CN1635164A

CN1635164A - High flux biochip and application thereof

Info

Publication number: CN1635164A
Application number: CN 200410088889
Authority: CN
Inventors: 陶生策; 高华方; 赵传赞; 王东; 安爽; 程京
Original assignee: BOAO BIOCHIP Co Ltd BEIJING; Tsinghua University
Current assignee: Tsinghua University; CapitalBio Corp
Priority date: 2004-11-08
Filing date: 2004-11-08
Publication date: 2005-07-06
Anticipated expiration: 2024-11-08
Also published as: CN1312293C; WO2006047911A1

Abstract

The invention disclosed a high-fluxed biochip and application thereof. The high-fluxed biochip of the invention comprises a solid-phase ground substance and samples adhered to the ground substance, wherein, the samples are arrayed in several sample zone. The detection method applying the biochip of the invention comprises: 1) fabricating several detection molecular line corresponding to the samples along the cross direction to the sample zones on the biochip, making the detection molecules react with the sample adhered to the solid-phase ground substance; 2) washing the solid-phase ground substance and detecting signal points. the invention fabricates sample line and probe line in two layers on the same biochip, realizes parallel detection and analysis of multi-simple to multi-probe, processes advantages of high detection flux and high detection efficiency; the invention adopts a simple drying process for quickening the hybridization reaction of probe and sample, shortening the detection time, and can be used in bio-molecule detection extensively.

Description

A kind of high flux biochip and application thereof

Technical field

The present invention relates to biochip and application, particularly relate to a kind of energy and realize of high flux biochip and the application thereof of various product the multiprobe parallel detection.

Background technology

Biological study has entered the epoch of one " group is learned research ", and representative wherein has genome research and proteome research.The feature that group is learned research is to carry out flux height, fireballing parallel parsing method to a large amount of target molecule in one or more samples, conventional once test gene of a sample or once tests the requirement that an a kind of proteic analysis mode of sample can not the adaptation group be studied.

As a kind of revolutionary analytical technology, biochip is integrated with what it was had, and potentiality microminiaturized and automatization have been brought into play more and more important effect in the bioassay technique field.In early days, biochip basically indication be exactly nucleic acid chip and dna microarray, often be used to high-flux parallel analysis (Debouck andGoodfellow, Nature Genetics, 21 (Suppl.): the 48-50 (1999) of nucleic acid; Duggan et al., NatureGenetics, 21 (Suppl.): 10-14 (1999); Gerhold et al., Trends Biochem.Sci., 24:168-173 (1999); And Alizadeh et al., Nature, 403:503-511 (2000)), can adopt nucleic acid chip to analyze gene expression profile under the particular case apace, also can adopt nucleic acid chip in experiment once, to analyze single nucleotide polymorphism (Single nucleotidepolymorphisms in the gene region reach 1kb, SNPs) (Guo et al., Genome Res., 12:447-57 (2002)).Integration based on the notion of biochip, basic Biological Principles and conventional biotechnology has developed the biochip that number of different types, comprising the protein chip that is used for disease and cancer research (Belov et al., CancerResearch, 61:4483-4489 (2001); Knezevic et al., Proteomics, 1: 1271-1278 (2001); Paweletz et al., Oncogene, 20: 1981-1989 (2001)); Be used on the genome level research molecular pathology organization chip (Kononen et al., Nat.Med., 4: 844-847 (2001)); And be used for the repercussion study between polysaccharide and the albumen the polysaccharide chip (Fukui et al., Nat.Biotech., 20: 1011-1017 (2002)).

Nucleic acid detection chip with routine is an example, according to chip surface institute fixed is that sample or probe can be divided into it two major types: as fixed on the fruit chip is that sample then is positive hybridization hybrid chip, for example NGS of Telechem company (next generationscreening) technology; If fixed is a probe then for anti-phase hybridization hybrid chip on the chip surface, the fixing chip of expression spectrum of 70mer probe for example.According to the hybridization reactive force producing method of chip surface, biochip can be divided into passive type chip and active chip.In the passive type biochip, probe is fixed in the surface of solid phase carrier, target to be checked then is in unbound state in hybridization in the cavity, the reaction between probe and the target to be checked rely on target to be checked in reaction system passive diffusion and carry out, the concentration of target to be checked is lower in the probe area.In this manner, reaction efficiency is relatively low, and the time of reacting required is longer relatively.

Developed at the few shortcoming of dependent response, the probe stationary amount of traditional two-dimentional passive type chip and several dissimilar solutions.First kind of mode is to adopt other substrate material and fixing means.In biochip technology at present commonly used, probe is fixed on a kind of two-dimensional plane usually, and is therefore lower usually in the density of chip surface fixed probe.In order to obtain higher hybridization efficiency, there is the investigator to attempt with probe stationary (Zlatanova et al., Methods Mol.Biol.170:17-38 (2001) on three-dimensional structure and three dimensional matrix; Tillib et al., Anal.Biochem.292:155-160 (2001); Michael et al., Anal.Chem.70:1242-1248 (1998)).Compare with the two-dimentional chip of routine, three-dimensional chip has following two characteristics: can fix more probe in a fixed zone, probe on three-dimensional structure has higher degree of freedom simultaneously, and therefore, such chip can improve the efficient of hybridization.But the shortcoming of this chip also is conspicuous, and therefore the making processes more complicated of chip has caused this chip to be difficult to realize high-density.Another kind of mode is to adopt the probe of particular design, these probes have some accessory compositions on its 5 ' end, comprise and be used to improve the flexible 5 ' spacerarm of stationary probe (Shchepinov et al., Nucleic Acids Res.25,1155-1161 (1997)), and loop-stem structure or hairpin structure probe (Broude et al., Nucleic Acids Res.29:E92 (2001)), the hybridization of target dna and probe can be strengthened (Riccelli et al., NucleicAcids Res.29:996-1004 (2001)) by the base stacking effect.The third mode that improves hybridization efficiency is to apply physical force on chip.Comprise the diffusion when adopting disturbance to promote to hybridize, for example Lucidea automatic chip treater (LucideaASP); Electrical forces also is used to drive the rapid movement of nucleic acid and the probe area on the nucleic acid chip surface concentrates and enrichment (Sosnowski et al., Proc.Natl.Acad.Sci.U.S.A 94:1119-1123 (1997); Cheng et al., Nat.Biotechnol.16:541-546 (1998)), molecule can be than the passive type chip of routine fast 1000 times in conjunction with speed in the chip of electric field driven.The shortcoming of this chip is the course of processing more complicated of chip itself or needs complicated support equipment.

In foranalysis of nucleic acids, conventional detection method is a kind of some reaction, for example one section specific nucleic acid in specific sample of one-time detection; The prior biological chip technology then be a kind of multiple spot to single-step reaction, its flux is higher than conventional analytical procedure far away, but still can not realize the parallel parsing of a plurality of samples to a plurality of probes in one-time detection.

Summary of the invention

The purpose of this invention is to provide a kind of energy and realize of high flux biochip and the application thereof of various product the multiprobe parallel detection.

High flux biochip provided by the present invention, it comprises solid-phase matrix and attached to the sample on the matrix, described sample is some parallel sample bands and arranges.

Wherein, the detection molecules band that also has some and described sample band to intersect on the described solid-phase matrix, sample band and detection molecules band need only to intersect and can reach purpose of the present invention, and preferably sample band and detection molecules band are vertical.The sample that is attached on the solid-phase matrix commonly used has various probes or biomolecules etc.

Common operable solid-phase matrix has multiple, as silicon, and plastics, glass, pottery, rubber, metal, Hybond membrane etc., but also can carry out being used for the present invention after the chemically modified to its surface, as carry out-CHO-NH ₂,-SH ,-S-S-, modifications such as epoxy group(ing) and tosyl group; Various biomolecules may be used to make chip of the present invention, as DNA, and RNA, peptide nucleic acid(PNA) (PNA), locked nucleic acid (LNA), protein, peptide, antibody, polysaccharide, cell, animal tissues or plant tissue etc.; Used probe can with the biomolecules specific combination that is detected, can be DNA, RNA, peptide nucleic acid(PNA) (PNA), locked nucleic acid (LNA), protein, peptide, antibody or polysaccharide etc.

Use the method that biochip of the present invention detects, comprise the steps: 1) along with biochip on the direction that intersects of sample band make the some detection molecules lines corresponding on the solid-phase matrix surface with sample, make detection molecules and be fixed on example reaction on the solid-phase matrix; 2) detection signal point behind the cleaning solid-phase matrix.

Step 2) before the described cleaning also through super-dry, make probe or biomolecules sample concentration, can accelerate the reaction of probe and biomolecules.

In order to improve the homogeneity of dry back sample, drying mode can be selected the air-permeable envelope drying for use.Drying temperature can be chosen in 0-80 ℃; Dry humidity is between the 0%-80%.

Making the method for second layer detection molecules line on chip can make with biochip point sample instrument point; These molecular lines can be that solid line also can be a dotted line, and each section of dotted line can be that circle also can be bar-shaped or other shape.

Second layer detection molecules line also can adopt the microfluidic channel method to make at chip surface, this method comprise the steps: a) along with biochip on the direction that intersects of sample band on the solid-phase matrix surface bonding on microfluidic channel; B) reaction solution that contains detection molecules is entered in the described microfluidic channel, with the example reaction that is fixed on the solid-phase matrix.

Wherein, microfluidic channel can adopt materials such as polymer to make; When detection molecules is reacted in microfluidic channel, can adopt Patent:5,741 as US, 647 and US Patent:6, the mode that 020,187 grade is introduced flows with Micropump control fluid and hybridizes or water conservancy diversion hybridization, and the energy enabling hybridization reaction is more abundant, quick.When cleaning, can directly scavenging solution be joined in the microfluidic channel, after also microfluidic channel can being removed chip is placed in the scavenging solution and clean.

For the ease of signal detection, can carry out mark to the detection molecules of the second layer, add silver as radio-labeled, fluorescent mark, chemical labeling, zymetology mark, luminescent marking, colloid gold label and dye amplification, marked by magnetic bead, FRET (fluorescence resonance energy transfer) mark or molecular beacon mark etc., fluorescent mark commonly used has FAM, TET, HEX, FITC, Cy3, Cy5, Texas Red, ROX, Fluroscein, TAMRA and have nanoparticle of rare earth metal etc.Signal detecting method commonly used has opticmicroscope, optical scanner and fluorescent scanning instrument etc.

Sample is fixed in (the first layer sample wire) on the chip solid-phase matrix earlier, makes flow process that second layer line probe carries out sample detection then shown in Figure 1A and Figure 1B, Figure 1A is fixed in solid-phase matrix with sample wire earlier, and every line is corresponding to a kind of sample; Figure 1B makes line probe again on Figure 1A basis, probe and sample are reacted constitute the detection matrix, and 1,2,3 are respectively solid-phase matrix, sample and probe molecule among the figure.The principle of carrying out dry hybridization after second layer line probe completes is shown in Fig. 2 A-Fig. 2 D, and Fig. 2 A adds to include probe molecule 3 reaction solution 5 of (having mark 4 on the probe molecule 3) on the solid-phase matrix 1 that is fixed with sample 2; Fig. 2 B be reaction solution 5 in the solid-phase matrix surface drying, probe molecule 3 concentrates, and has promoted probe molecule 3 and effective combination of sample 2 generations; Fig. 2 C is that drying process finishes, and probe 3 finishes with sample 2 association reactions; Fig. 2 D only keeps and sample 2 bonded probe molecules 3 for cleaning on the solid-phase matrix of back, is used for signal detection.Fig. 3 makes the synoptic diagram of second layer line probe for adopting the microfluidic channel method, after microfluidic channel makes up and finishes, probe molecule 3 is joined in the microchannel 6, make probe molecule 3 and sample 2 that association reaction take place in microchannel 6, reaction finishes can carry out signal detection after cleaning.

The present invention produces two-layer sample wire and line probe dexterously on a biochip, constitute crisscross biochip matrix, can once realize the parallel detection analysis of a plurality of samples to a plurality of probes, has high detection flux and detection efficiency; Adopt simple drying process that the probe of the second layer or sample molecule are concentrated, accelerated probe or sample molecule and be fixed on the first layer sample on the chip or the hybridization of probe, can shorten detection time, can be widely used in the detection of biomolecules.

Description of drawings

Figure 1A is the synoptic diagram that is fixed with the solid-phase matrix of sample wire;

Figure 1B shows to make on the solid-phase matrix of Figure 1A again and goes up line probe;

Fig. 2 A shows on the solid-phase matrix surface be fixed with sample and is added with the reaction solution that contains probe;

Fig. 2 B demonstration drying is impelled probe and example reaction;

Fig. 2 C shows that dry end probe and sample are effective and combines;

Fig. 2 D shows that the sample that cleaning after reaction finishes finishes is combined with probe is used for detecting;

Fig. 3 makes the structural representation of line probe for adopting the microfluidic channel method;

Fig. 4 A is the overall schematic of air permeation device;

Fig. 4 B is the sectional view of air permeation device;

Fig. 4 C is that chip adopts air-permeable envelope exsiccant synoptic diagram;

Fig. 5 is embodiment 1 probe 1-4 and Cy3 passage scintigram after sample combines;

Fig. 6 is embodiment 1 general probe and Cy5 passage scintigram after sample combines.

Embodiment

Human leucocyte antigen (HLA) gene test is carried out in embodiment 1, employing the inventive method and dry hybridization

1, experiment material

Amino slide (AminoSlide ^TM, Beijing biochip rich difficult to understand company limited, Beijing)

Probe and primer: Bo Ya biotech company in Shanghai is synthetic.

HLA-A PCR primer (5 '-3 '):

Upstream primer PMH-AF TCCCCAGACGCCGAGGATGGCC

Downstream primer PMH-AR CCCGTGGCCCCTGGTACCCG

Probe (5 '-3 '):

Probe 1 A07401a_Ta TCACAGACTCACCGAGTCG

Probe 2 A11407_Ta TACCACCAGTACGCCTACG

Probe 3 A06202_Ta GGGACCGGAACACACGGAA

Probe 4 A05603a_Ta CAGGAGAGGCCTGAGTATT

General probe PBH_A991001_d9_Cy5 CCTGCGCTCTTGGACCGC

Specimen in use and as shown in table 1 with the hybridization corresponding relation of probe sequence 1-4, in the table 2402,2501 and 2601 is homozygote, correspond respectively to the international somatotype tissue of HLA (International HistocompatibilityWorking Group, IHWG) standard DNA WS No.9369,9092 and 9014, be respectively HLA-A2402, HLA-A2501 and HLA-A2601 gene; Other 9 duplicate samples are for adopting Array Beads Multi-AnalyteSystem ^TM(One Lambda Inc.CA USA) and A Locus High Res SSP UniTray ^(Pel-FreezClinical Systems, LLC WI USA) carried out the actual sample of intermediate-resolution somatotype, this 9 duplicate samples is heterozygote, wherein, 11/24 listed in table representative is by the heterozygote that HLA-A11** and HLA-A24** formed, and all the other are represented similarly.Blacking region representation probe and sample can produce the positive hybridization of expection.General probe can be hybridized with higher efficient and all HLA sample.

The hybridization corresponding relation of table 1. sample and probe

Reagent and solution: DMSO, 20 * SSC, 10%SDS, 50 * Denhardt ' s, ddw, 2.5mM dNTP (Shanghai Bo Ya biotech company), 5U/ μ L LA-Taq and 10 * LA buffer (precious biotech company, DaLian, China); Manu 03010 PCR product purification test kit (Millipore Corporation.290 Concord Road Billerica, Massachusetts).

Instrument: ScanArray Express fluorescent scanning instrument (GSI Lumonics); DU 640 spectrophotometers (PerkinElmer); GeneMachine (Genomic Instrumentation Services Inc., San Carlos, CA.); PTC-200 thermal cycler (MJ); TDL-5 whizzer (Anting Scientific Instrument Factory, Shanghai); Digital display constant temperature water bath vibrator SHA-C (state China instrument plant, Chinese changzhou); UV-crosslinked instrument (Bio-Rad Laboratories, Inc).

2, experimental technique

1) specimen preparation (pcr amplification, PCR product purification concentrate and be quantitative)

Pcr amplification: 1 * LA buffer, 200 μ M dNTPs, 1 μ M upstream primer PMH-AF, 0.04 μ M downstream primer PMH-AR, LA-Taq and the 2 μ L sample DNAs of adding 5U in the 100 μ L PCR reaction systems.The thermal cycling program is as follows: 96 ℃ of pre-sex change 3 minutes; 96 ℃ of sex change 25 seconds, 71 ℃ of annealing 45 seconds, 72 ℃ were extended 25 circulations 30 seconds; 96 ℃ of sex change 25 seconds, 65 ℃ of annealing 60 seconds, 72 ℃ were extended 15 circulations 2 minutes; 72 ℃ were extended 5 minutes; 4 ℃ of maintenances.PCR carries out on the PTC-200 thermal cycler.

The purifying of PCR product concentrates and is quantitative: according to the operation instructions purified pcr product of Millipore Manu PCR product purification test kit, adopt DU 640 spectrophotometers that the PCR product of purifying is carried out quantitatively, adopt the vacuum concentration system of Eppendorf to concentrate the PCR product, spissated PCR product is dissolved among the 50%DMSO, and making its final concentration is 400ng/ μ L.

2) preparation of sample sampling liquid and setting-out operation

With concentration is that the sample 1 to 12 of 400ng/ μ L adopts GeneMachine point sample instrument crosswise spots to be formed on amino surface of glass slide.The diameter of point is 150 μ m, and adjacent 2 spacing is set at 80 μ m in the same sample wire, and the spacing between adjacent two sample wires is set at 300 μ m.The temperature of point sample is 24 ℃, and humidity is 50%.

3) sample fixing on amino slide

The slide that point is shaped on sample places baking oven, places after 1 hour for 80 ℃ and takes out, and reduces to room temperature.At room temperature carry out following operation then: have facing down of sample spot to place 60 ℃ of water-bath surfaces slide, make water vapour have dot matrix simultaneously to be vaporific hydration 10s at slide glass, the slide that hydration the finishes room temperature that faces up is placed 5min; Carry out then UV-crosslinked, crosslinked energy 250mJ; Place 1%SDS under 60 rev/mins of speed, to shake slide and wash 5 minutes, take out slide and put into dehydrated alcohol cleaning 3 times, take out slide drying in centrifugal 3 minutes under 1000 rev/mins of speed.

4) preparation of probe sampling liquid and setting-out operation

Adopt ordinary method that probe 1-4 is carried out the Cy3 mark, 6 * SSC during the probe behind the mark 1 to 4 is dissolved in respectively, among 0.1%SDS and the 5 * Denhart ' s, the final concentration of probe is 1 μ M.Adopt GeneMachine point sample instrument point to be formed on chip surface the probe solution 1 to 4 for preparing, the diameter of point is 150 μ m, and adjacent 2 spacing is set at 80 μ m in the same sample wire, and the spacing between adjacent two sample wires is set at 300 μ m.The temperature of point sample is 24 ℃, and humidity is 50%.

Adopt ordinary method that general probe is carried out the Cy5 mark, 6 * SSC during the general probe of Cy5 mark is dissolved in, among 0.1%SDS and the 5 * Denhart ' s, final concentration is 30nM, is formed on chip surface according to top method point.

5) cleaning and result detect

Chip being taken out from point sample instrument, cover air permeation device on chip, is 25 ℃ in temperature, and humidity is dry in 50% the environment.The structure of air permeation device as shown in Figure 4, Fig. 4 A is the overall schematic of air permeation device, Fig. 4 B is the sectional view of air permeation device, 7 is air-permeable envelope, 8 is support; Air permeation device is positioned at synoptic diagram such as Fig. 4 C on the chip.With drying chip be positioned over hybridization scavenging solution I (3 * SSC﹠amp; 0.1%SDS), 42 ℃ of slight vibrations were cleaned two minutes; (in 0.06 * SSC), 42 ℃ of slight vibrations were cleaned two minutes at hybridization scavenging solution II again.Place TDG-5 whizzer 1000rpm to dry in centrifugal 1 minute with cleaning the chip that finishes.

Adopt Scan Array Express to detect fluorescent signal, Cy3 is provided with identical sweep parameter with the Cy5 passage: Laser power=80%, and PMT=90%, scanning accuracy is 10 μ m.Scanning result such as Fig. 5 and shown in Figure 6, Fig. 5 are the hybridization collection of illustrative plates of probe 1-4 and sample, and wherein 1-12 is respectively sample 1-12; A, B, C, D are respectively probe 1-4; Fig. 6 is the hybridization collection of illustrative plates of general probe and sample, and wherein 1-12 is respectively sample 1-12.The result shows that method provided by the invention has good strength of signal and higher hybridization specificity, and actual results of hybridization and expected results are in full accord.

Embodiment 2, employing microfluidic channel are made second layer line probe and are carried out sample detection

1, the chip that 12 samples among the embodiment 1 is contained the first layer sample according to the preparation of the step among the embodiment 1.

2, make up microfluidic channel

Along with chip on the direction that intersects of sample band on the solid-phase matrix surface bonding on 4 polythene material passages, its end face sealing.

3, hybridization in the microfluidic channel

6 * SSC during 4 kinds among the embodiment 1 probe 1-4 through the Cy3 mark are dissolved in respectively, among 0.1%SDS and the 5 * Denhart ' s, the final concentration of probe is 1 μ M; Then probe solution is joined respectively in 4 passages, hybridization is carried out in vibration, removes probe solution after the reaction, and is dry at ambient temperature.

Equally, the general probe through the Cy5 mark is joined in the passage, carry out hybridization.

4, clean, detect

To hybridize scavenging solution I (3 * SSC﹠amp; 0.1%SDS) join drying chip in, 42 ℃ of slight vibrations were cleaned two minutes; (0.06 * SSC), 42 ℃ of slight vibrations were cleaned two minutes to add hybridization scavenging solution II again; Chip after will cleaning at last dries in air, removes microfluidic channel.

Adopt Scan Array Express to detect fluorescent signal, Cy3 is provided with identical sweep parameter with the Cy5 passage: Laser power=80%, and PMT=90%, scanning accuracy is 10 μ m.Its scanning result is identical with embodiment 1.

Claims

1, a kind of high flux biochip, it comprises solid-phase matrix and attached to the sample on the matrix, it is characterized in that: described sample is some parallel sample bands and arranges.

2, biochip according to claim 1 is characterized in that: the detection molecules band that also has some and described sample band to intersect on the described solid-phase matrix.

3, biochip according to claim 2 is characterized in that: described sample band and detection molecules band are vertical.

4, according to claim 1 or 2 or 3 described biochips, it is characterized in that: described sample is probe or biomolecules; Described solid-phase matrix selection is a silicon, plastics, glass, pottery, rubber, a kind of in metal or the Hybond membrane.

5, biochip according to claim 4 is characterized in that: described biomolecules is DNA, RNA, peptide nucleic acid(PNA), locked nucleic acid, protein, peptide, antibody, polysaccharide, cell, one or more in animal tissues or the plant tissue; Described probe is DNA, RNA, peptide nucleic acid(PNA), locked nucleic acid, protein, peptide, one or more in antibody or the polysaccharide.

6, application rights requires the method that 1 described biochip detects, comprise the steps: 1) along with biochip on the direction that intersects of sample band make the some detection molecules lines corresponding on the solid-phase matrix surface with sample, make detection molecules and be fixed on example reaction on the solid-phase matrix; 2) clean back detection signal point.

7, detection method according to claim 6 is characterized in that: step 2) before the described cleaning also through super-dry.

8, detection method according to claim 7 is characterized in that: the described dry air-permeable envelope drying that adopts.

9, according to claim 7 or 8 described detection methods, it is characterized in that: described drying temperature is 0-80 ℃; Described dry humidity is 0%-80%.

10, according to claim 6 or 7 or 8 described detection methods, it is characterized in that: the described detection molecules line of step 1) is to adopt biochip point sample instrument point system.

11, according to claim 6 or 7 or 8 described detection methods, it is characterized in that, the described detection molecules line of step 1) can be to adopt the microfluidic channel method to make, comprise the steps: a) along with biochip on the direction that intersects of sample band on the solid-phase matrix surface bonding on microfluidic channel; B) reaction solution that contains detection molecules is entered in the described microfluidic channel, with the example reaction that is fixed on the solid-phase matrix.