystyrene (Polystyrene, abridge PS), diameter 1~
10mm, end mark Anti-HBs antibody Ag antibody.
It is introduced below to carry out hepatitis B surface antigen (HBsAg) using the biochip of chip handle construction as shown in Figure 5
Each step of the method for double antibody sandwich method detection.
Step 1: plastic chip stick end is coated with Anti-HBs antibody Ag antibody
In test tube, Anti-HBs antibody Ag 0.05mol/L, pH9.6 carbonate buffer solution is diluted to 3 μ g/ of working concentration
Ml, as coating buffer.Plastic chip stick end is immersed in coating buffer, 37 DEG C of incubation 2hr；Chip stick is transferred to added with carbon
The test tube of acid salt solution, shakes and washes；Chip stick is transferred to containing 1%BSA carbonate solution (250 μ l/ test tube), 37 DEG C of incubations again
2hr；Chip stick is transferred to the test tube added with carbonate solution, shakes and washes, it is spare after dry.
Step 2: detection
1) 3 chip test bars are taken out and are marked.Sample to be tested is added in 3 test tubes (or 3 holes of 96 orifice plates)
H1, H2 and H0.Wherein H0 is sample diluent 5%BSA-0.1MPBS, pH7.2.By the different pipes of the corresponding addition of these chip sticks
It is interior, 37 DEG C of incubation 30min.
2) 3 chip test bars are simultaneously transferred to one group of test tube (3) added with washing lotion, washing lotion respectively is
The Tris-HCl solution of 0.02M, pH7.4 shake containing 0.1%Tween20 and wash 3min；Then chip test bar is transferred to second group
The test tube (3) for filling washing lotion, shakes and washes 3min；Chip test bar is transferred to the test tube (3) that third group fills washing lotion again, shakes and washes
3min。
3) 3 chip test bars are transferred to respectively added with dilution (1:5000) enzyme labelled antibody (anti-HBsAg-HRP)
One group of test tube (3), 37 DEG C of incubation 30min.
4) detecting step 2 is repeated).
5) 3 chip test bars are transferred to respectively added with developing solution H2O2With developing solution tetramethyl benzidine (TMB)
One group of test tube (3, mark).React at room temperature 15min.
6) chip test bar is removed, is added and stops liquid (0.1M sulfuric acid solution) mixing, each hole is measured at 450nm wavelength
OD value.
Testing result see the table below 3.
Table 3
As it can be seen that detecting hepatitis B surface antigen using detection method provided by the invention, accurate detection knot is obtained
Fruit.This example 3 has used three chip reaction interfaces respectively while having measured three samples, and so on, it can according to need increasing
Concrete-cored reaction interface number and sample to be tested number, by operating simultaneously, all samples to be tested can be detected simultaneously, be improved
Detection efficiency.
Comparative example 1: conventional ELISA method detects hepatitis B surface antigen
Step 1: ELISA Plate coating
By Anti-HBs antibody Ag 0.05mol/L 0.05mol/L, pH9.6 carbonate buffer solution is diluted to 3 μ g/ of working concentration
Ml, as coating buffer.Take 96 hole elisa Plates of blank that coating buffer, 37 DEG C of incubation 2hr are added；Discard coating buffer and molten with carbonate
Then liquid washing is added contains 1%BSA carbonate solution (250 hole μ l/), 37 DEG C of incubation 2hr；It discards confining liquid and uses carbonic acid
Brine, it is spare after dry.
Step 2: detection
1) it takes out ELISA Plate and marks.Sample to be tested H4, H5 and H0b is one by one added in three holes, and wherein H0b is
Sample diluent 5%BSA-0.1M PBS, pH7.2.37 DEG C of incubation 30min.The composition of H4, H5 and H0b respectively with H 1, H2 and
H0 is identical.
2) liquid in three holes is one by one washed out with liquid-transfering gun and is discarded, then draw washing lotion to three with liquid-transfering gun
Hole is one by one washed 3 times, then cleaning solution is sucked out one by one.
3) enzyme labelled antibody that has diluted is added to hole one by one with liquid-transfering gun, and (anti-HBsAg-HRP, 100 holes μ l/, 1:5000 are dilute
Degree of releasing), 37 DEG C of incubation 30min.
4) detecting step 2 is repeated), and liquid in hole is patted dry.
5) developing solution H is added to hole one by one with liquid-transfering gun2O2With developing solution tetramethyl benzidine (TMB), room temperature reaction
15min。
6) it is added to hole one by one with liquid-transfering gun and stops liquid (0.1M sulfuric acid solution) mixing, read optical density.
Testing result is as shown in table 4 below:
Table 4
By table 3 and 4 result of table as it can be seen that using method provided by the invention to the testing result of hepatitis B surface antigen with adopt
The testing result detected with traditional ELISA method is suitable, illustrates that the accuracy of detection method is high.But from detection
From the point of view of process, detection method provided by the invention but obviously facilitates than traditional ELISA detection method, eliminates at each
The tedious steps that hole is handled one by one are needed in reason step, to greatly improve detection efficiency；Also, due to multiple samples
The synchronous of this each processing step carries out, and is compared to traditional processing one by one, detection method avoids sample
Between cross-infection a possibility that.Example 3 and comparative example 1 diagrammatically only detect 3 samples, work as needs
Detect to huge discharge it is multiple, for example dozens of even hundreds of samples when, above-mentioned advantage of the invention will be protruded more.
Embodiment 4
Fig. 6 schematically illustrates a kind of biochip for use in the present invention, includes another chip handle 23.Chip
Handle 23 is configured to sticking plaster, and is equipped with fixation hole 6 in its free end.Chip reaction interface 13 is sheet material, and is equipped with and is used for
With the mutually matched fixed column 7 of fixation hole 6.Chip reaction interface 13 is arranged in longitudinally perpendicular flat with chip handle 23
In face.It is fixed in use, fixed column 7 is inserted into fixation hole 6.
The implementation process of the detection method provided according to the present invention is provided below by a specific example, wherein
Using biochip as shown in Figure 3.
Example 4
In this example, the 4 kinds of HPV nucleic acids of biochip test constructed using chip handle as shown in FIG. 6, HPV16,
HPV18, HPV6 and HPV11.
Using plastic chip as chip reaction interface in this example 4, signal detecting mode uses the cataluminescence side HRP
Method.The thin rounded flakes for securing polystyrene (PS) the material production of HPV probe nucleic acid, are embedded by the fixed column at center
It is vertical with sticking plaster in the fixation hole 7 of sticking plaster end.When detection, fixed diaphragm is set to impregnate progress chip in the solution miscellaneous
The operations such as friendship, washing and chemiluminescence.PS material can be with adhesion protein, including streptavidin (SA) etc., then by raw
The nucleic acid of object element label fixes probe in conjunction with SA.
It is introduced below to detect 4 kinds of HPV nucleic acids using biochip as shown in FIG. 6, HPV 16, HPV18, HPV6,
Each step of the method for HPV11.
The production of step 1:HPV Genotyping horizontal plastic chip
Design synthesizes each HPV probe:
HPV16 probe sequence: Bio-CTGAAGTAGATATGGCAGC
HPV18 probe sequence: Bio-ATTGCCCAGGTACAGGA
HPV6 probe sequence: Bio-GGAAGATGTAGTTACGGA
HPV11 probe sequence: Bio-CAGATTTAGACACAkATGC
Positive control probe: Bio-AACTGCAGCTTGGACTACGC
Negative control probe: Bio-ATGCCTTTAAGCATGGCA
Positive control target sequence: (digoxigenin labeled can be visited DIg-GCGTAGTCCAAGCTGCAGTT with positive control
Needle hybridization reaction)
Probe solution is prepared: being prepared probe using TE solution, is diluted to 5 μM of concentration.
It customizes the pretreatment of round plastic (PS material) piece of processing: the plastic chip being cleaned by ultrasonic being dried, is transferred to
1 μ g/ml streptavidin solution (uses pH7.0, the dilution of 100mM Tris solution), in 37 DEG C of incubation 1hr, then is transferred to pH7.0,
It is shaken in 100mM Tris solution and washes 5min, then be transferred to pure water and shake and wash 5min.
Fixation of the probe in round plastic on piece: taking on each 0.5 μ L point to plastic sheet of 6 probe solutions above, moisturizing in
37 DEG C of incubation 1hr.Disk is transferred to shake in pure water and washes 2min, is dried.
Probe arrangement mode is shown in Fig. 7 a.
The round plastic piece of fixed probe is embedded into sticking plaster end.Dry sealing, saves.
Step 2: test sample prepares
Sample 08:HPV16 sample of nucleic acid
Sample 09:HPV11 sample of nucleic acid
PCR system amplified sample 08, sample 09 are prepared using HPV universal primer sequence, taq enzyme etc..Upstream primer sequence
Y03D:GAAAAATAAACTGTAAATCATATTC (digoxigenin labeled)；
Downstream primer sequence Y04:TTTGTTACTGTGGTAGATACTAC is configured to 20 μM of concentration.
Pcr amplification reaction system prepares (50 μ L):
PCR response procedures: 95 DEG C, 5min；95 DEG C, 1min, 50 DEG C, 0.5min, 65 DEG C, 1min,
35cycles；72 DEG C, 5min.- 20 DEG C of PCR product storages are spare.
Step 3: detection
1) 2 1.5ml EP pipes are taken, are marked, common phosphate buffer (3 × SSPE) 1ml and positive control is added
10 μ L of sequence target column (10 μM).Then it takes the PCR product of 2 samples (08 and 09) of 20 μ L to be added, becomes in 95 DEG C of heating 10min
Property, taking-up is placed in mixture of ice and water processing.
2) prepare one piece of 24 orifice plate, 2 holes is selected to mark, sample correspondence is added in hole by 1) treated.
3) it takes out the plastic chip of 2 preparations and marks.Then it is inserted into both the above hole respectively, is placed in 48 DEG C of water
1hr is incubated in bath.
4) plastic chip is taken out, is transferred to other two added with 1ml buffer 3 (0.1M Tris-HCl, pH7.5；
0.15M NaCl) hole in, shake and wash 2min.
5) detecting step 4 is come again).
6) plastic chip is taken out, is transferred to other two added with 3 diluted anti-dig-HRP to 150mU/ml of buffer
In the hole of (explaining: 150 every milliliter of milliunits), it is incubated at room temperature 30min.
7) plastic chip is taken out, is transferred in other two hole added with buffer 3, shakes and wash 2min.
8) plastic chip is taken out, is transferred to other two added with (the 0.1M Tris-HCl, pH 9.5 of 1ml buffer 4；
0.15M NaCl, 10mM MgCl2) hole in, shake and wash 2min.
9) plastic chip is taken out, is transferred to other two added with 0.2ml luminescent solution (by luminescent solution I (aminobenzene diformazan
Amide, reinforcing agent) and the hole that mixes luminescent solution II (oxidant) in, note down hair from empty bottom using Chemiluminescence Apparatus
Optical signal.It is imaged from bottom with cold CCD (such as day energy chemiluminescence imaging system).
Testing result see the table below 5 and Fig. 7.
Table 5
This example detection method detection sensitivity is high, easy to detect using instrument, and a chip can detect simultaneously
Multiple indexs are a splendid selections for clinical detection.
Embodiment 5
Fig. 8 schematically illustrates a kind of biochip for use in the present invention, wherein using another chip handle 24.
Chip handle 24 includes the closed non magnetic sleeve 241 in end face of free end, and the magnetism stick 242 being arranged in sleeve.Chip
Reaction interface 14 is configured to magnetic bead.When magnetism stick 242 to be inserted into sleeve 241, magnetic bead can be applied with magnetism stick 242
Magnetic attracting force causes magnetic bead to be adsorbed on the end face of sleeve 241.Thus, it is possible to carry out subsequent operation.When operation is tied
Shu Hou can extract magnetism stick 242 out from sleeve 241, then magnetic bead can fall off from sleeve 241, to be used for subsequent processing.
The implementation process of the detection method provided according to the present invention is provided below by a specific example, wherein
Using biochip as shown in Figure 3.
Example 5
In this example, using biochip test thyroid hormone (TSH) as shown in Figure 8.
Thyroid hormone (TSH) is the Main Factors for regulating and controlling thyroid cell growth and thyroid hormone synthesis and secretion,
It can reflect thyroid functional status by detecting blood TSH level, facilitate the screening, diagnosis, therapeutic effect of thyroid disease
Judge and Index for diagnosis.
5 relevant parameter of this example is as follows: double antibody sandwich method；Enzyme-catalyzed chemical luminescence, wherein using horseradish peroxidase
(HRP) TSH antibody is marked, selects luminol, hydrogen peroxide as luminous substrate.When bar magnet is inserted into hollow plastic charge bar bottom
When, magnetic bead is adsorbed sticking plaster end, and when detaching bar magnet, magnetic bead will be detached from sticking plaster, splits away off.For capturing
Antibody -- anti-tsh monoclonal antibody is coated on magnetic bead, antibody is connected on carboxylated magnetic bead by carbodiimide,
Another antibody is then used to mark HRP.
The side introduced below that thyroid hormone (TSH) is detected using the biochip of chip handle construction as shown in Figure 8
Each step of method.
Step 1: the assembling of coating and magnetic bead the absorption chip of magnetic bead
The activation of magnetic bead: it takes 1mg carboxyl magnetic bead (about 100 μ l magnetic flaw detection ink) in centrifuge tube, is shaken on sample mixed instrument
5~10min；Centrifuge tube is placed on Magneto separate frame, is adsorbed completely to magnetic bead, supernatant is taken out；1ml 15mM is added
MES (pH6.0) solution washs magnetic bead, and repeated washing is primary；Magnetic bead is resuspended using 100 μ L 15mM MES (pH6.0), adds
100 μ L (10mg/ml) carbodiimide (EDC) solution are prepared using the solution of pre-cooling, ready-to-use；It is uniformly mixed, room temperature item
Under part, 30min is activated on sample mixed instrument.
Magnetic bead coating: using magnetic bead one time after 15mM MES (PH6.0) the washing activation of 1ml, Magneto separate abandons supernatant；
15mM MES (pH6.0) solution of 500 μ L monoclonal antibodies containing anti-tsh (50 μ g) is added, room temperature reaction overnight, is immunized
Magnetic bead.
It saves: magnetic bead 2 times after washing coating with the PBST of 1ml, the PBS weight with 1ml containing 0.1% bovine serum albumin(BSA)
Outstanding magnetic bead.Bar magnet is inserted into hollow plastic charge bar, the centrifugation bottom of the tube of anti-tsh label magnetic bead is preserved in insertion, to be adsorbed complete
Afterwards, it takes out, sealing, 4 DEG C spare.
Step 2: the preparation of horseradish peroxidase mark TSH antibody
Horseradish peroxidase mark TSH antibody is prepared with sodium periodate method, it is then slow with the phosphate of 0.01M pH7.4
After fliud flushing dialysed overnight, the glycerol that equivalent is added is saved in -20 DEG C.The throwing of horseradish peroxidase and anti-tsh monoclonal antibody
Material is than being respectively 1:2.
Step 3: detection
1) preparation of TSH antigen standard
Will TSH antigen calibration after be dissolved in inactivation calf serum in, be configured to TSH be 0,0.1,0.5,4,10,20,
The standard solution of 50mIU/L.
2) 6 magnetic bead absorption chip test bars are taken out and are marked.Each 100 μ L is added in 6 holes of Chemiluminescent plate
The upper surface of 6 standard items samples, and 100 μ L are respectively added and dilute the horseradish peroxidase mark TSH antibody of 1:1000.By this
A little chip sticks are corresponding to be added in different pipes, takes chip stick away, and magnetic bead is scattering into solution, then removes sticking plaster, and oscillation, which mixes, to be made
It obtains magnetic bead to be distributed in solution, 37 DEG C of incubation 40min.
3) bar magnet is inserted into hollow plastic charge bar, is transferred in reaction solution, is gently agitated for, so that the magnetic bead in solution is again
It is adsorbed onto sticking plaster end.
4) 6 magnetic bead absorption chip test bars are transferred to respectively again in 6 holes added with washing lotion, washing lotion is
The Tris-HCl solution of 0.02M, pH7.4, containing 0.1%Tween20, every 250 μ L of hole.Take chip stick away, magnetic bead is scattering into molten
In liquid, then sticking plaster is removed, oscillation mixes so that magnetic bead is distributed in solution, shakes and washes 3min.
5) step 3), step 4) 2 times are repeated.
6) bar magnet is inserted into hollow plastic charge bar, is transferred in reaction solution, is gently agitated for, so that the magnetic bead in solution is again
It is adsorbed onto sticking plaster end.
7) in 6 chip test bars being transferred to respectively in the hole added with 200 μ L luminol chemiluminescence liquid, chip is taken away
Stick, magnetic bead are scattering into solution, then remove sticking plaster, and oscillation mixes so that magnetic bead is distributed in luminescent solution, by chemiluminescence
Plate is placed in the luminous counting of Chemiluminescence Apparatus detection.
Testing result see the table below 6:
Table 6
As it can be seen that cooperating the detection side of multisample synchro measure using biochip as shown in Figure 8 provided by the invention
Method detects H-TSH, obtains accurate testing result (obtaining good linear relationship, as shown in Figure 9).
This example 5 has used six chip reaction interfaces respectively while having measured six samples, and so on, it can according to need increase
Chip reaction interface number and sample to be tested number, by operating simultaneously, all samples to be tested can be detected simultaneously, improve inspection
Survey efficiency.
Further, at the same measure 20 " zero " standards luminous counting rate, find out ∑ x=2SD and looked on standard curve
The minimum detection limit 0.02mIU/L of the method out illustrates that this law obtains higher sensitivity.
Although by reference to preferred embodiment, invention has been described, the case where not departing from the scope of the invention
Under, various improvement can be carried out to it and can replace component therein with equivalent.Especially, as long as structure is not present
Conflict, items technical characteristic mentioned in the various embodiments can be combined in any way.The invention is not limited to
Specific embodiment disclosed herein, but all technical solutions including falling within the scope of the claims.
Claims (6)
1. a kind of biomolecule detecting method for non-diagnostic purpose, which comprises the following steps:
Step 1: providing biochip, the biochip includes:
Base,
Several chip handles being mounted on the base in an array manner, the chip handle is along the direction perpendicular to the base
It is stretched out from the base in parallel to each other, and
It is arranged in the chip reaction interface of the free end of each chip handle；
Step 2: being fixed for the detection probe of specific detection biomolecule to be measured respectively in each chip reaction interface；
Step 3: contacting each chip reaction interface with sample to be tested, to detect the biomolecule to be measured in sample to be tested；With
Step 4: obtaining the detection signal of each chip reaction interface；
The chip handle is strip, and the folder for fixing the chip reaction interface is equipped on the end face of its free end
Tool, is arranged in the chip reaction interface in the plane longitudinally perpendicular with the chip handle.
2. detection method according to claim 1, which is characterized in that the fixture includes oneself for being mounted on the chip handle
By the first support on end, and can cooperate with the first support and by fixed the therebetween of the chip reaction interface
Two brackets.
3. detection method according to claim 1 or 2, which is characterized in that the number of the chip handle is 1~100；
And/or
The probe of the chip reaction interface label is 1~500.
4. detection method according to claim 1 or 2, which is characterized in that the base is the rectangle base with several holes
Support, each hole is constructed to be permeable to removably be clamped with the installation end of a corresponding chip handle.
5. detection method according to claim 1 or 2, which is characterized in that the detection probe is nucleic acid probe and/or egg
White probe；And/or
The detection signal is any one in color signal, fluorescence signal or chemiluminescence signal.
6. detection method according to claim 1 or 2, which is characterized in that reacted in step 2, while in each chip
It is fixed for the detection probe of specific detection biomolecule to be measured on interface respectively；And/or in step 3, make each chip
Reaction interface is contacted with each sample to be tested respectively simultaneously, and implements to post-process simultaneously to each chip reaction interface；
Optionally, in step 4, while the detection signal of each chip reaction interface is obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710446617.XA CN107340388B (en) | 2017-06-14 | 2017-06-14 | A kind of biomolecule detecting method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710446617.XA CN107340388B (en) | 2017-06-14 | 2017-06-14 | A kind of biomolecule detecting method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107340388A CN107340388A (en) | 2017-11-10 |
| CN107340388B true CN107340388B (en) | 2019-07-23 |
Family
ID=60220770
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710446617.XA Active CN107340388B (en) | 2017-06-14 | 2017-06-14 | A kind of biomolecule detecting method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107340388B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111879934A (en) * | 2020-08-12 | 2020-11-03 | 上海市动物疫病预防控制中心(上海市兽药饲料检测所、上海市畜牧技术推广中心) | Canine carcino-embryonic antigen immune comb and canine carcino-embryonic antigen detection kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN2262710Y (en) * | 1996-04-15 | 1997-09-17 | 陶日升 | Quick kit using enzyme label inversed coating pressing method |
| CN2284404Y (en) * | 1997-04-04 | 1998-06-17 | 上海荣盛生物技术有限公司 | Comb type spot immunity assaying box |
| CN1650167A (en) * | 2002-04-11 | 2005-08-03 | 莫利塞诺瓦昂尼公司 | Device and method to simultaneously detect different antibodies and antigens in clinical alimentary and environmental samples |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN2777542Y (en) * | 2004-11-26 | 2006-05-03 | 珠海市永如生物技术发展有限公司 | Combined covex type many person portion protein chip |
| CN1825121B (en) * | 2005-02-24 | 2011-06-08 | 上海裕隆生物科技有限公司 | Plastic chip |
-
2017
- 2017-06-14 CN CN201710446617.XA patent/CN107340388B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN2262710Y (en) * | 1996-04-15 | 1997-09-17 | 陶日升 | Quick kit using enzyme label inversed coating pressing method |
| CN2284404Y (en) * | 1997-04-04 | 1998-06-17 | 上海荣盛生物技术有限公司 | Comb type spot immunity assaying box |
| CN1650167A (en) * | 2002-04-11 | 2005-08-03 | 莫利塞诺瓦昂尼公司 | Device and method to simultaneously detect different antibodies and antigens in clinical alimentary and environmental samples |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107340388A (en) | 2017-11-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11560592B2 (en) | Method for resetting an array | |
| CN1161611C (en) | Biosensor | |
| CN1920559A (en) | Cellular biological technique, reagent kits and preparation device | |
| KR20180031612A (en) | A Method of Rapid Diagnosis With High Sensitivity By Using Single Diagnosis Chip Comprising Reaction and Analysis Process | |
| CN1313622C (en) | High-flux cell biological chip testing technology and reagent case | |
| CN102735728A (en) | Electrochemical immunosensor, preparation method and use of electrochemical immunosensor | |
| EP3983803A2 (en) | Multiplexed tissue imaging | |
| JP6310926B2 (en) | Parallel line biochip for multiple diagnostics | |
| CN1464977A (en) | Biosensor and method for analyzing blood components using it | |
| CN1818652A (en) | Test kit for immunochromatography | |
| CN107340388B (en) | A kind of biomolecule detecting method | |
| AU2005303881A1 (en) | Device for carrying out an individual immunoassay in a fully automatic manner | |
| JP2004354164A (en) | Specimen inspection method using microparticle and its inspection system | |
| CN104293976B (en) | Gene chip and kit for detecting pig epidemic type B encephalitis virus and/or pig porcine reproductive and respiratory syndrome virus | |
| CN107389933B (en) | A kind of biochip | |
| JP2002357604A (en) | Reaction vessel and analysis method for biologically active substance using the same | |
| JP2011188835A (en) | Tissue microarray and tissue analysis method | |
| US9977040B2 (en) | Device and method for reactions between a solid and a liquid phase | |
| CN110195079A (en) | Prepare plasmid, antibody, preparation method and the screening technique of AMH antibody, kit and detection method | |
| CN105891193A (en) | Chemiluminescent immune detection kit for respiratory syncytial virus and preparation method thereof | |
| JPWO2005052583A1 (en) | Method for detecting analytes | |
| CN107338288A (en) | A kind of biomolecule detecting method | |
| WO2018056700A1 (en) | High-sensitivity rapid diagnostic method of single diagnostic chip including reaction and analysis | |
| CN109884299A (en) | One-step method fluorescent detection system and blood coagulation enzyme assay method | |
| CN212622620U (en) | Compact immunoassay device |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |