CN1200115C - Oligonucleotide chip and its application of detecting muatatonal site of hepatitis B virus - Google Patents

Oligonucleotide chip and its application of detecting muatatonal site of hepatitis B virus Download PDF

Info

Publication number
CN1200115C
CN1200115C CN 02135625 CN02135625A CN1200115C CN 1200115 C CN1200115 C CN 1200115C CN 02135625 CN02135625 CN 02135625 CN 02135625 A CN02135625 A CN 02135625A CN 1200115 C CN1200115 C CN 1200115C
Authority
CN
China
Prior art keywords
oligonucleotide
site
probe
hepatitis
chip
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN 02135625
Other languages
Chinese (zh)
Other versions
CN1431317A (en
Inventor
鲁艳芹
韩金祥
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Provincial Pharmaceutical Biological Tech Research Center
Original Assignee
Shandong Provincial Pharmaceutical Biological Tech Research Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Provincial Pharmaceutical Biological Tech Research Center filed Critical Shandong Provincial Pharmaceutical Biological Tech Research Center
Priority to CN 02135625 priority Critical patent/CN1200115C/en
Publication of CN1431317A publication Critical patent/CN1431317A/en
Application granted granted Critical
Publication of CN1200115C publication Critical patent/CN1200115C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to an oligonucleotide chip and the application thereof for detecting a mutation site of hepatitis B viruses, which belongs to the technical field of a gene chip. The oligonucleotide detection chip comprises a glass substrate and a coating layer with 72 oligonucleotide probes in array distribution and contract points. The oligonucleotide probes comprise 12 known mutation sites at the pre-core antigen region and a surface antigen region of hepatitis B and the corresponding wild sites of the 12 known mutation sites. The oligonucleotide probes on the glass substrate are used as solid phase primers; hepatitis B virus DNA is used as a template; three pairs of liquid phase primers are mixed, and then solid phase PCR is amplified by Cy3-dCTP marked by fluorescence. The mutation sites are analyzed according to the strength of fluorescence signals of different sites on the oligonucleotide chip. The oligonucleotide chip integrates the oligonucleotide chip and the solid phase PCR and has the characteristics of high speed, high efficiency, accuracy and parallel diagnosis.

Description

Oligonucleotide chip and the application in the hepatitis B virus mutational site is detected thereof
(1) technical field
The present invention relates to the biochip technology field, relate to the oligonucleotide detection chip in hepatitis B virus mutational site specifically, utilize the solid phase PCR of oligonucleotide chip to detect the hepatitis B virus mutational site.
(2) background technology
Biochip technology is an emerging biotechnology that grows up in nineteen nineties, and it is the integrated of polymerase chain reaction (PCR) and Shao Shi (Southern) hybridization.It is fixed on carrier surface by microelectronics and micro-processing technology in an orderly manner with the DNA of a large amount of particular sequences, forms the DNA array that stores bulk information.Behind the probe hybridization of this array and mark, obtain bulk information at short notice quickly and accurately.Characteristics with high-throughput, micromation and parallel analysis.The preparation of gene chip mainly contains dual mode, solid phase synthesis and synthetic back point sample.This (Affymetrix) company of Ai Feimai Rake utilizes solid phase photochemistry synthesis method to develop a series of oligonucleotide chips, and every square centimeter of quantity that goes up probe can reach 244000.But this method is synthesized the cost height, is not suitable for long oligonucleotide fragment.Synthetic back point sample method can be used for long oligonucleotide fragment or PCR product.
Classification by function, gene chip can be divided into cDNA chip and oligonucleotide chip, and the former can be used for the analysis of gene function.Oligonucleotide chip has the potential advantage except drawing the express spectra at aspects such as high-flux sequence, clinical diagnosis, the detection of disease resistance, single nucleotide polymorphism, gene types.The sudden change detection of for example research of human mitochondrion 16.6kb genome polymorphism, BRCA I exons 11, cftr gene, ATM gene, HIV-1 reversed transcriptive enzyme and proteinase gene, branch bar be identification not of the same race and the plain resistance detection of sharp good fortune enzyme etc. in belonging to.
Fragment and the specific oligonucleotide probe hybridization of equipotential that oligonucleotide chip identification form nucleotide polymorphisms (SNPs) or single base mutation can obtain by pcr amplification come analytical results according to the power of signal.But, change the thermostability that reaction conditions such as temperature, the rigorous degree of hybridization etc. can only partly improve hybridization efficiency and heterozygote because sequence, the structural relation of the thermostability of the hybridization efficiency of nucleic acid and formation heterozygote and nucleic acid are close.Because this is restricted, derives many novel methods and new approaches.To synthetic back point sample, also deposit by superchip and low density chip while by initial solid phase synthesis for oligonucleotide chip.Also arise at the historic moment based on the micrometering preface of oligonucleotide arrays, single-basic extension, solid phase PCR etc.
Hepatitis is the Pandemic infection disease, and China is the hepatitis big country that generally acknowledges, the morbidity of hepatitis and sickness rate are all at the forefront in the world, and especially hepatitis B distributes the widest in China.The infection of hepatitis virus, not only, also closely related with the generation of liver cirrhosis, liver cancer with anxious slow, hepatitis.The sudden change of hepatitis B virus gene different loci can cause immune evasion, antiviral therapy escape, makes clinical detection omission, inappropriate medication occur, so that delay treatment.Traditional hepatitis B sudden change detects, and normally realizes by restriction fragment length polymorphism analysis various molecule markers, pcr amplifications such as (RFLP).When they are difficult to accomplish to a large amount of sample, parallel analysis, and required sample size is big, detection sensitivity is low, the operating time is long.
(3) summary of the invention
The present invention is directed to the deficiencies in the prior art, oligonucleotide chip and the application in the hepatitis B virus mutational site is detected thereof are provided.
The total design of the present invention is that collection oligonucleotide chip and solid phase PCR react on one.In the PCR reaction, the characteristics that when there is mispairing in 3 ' end of primer, can not correctly extend in view of the TaqDNA polysaccharase, with the 3 ' end of mutational site design in detection probes, then its 5 ' end is fixed on the process glass substrate of chemically modified as the probe of oligonucleotide chip, the solid phase primer of solid phase PCR reaction, its 3 ' free end.Design different liquid phase primers, itself and solid phase primer are matched.Be efficient and the accuracy of guaranteeing to increase, institute amplification PCR zone is no more than 150bp, and fluorescent mark adopts Cy3-dCTP.Fluorescent scanning or fluorescence microscope (seeing accompanying drawing 1) are adopted in solid phase pcr amplification result's detection.
In the present invention, three pairs of liquid phase primers have been adopted.Upstream primer 3 and downstream primer 3 are used to increase and comprise the zone in known mutations site, S district.Sudden change was united in 1762,1764 sites, C district before upstream primer 1 was used to increase with downstream primer 1, other mutational site, C district before upstream primer 2 increases with downstream primer 2.Upstream primer in the liquid phase mixture respectively with its corresponding antisense strand on the oligonucleotide detection probes, i.e. solid phase downstream primer pairing.Downstream primer in the liquid phase mixture respectively with its corresponding positive-sense strand on oligonucleotide probe, i.e. solid phase upstream primer pairing.Thereby amplify different length, comprise having of mutational site information of fluorescently-labeled fragment.
Among the present invention, each mutational site of hepatitis B is designed respectively on the positive and negative adopted chain of DNA the relevant detection probe, corresponding with detection probes in addition simultaneously, only lacks 3 ' terminal base to be detected at interior positive control probe.So each mutational site design has 6 oligonucleotide probes, 2 of positive control probes, 2 of detection probes of sudden change, 2 of wild detection probes design respectively on the positive and negative adopted chain of DNA.According to positive control, if the positive signal intensity of the mutant probe on positive and negative adopted chain in a certain site, proves that this site is homozygous mutation site M/M far above wild probe; Otherwise be the wild site W/W that isozygotys.If the probe signals intensity of same site on positive and negative adopted chain is close, prove that this site is heterozygosis site M/W.
Oligonucleotide detection chip of the present invention, comprise the oligonucleotide probe of glass substrate and array distribution and the some coating of contrast, described some coating is that array is equally distributed on glass substrate, contains 72 oligonucleotide probes that comprise the preceding core antigenic region of hepatitis B and known 12 mutational sites, surface antigen district and its corresponding wild site.
Above-mentioned glass substrate is the silanized glass slide glass, or through trimethoxy propyl group-ethyleneimine modification, Succinic Acid-N-hydroxylation succimide ester activatory glass slide.
All probes on the above-mentioned oligonucleotide chip are connected on the slide after the modification by 5 ' terminal amino group hexane.
The size of the some coating of above-mentioned oligonucleotide probe place array and contrast can be according to the size of point, the variation of dot spacing and changing; The arrangement of array and distributed quantity can change according to the number of sample to be analyzed.
Above-mentioned oligonucleotide probe is arranged as shown in Figure 3, and the probe points diameter is 100 μ m, and when dot spacing was 300 μ m, peptide nucleic acid probe place array was 2.2mm * 2.5mm with corresponding some coating size.
12 mutational sites that 72 above-mentioned oligonucleotide probes comprise are hepatitis B surface antigen district known 5 mutational site: 546C-T, 551A-G, 552T-C, 585A-C, 587G-A; Preceding core antigenic region 7 known mutational site: 1896G-A, 1762A-T and 1764G-A unite sudden change, 1858C-T, 1862G-T, 1898G-A, 1899G-A, 1901G-A.
72 above-mentioned oligonucleotide probes, each site to be detected comprises 6 probes, the positive and negative adopted chain probe in mutational site and wild site amounts to 4.2 of positive control probes lay respectively at positive and negative adopted chain, and it lacks 3 ' terminal base to be detected.
The length of above-mentioned oligonucleotide probe is 14-19mer, and the Tm value differs and is no more than 10 ℃, and GC base percentage composition is 50%-70%.
The application of oligonucleotide chip of the present invention in the hepatitis B virus mutational site is detected, method comprise the design of (1) hepatitis B mutational site detection oligonucleotide probe and synthesize; (2) modification of glass substrate and oligonucleotide probe is fixing; (3) extraction of hepatitis B sample DNA; (4) solid phase pcr amplification; (5) washing of oligonucleotide chip and signal detection analysis.
Above-mentioned solid phase PCR carries out on oligonucleotide chip; The solid phase primer is the probe on the oligonucleotide chip, and the liquid phase primer is the mixture of upstream primer 1,2,3 and downstream primer 1,2,3; Adopt Cy3-dCTP fluorescence to mix mark among the pcr amplification.
3 pairs of liquid phase primers in the above-mentioned solid phase pcr amplification, be respectively to be used to increase the upstream primer 3 and downstream primer 3 in the zone that comprises known mutations site, S district, the C district unites in 1762,1764 sites the upstream primer 1 and downstream primer 1 of sudden change before being used to increase, the upstream primer 2 and downstream primer 2 in other mutational site, C district before being used to increase; 3 pairs of liquid phase primers are specific as follows:
Primer Initiation site Sequence Length The Tm value GC％
Upstream primer 1 1700 5’GAGGCATACTTCAAAGACTG 3’ 20 71.1 45
Downstream primer 1 1779 5’ATTTATGCCTACAGCCTCC 3’ 19 70.8 47.4
Upstream primer 2 1828 5’CACCTCTGCCTAATCATCT 3’ 19 70.8 47.4
Downstream primer 2 1919 5’AG CTCCAAATTCTTTAT 17 60.3 29.4
Upstream primer 3 460 5’GGTATGTTGCCCGTTTGTCC 3’ 20 75.2 55.5
Downstream primer 3 601 5’GATGGGATGGGAATACA 3’ 17 67.6 47.1
The Tm value is a melting temperature(Tm), and GC% is guanine and cytosine(Cyt) percentage composition.
The application of oligonucleotide chip of the present invention in the hepatitis B virus mutational site is detected specifically may further comprise the steps:
1, the hepatitis B mutational site is detected the design of oligonucleotide probe and is synthesized
Adopt reason difficult to understand to collude 5.0 (Oligo5.0) software and come designing probe.Detection probes adopts oligodeoxynucleotide, and length is 14-19mer, and the probe in each mutational site comprises 2 sudden change detection probes, 2 wild detection probes, 2 positive control probes, designs the positive and negative adopted chain at hepatitis B DNA respectively. Article 4,3 of detection probes ' terminal last base is respectively mutational site to be detected on the positive and negative adopted chain, and 2 positive control probes lack 3 ' terminal base to be detected.(accompanying drawing 2 is S district 546 site probe design synoptic diagram), the Tm value of all probes is pressed the GC percentage calculation, between 65 ℃-75 ℃.Used probe in the oligonucleotide chip (giving birth to worker bio-engineering corporation by Shanghai synthesizes) information sees Table 1.5 of probe ' end is connected with aminohexane NH 2-(CH2) bTo combine with the activatory glass substrate.Aminohexane links to each other with oligonucleotide probe by polyT15, the adding of poly thymus pyrimidine, and check in the space that can reduce between oligonucleotide probe and the glass substrate, is beneficial to the carrying out of PCR.
2, the modification of glass substrate and oligonucleotide probe is fixing
Handle clean blank slide with silylating reagent, the silanization slide that obtains can be directly used in point sample.Or with slide with 1%-3% trimethoxy propyl group-ethyleneimine (95% ethanol preparation) solution-treated slide 1 hour, (with 9: the DMSO of 1V/V: DMF configuration) processing is 5 hours to use Succinic Acid-N-hydroxylation succimide ester solution then.
Oligonucleotide probe adopts the sodium carbonate salt buffer soln of pH9.0 as sampling liquid, oligonucleotide probe is that six probes in each site are one group in on-chip distribution principle, and array area can change according to the variation of the arrangement of probe and point, dot spacing.In the accompanying drawing 3, the numeral in the circle is consistent with probe numbering in the table 1, and this array 8 row 9 altogether is listed as, and the probe points diameter is 100 μ m, and dot spacing is 300 μ m, and the total area is 2.2mm * 2.5mm.1-6,7-12,13-18,19-24,25-30,31-36,37-42,43-48,49-54,55-60,61-66,67-72 represent site 546,551,552,585,587 to be detected, hepatitis B S district respectively; 12 groups of 72 oligonucleotide detection probes such as site 1896,1762,1764,1858,1862,1898,1899,1901 to be detected, preceding C district.Two rows arranged about 6 probes of each group divided, and a row on the left side is respectively the positive control on this site positive-sense strand, wild probe and mutant probe from top to bottom; One row on the right is respectively the positive control on this site antisense strand, wild probe and mutant probe from top to bottom.Array behind the point sample is directly used in the solid phase pcr amplification after hydration.
3, the extraction of hepatitis B sample DNA
Get hepatitis B patients serum 20-100 μ l, add the lysate thermal agitation mixing of 3 times of volumes.Add isopyknic chloroform, primary isoamyl alcohol solution (24: 1) then, centrifugal behind the mixing.Collect supernatant liquor, the dehydrated alcohol that adds 2 times of volumes was placed 2 hours in-20 ℃, and centrifugal back gained precipitation is with 70% ethanol washing and precipitating 2 times, seasoning.
4, solid phase pcr amplification
Used solid phase primer is the oligonucleotide probe that is fixed on the array in the solid phase pcr amplification, and the phase primer is the mixture of three pairs of upstream and downstream primers.MJ Research PTC-200 solid phase pcr amplification instrument is adopted in amplification, and the system of answering is 10 μ l.
The pcr amplification program of adopting is:
94 ℃ of 1 circulations in 6 minutes
94 ℃ 15 seconds, 60 ℃ 30 seconds, 72 ℃ 45 seconds, 50 circulations
5, the washing of oligonucleotide chip and signal detection analysis
(0.15M NaCI, 17mM Trisodium Citrate pH7.0), include 0.1% SDS solution and clean twice oligonucleotide arrays behind the solid phase pcr amplification with 1 * SSC.Oligonucleotide arrays after the cleaning is through laser scanner scans or fluorescence microscope and collect signal, analyzing and testing result.If scanning result shows the positive control in a certain site fluorescent signal is arranged, the wild probe positive signal of positive and negative adopted chain proves that far above the strength of signal of mutant probe this site is the wild site W/W that isozygotys.Otherwise be homozygous mutation site M/M.If same site is close in the probe signals intensity of positive and negative adopted chain, prove that this site is heterozygosis site M/W.
S district and C region mutation site detection probes before table 1 hepatitis B
The site Numbering Probe sequence Length The Tm value GC％
546 1 5′NH 2-(CH2) 6-T 15-ACTCCTGCTCAAGGAA 3′ 16 66.9 50
2 5′NH 2-(CH2) 6-T 15-ACTCCTGCTCAAGGAAC 3′ 17 70 52.9
3 5′NH 2-(CH2) 6-T 15-ACTCCTGCTCAAGGAAT 3′ 17 67.6 47.1
4 5′NH 2-(CH2) 6-T 15-AAGAGGGAAACATAGAG 3′ 17 65.1 41.2
5 5′NH 2-(CH2) 6-T 15-AAGAGGGAAACATAGAGG 3′ 18 68.1 44.4
6 5′NH 2-(CH2) 6-T 15-AAGAGGGAAACATAGAGA 3′ 18 65.8 38.9
551 7 5′NH 2-(CH2) 6-T 15-TGCTCAAGGAACCTCT 3′ 16 66.9 50
8 5′NH 2-(CH2) 6-T 15-TGCTCAAGGAACCTCTA 3′ 17 67.6 47.1
9 5′NH 2-(CH2) 6-T 15-TGCTCAAGGAACCTCTG 3′ 17 70 52.9
10 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACA 3′ 17 67.6 47.1
11 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACAT 3′ 18 68.1 44.4
12 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACAC3′ 18 70.4 50
552 13 5′NH 2-(CH2) 6-T 15-GCTCAAGGAACCTCTA 3′ 16 66.9 50
14 5′NH 2-(CH2) 6-T 15-GCTCAAGGAACCTCTAT 3′ 17 67.6 47.1
15 5′NH 2-(CH2) 6-T 15-GCTCAAGGAACCTCTAC 3′ 17 70 52.9
16 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAAC 3′ 16 66.9 50
17 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACA 3′ 17 67.6 47.1
18 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACG 3′ 17 70 52.9
585 19 5′NH 2-(CH2) 6-T 15-CTGTACAAAACCTTCGG 3′ 17 67.6 47.1
20 5′NH 2-(CH2) 6-T 15-CTGTACAAAACCTTCGGA 3′ 18 68.1 44.4
21 5′NH 2-(CH2) 6-T 15-CTGTACAAAACCTTCGGC 3′ 18 70.4 50
22 5′NH 2-(CH2) 6-T 15-ACAGGTGCAGTTTCCG 3′ 16 69.5 56.2
23 5′NH 2-(CH2) 6-T 15-ACAGGTGCAGTTTCCGT 3′ 17 70 52.9
24 5′NH 2-(CH2) 6-T 15-ACAGGTGCAGTTTCCGG 3′ 17 72.4 88.8
25 5′NH 2-(CH2) 6-T 15-GTACAAAACCTTCGGAC 3′ 17 67.6 47.1
26 5′NH 2-(CH2) 6-T 15-GTACAAAACCTTCGGACG 3′ 18 70.4 50
587 27 5′NH 2-(CH2) 6-T 15-GTACAAAACCTTCGGACA 3′ 18 68.1 44.4
28 5′NH 2-(CH2) 6-T 15-AATACAGGTGCAGTTTC 3′ 17 65.1 41.2
29 5′NH 2-(CH2) 6-T 15-AATACAGGTGCAGTTTCC 3′ 18 68 44.4
30 5′NH 2-(CH2) 6-T 15-AATACAGGTGCAGTTTCT 3′ 18 65.8 38.9
1762 31 5′NH 2-(CH2) 6-T 15-GGAGGAGATTAGGTTAA 3′ 17 65.1 41.2
32 5′NH 2-(CH2) 6-T 15-GGAGGAGATTAGGTTAAA 3′ 18 65.8 38.9
33 5′NH 2-(CH2) 6-T 15-GGAGGAGATTAGGTTAAT 3′ 18 65.8 38.9
34 5′NH 2-(CH2) 6-T 15-CTCCTAGTACAAAGA 3′ 15 60.7 40
35 5′NH 2-(CH2) 6-T 15-CTCCTAGTACAAAGACCT 3′ 18 68.1 44.4
36 5′NH 2-(CH2) 6-T 15-CTCCTAGTACAAAGATCA 3′ 18 65.8 38.9
1764 37 5′NH 2-(CH2) 6-T 15-GAGGAGATTAGGTTAA 3′ 16 61.8 37.5
38 5′NH 2-(CH2) 6-T 15-GAGGAGGTTAGGTTAAAGG 3′ 19 70.8 47.4
39 5′NH 2-(CH2) 6-T 15-GAGGAGGTTAGGTTAATGA 3′ 19 68.6 42.1
40 5′NH 2-(CH2) 6-T 15-GCCTCCTAGTACAAAGA 3′ 17 67.6 47.1
41 5′NH 2-(CH2) 6-T 15-GCCTCCTAGTACAAAGAC 3′ 18 70.4 50
42 5′NH 2-(CH2) 6-T 15-GCCTCCTAGTACAAAGAT 3′ 18 68.1 44.4
1858 43 5′NH 2-(CH2) 6-T 15-ATCTCATGTTCATGTCC 3′ 17 65.1 41.2
44 5′NH 2-(CH2) 6-T 15-ATCTCATGTTCATGTCCC 3′ 18 65.8 38.9
45 5′NH 2-(CH2) 6-T 15-ATCTCATGTTCATGTCCT 3′ 18 68.1 44.4
46 5′NH 2-(CH2) 6-T 15-TGGAGGCTTGAACAGT 3′ 16 66.9 50
47 5′NH 2-(CH2) 6-T 15-TGGAGGCTTGAACAGTG 3′ 17 67.6 47.1
48 5′NH 2-(CH2) 6-T 15-TGGAGGCTTGAACAGTA 3′ 17 70 52.9
1862 49 5′NH 2-(CH2) 6-T 15-CATGTTCATGTCCTACT 3′ 17 65.1 45.2
50 5′NH 2-(CH2) 6-T 15-CATGTTCATGTCCTACTG 3′ 18 68.1 44.4
51 5′NH 2-(CH2) 6-T 15-CATGTTCATGTCCTACTT 3′ 18 65.8 38.9
52 5′NH 2-(CH2) 6-T 15-AGCTTGGAGGCTTGAA 3′ 16 66.9 50
53 5′NH 2-(CH2) 6-T 15-AGCTTGGAGGCTTGAAC 3′ 17 70 52.9
54 5′NH 2-(CH2) 6-T 15-AGCTTGGAGGCTTGAAA 3′ 17 67.6 47.1
1896 55 5′NH 2-(CH2) 6-T 15-GCCTTGGGTGGCTTT 3′ 15 68.9 60
56 5′NH 2-(CH2) 6-T 15-GCCTTGGGTGGCTTTG 3′ 16 72 62.5
57 5′NH 2-(CH2) 6-T 15-GCCTTGGGTGGCTTTA 3′ 16 69.5 56.2
58 5′NH 2-(CH2) 6-T 15-GTCAATGTCCATGCCC 3′ 16 69.5 56.2
59 5′NH 2-(CH2) 6-T 15-GTCAATGTCCATGCCCC 3′ 17 72.4 58.8
60 5′NH 2-(CH2) 6-T 15-GTCAATGTCCATGCCCT 3′ 17 70 52.9
1898 61 5′NH 2-(CH2) 6-T 15-CTTGGGTGGCTTTGG 3′ 15 68.9 60
62 5′NH 2-(CH2) 6-T 15-CTTGGGTGGCTTTGGG 3′ 16 72 62.5
63 5′NH 2-(CH2) 6-T 15-CTTGGGTGGCTTTGGA 3′ 16 69.5 56.2
64 5′NH 2-(CH2) 6-T 15-GGGTCAATGTCCATGC 3′ 16 69.5 56.2
65 5′NH 2-(CH2) 6-T 15-GGGTCAATGTCCATGCC 3′ 17 72.4 58.8
66 5′NH 2-(CH2) 6-T 15-GGGTCAATGTCCATGCT3′ 17 70 52.9
1901 67 5′NH 2-(CH2) 6-T 15-GGTGGCTTTGGGGC 3′ 14 71.2 71.4
68 5′NH 2-(CH2) 6-T 15-GGTGGCTTTGGGGCG 3′ 15 74.4 73.3
69 5′NH 2-(CH2) 6-T 15-GGTGGCTTTGGGGCA 3′ 15 71.7 66.7
70 5′NH 2-(CH2) 6-T 15-TACGGGTCAATGTCCA 3′ 16 66.9 50
71 5′NH 2-(CH2) 6-T 15-TACGGGTCAATGTCCAC 3′ 17 70 52.9
72 5′NH 2-(CH2) 6-T 15-TACGGGTCAATGTCCAT 3′ 17 67.6 47.1
Wherein, the ordering of 6 probes that each site marked is respectively the positive control probe of positive-sense strand, wild detection probes and sudden change detection probes by sequence number from low to high, the positive control probe of antisense strand, wild detection probes and sudden change detection probes.Simultaneously, the contents such as sequence, length, Tm value and GC per-cent that also comprised probe in this table.
Excellent results of the present invention is as follows:
1) the present invention integrates solid phase PCR and oligonucleotide chip.With traditional sudden change detection technique, to compare with RFLP equimolecular labeling technique as PCR, it detects a lot of mutational sites, a plurality of samples of parallel analysis in high-throughput ground simultaneously.Compare with the gene chip of routine, it directly in the enterprising performing PCR amplification of chip, can directly pass through scanning detecting result and unnecessary process hybridization after pcr amplification finishes, thereby shorten detection time.
2) the present invention is behind many wheel pcr amplifications, and the fluorescence signal intensity of mixing mark increases greatly, makes the sensitivity of this detection method improve greatly.
3) detect sudden change for oligonucleotide chip, sequence self structure to be detected is all influential to hybridization efficiency and hybrid stability, thereby detects when being difficult to realize to the mass mutation site.The characteristics that the present invention utilizes the TaqDNA polysaccharase can not correctly extend when there is mispairing in 3 ' end detect sudden change, and without hybridization.Thereby make it to be applicable to that the high-throughput sudden change detects and single nucleotide polymorphism analysis.
4) the present invention utilizes the solid phase PCR of oligonucleotide chip to react to detect the hepatitis B virus mutational site, can obtain the clinical information relevant with the mutational site, instruct clinical application.
(4) description of drawings
Fig. 1 is the schematic diagram that solid phase PCR of the present invention detects catastrophe point.
Fig. 2 is to be the positive and negative adopted probe design synoptic diagram of example with 546 sites, S district.Wherein, probe 1,2,3 is three probes on the positive-sense strand, and 4,5,6 is three probes on the antisense strand.Probe 1,4 is respectively the positive control in this site on the positive and negative adopted chain.2,5 be respectively the wild-type probe of this site on positive and negative adopted chain, 3,6 is the mutant probe of this site on positive and negative adopted chain.
Fig. 3 is the distribution schematic diagram of oligonucleotide probe on glass substrate.
Wherein, 1 is glass substrate, and 2 is the some coating of oligonucleotide probe and contrast.The listed oligonucleotide probe sequence number of numeral in the circle and table 1 is corresponding.
Fig. 4 is for utilizing the figure as a result of the oligonucleotide chip of laser confocal scanning instrument ScanArray4000 scanning (laser intensity is 80, and the PMT gain is 80) after solid phase pcr amplification and cleaning.Be distributed with 12 probes in hepatitis B 1896 and 1901 sites on the oligonucleotide chip.Wherein, 1 and 2 row are 6 probes in 1896 sites, and 3 and 4 row are 6 probes in 1901 sites.A1, B1, C1 are respectively the positive controls on the 1896 site positive-sense strands, wild site detection probes and mutational site detection probes; A2, B2, C2 are respectively the positive control on the 1896 site antisense strands, wild site detection probes and mutational site detection probes.The probe in 1901 sites is arranged as 1896 sites, and 3,4 row are respectively three probes on positive-sense strand and the antisense strand.
(5) embodiment
Embodiment 1. oligonucleotide chips
Structure is as shown in Figure 1: array is evenly distributed with the some coating 2 of oligonucleotide probe and contrast on glass substrate 1, wherein contain 72 oligonucleotide probes in the preceding C district of hepatitis B and known mutations site, S district and wild site, each site is equipped with positive control.Glass substrate is the rectangle thin slice, is the silanized glass slide glass, and the length of oligonucleotide probe is 14-19mer, and the Tm value differs and is no more than 10 ℃, and GC base percentage composition is 50%-70%.
Point coating 2 arrays of oligonucleotide probe and contrast amount to 8 row, 9 row, and the pin mark diameter is 100 μ m, and spacing is 300 μ m, and the total area is 2.2mm * 2.5mm.1-6,7-12,13-18,19-24,25-30,31-36,37-42,43-48,49-54,55-60,61-66,67-72 represent site 516,551,552,585,587 to be detected, hepatitis B S district respectively; 12 groups of 72 oligonucleotide detection probes such as site 1896,1762,1764,1858,1862,1898,1899,1901 to be detected, preceding C district.Two rows arranged about 6 probes of each group divided, and a row on the left side is respectively the positive control on this site positive-sense strand, wild probe and mutant probe from top to bottom; One row on the right is respectively the positive control on this site antisense strand, wild probe and mutant probe from top to bottom.Array behind the point sample is directly used in the solid phase pcr amplification after hydration.
Solid phase PCR carries out on oligonucleotide chip, and oligonucleotide probe is the solid phase primer of solid phase pcr amplification simultaneously, and three pairs of liquid phase primers have comprised the zone in all mutational sites to be detected, and guarantees that the longest amplified fragments is no more than 150bp.In solid phase pcr amplification process, adopt Cy-3-dCTP fluorescence to mix mark.The solid phase PCR product of oligonucleotide chip is through each mutational site of laser confocal scanning instrument scanning post analysis.
Embodiment 2. is as embodiment 1 described oligonucleotide chip, different is glass substrate 1 be through trimethoxy propyl group-ethyleneimine modify, Succinic Acid-N-hydroxylation succimide ester activatory glass slide.
Embodiment 3. oligonucleotide detection chip are used for the detection in hepatitis B virus mutational site
1. the hepatitis B mutational site is detected the design of oligonucleotide probe and is synthesized
Adopt Oligo5.0 software to come designing probe.Detection probes adopts oligodeoxynucleotide, and length is 14-19mer, and the probe in each mutational site comprises 2 sudden change detection probes, 2 wild detection probes, 2 positive control probes, designs the positive and negative adopted chain at hepatitis B DNA respectively.Article 4,3 of detection probes ' terminal last base is respectively mutational site to be detected on the positive and negative adopted chain, and 2 positive control probes lack 3 ' terminal base to be detected.The Tm value of (accompanying drawing 2 is S district 546 site probe design synoptic diagram) all probes is pressed the GC percentage calculation, between 65 ℃-75 ℃.Used probe in the oligonucleotide chip (giving birth to worker bio-engineering corporation by Shanghai synthesizes) information sees Table 1.5 of probe ' end is connected with aminohexane NH2 -(CH2) 6To combine with the activatory glass substrate.Aminohexane links to each other with oligonucleotide probe by polyT15, adds the poly thymus pyrimidine, checks with the space of reducing between oligonucleotide probe and the glass substrate, is beneficial to the carrying out of PCR.
2. the surface chemical modification of glass substrate and oligonucleotide probe is fixing
(1) surface chemical modification of glass substrate
1) slide glass was soaked 1 hour with 1MNaOH, soaked 1 hour with 1MHCI again after the washing.Pure water fully cleans the back and cleans 1 time with ethanol, dries.
2) under the room temperature above-mentioned slide was handled thermal agitation 1 hour with 3% 3-TSL 8330 (95% ethanolic soln preparation) or trimethoxy propyl group-ethyleneimine of 3% (95% ethanol preparation).
3) under the room temperature slide is cleaned 3 times each 5 minutes with 95% ethanolic soln.
4) use dull and stereotyped whizzer, centrifugal 8 minutes of 800rpm dries slide.
5) slide is placed 80 ℃, toasted 1 hour.The glass substrate of the 3-TSL 8330 silication that so far obtains can be directly used in the oligonucleotide binding probe, and the substrate that 3% trimethoxy propyl group-ethyleneimine is handled is proceeded following processing:
6) Succinic Acid-N-hydroxylation succimide ester solution (9: the DMSO of IV/V: DMF prepares) with 20mM was handled 5 hours under the room temperature.
7) clean slide twice, each 5 minutes with ethanol.
8) use dull and stereotyped whizzer, centrifugal 8 minutes of 800rpm dries slide.
(2) oligonucleotide probe is fixing
Oligonucleotide probe adopts the carbonate buffer solution of pH9.0 as sampling liquid, and concentration and probe concentration is 50 μ M.Utilize card tower gloomy 5500 (Cartesian Pixsys5500) point sample instrument that oligonucleotide probe is put on the activatory glass substrate, the arrangement of array as shown in Figure 3, spot diameter is 100 μ m, dot spacing is 300 μ m, array size is 2.2mm * 2.5mm.Behind the point sample and the oligonucleotide chip that obtains places the wet box that contains saturated NaCI solution, ambient temperature overnight, then slide is dipped in thanomin (with the Tris-CI configuration of 100mM, the pH value the is 9.0) solution of 150mM, 55 ℃ are reacted 20 minutes to seal unreacted Succinic Acid-N-succimide ester.
3. the solid phase PCR on the oligonucleotide chip
(1) extraction of hepatitis B virus DNA
1) gets 100 μ l hepatitis B patients serums, add lysate (4M guanidine thiocyanate, mercaptoethanol, 0.1MTris-CI, pH7.5) mixing of 3 times of volumes.
2) add isopyknic imitative, primary isoamyl alcohol solution (24: 1), fully mixing.12000rpm is centrifugal 15 minutes under the room temperature.
3) carefully supernatant liquor is moved in another 1.5ml centrifuge tube, add the dehydrated alcohol of 2 times of volumes.Placed 2 hours for-20 ℃.
4) 4 ℃, centrifugal 15 minutes of 12000rpm.
5) gained precipitation in centrifugal back is with 70% ethanol cleaning 2 times, at every turn at 4 ℃, and centrifugal 10 minutes of 12000rpm.
6) be dissolved in the 5.55 μ l pure water after the precipitation seasoning.
(2) solid phase pcr amplification
Adopt MJ Research PTC-200 solid phase pcr amplification instrument.
1) the PCR reaction system is 10 μ l, comprising
10 * PCR damping fluid, 1.0 μ l
2mM dATP dGTP dTTP mixture 1.0 μ l
2mM dCTP 0.65μl
1mM dCTP 0.7μl
3 pairs of liquid phase liquid phase primer mixtures (5 μ M), 1.0 μ l
Taq archaeal dna polymerase (5u/ μ l) 0.1 μ l
Hepatitis B DNA 5.55 μ l
10μl
Wherein the composition of 10 * PCR damping fluid is 500mM Tris-CI (pH8.3), 20mM MgCI 2, 0.75% bovine serum albumin.
2) the pcr amplification program of adopting is
94 ℃ of 1 circulations in 6 minutes
94 ℃ 15 seconds, 60 ℃ 30 seconds, 72 ℃ 45 seconds, 50 circulations
4. the cleaning of oligonucleotide chip, scanning and interpretation of result
Oligonucleotide arrays behind the solid phase pcr amplification includes 0.1% SDS solution cleaning twice, each 5 minutes with 1 * SSC.Oligonucleotide arrays after the cleaning is through laser confocal scanning instrument ScanArray4000 scanning and collect signal, analyzing and testing result.Fig. 4 is according to concrete grammar provided by the present invention, uses the slide stationary probe of modifying through the 3-TSL 8330, detects the hepatitis B virus DNA 1896 an of the unknown and the figure as a result of 1901 site mutations.This oligonucleotide chip has comprised 12 probes in hepatitis B virus 1896 and 1,901 two sites, and used liquid phase primer is upstream primer 2 and downstream primer 2.Among figure 1 and 2 row are 6 probes in 1896 sites, and 3 and 4 row are 6 probes in 1901 sites.A1, B1, C1 are respectively the positive controls on the 1896 site positive-sense strands, wild site detection probes and mutational site detection probes; A2, B2, C2 are respectively the positive control on the 1896 site antisense strands, wild site detection probes and mutational site detection probes.The probe in 1901 sites is arranged as 1896 sites, and 3,4 row are respectively three probes on positive-sense strand and the antisense strand.According to the fluorescence intensity of scanning result and positive control probe, the B1 in 1896 sites and the fluorescence signal intensity of B2 are all far above C1 and C2, so this site is wild isozygotying.The fluorescence intensity of C3 is higher than C2 in 1901 sites, proves that there is sudden change 1901G-A in 1901 sites on positive-sense strand.The fluorescence intensity of B4 is better than C4, and there is not sudden change in 1901 sites on antisense strand, so this site is wild heterozygosis.

Claims (6)

1. oligonucleotide chip, comprise the oligonucleotide probe of glass substrate and array distribution and the some coating of contrast, described some coating be equally distributed on glass substrate, contain 72 oligonucleotide probes that comprise known 12 mutational sites of core antigenic region and surface antigen district and its corresponding wild site before the hepatitis B, it is characterized in that, 12 mutational sites that described 72 oligonucleotide probes comprise are hepatitis B surface antigen district known 5 mutational site: 546C-T, 551A-G, 552T-C, 585A-C, 587G-A; Preceding core antigenic region 7 known mutational site: 1896G-A, 1762A-T and 1764G-A unite sudden change, 1858C-T, 1862G-T, 1898G-A, 1899G-A, 1901G-A; The size of the some coating of described oligonucleotide probe place array and contrast can be according to the size of point, the variation of dot spacing and changing, and the arrangement of array and distributed quantity can change according to the number of sample to be analyzed; Described oligonucleotide probe spot diameter is 100 μ m, and dot spacing is 300 μ m, and oligonucleotide probe place array and control point coating size are 2.2mm * 2.5mm; Above-mentioned 72 sequence oligonucleotide probes are as follows: The site Numbering Probe sequence Length The Tm value GC％ 546 1 5′NH 2-(CH2) 6-T 15-ACTCCTGCTCAAGGAA 3′ 16 66.9 50 2 5′NH 2-(CH2) 6-T 15-ACTCCTGCTCAAGGAAC 3′ 17 70 52.9 3 5′NH 2-(CH2) 6-T 15-ACTCCTGCTCAAGGAAT 3′ 17 67.6 47.1 4 5′NH 2-(CH2) 6-T 15-AAGAGGGAAACATAGAG 3′ 17 65.1 41.2 5 5′NH 2-(CH2) 6-T 15-AAGAGGGAAACATAGAGG 3′ 18 68.1 44.4 6 5′NH 2-(CH2) 6-T 15-AAGAGGGAAACATAGAGA 3′ 18 65.8 38.9 551 7 5′NH 2-(CH2) 6-T 15-TGCTCAAGGAACCTCT 3′ 16 66.9 50 8 5′NH 2-(CH2) 6-T 15-TGCTCAAGGAACCTCTA 3′ 17 67.6 471 9 5′NH 2-(CH2) 6-T 15-TGCTCAAGGAACCTCTG 3′ 17 70 52.9 10 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACA 3′ 17 67.6 47.1 11 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACAT 3′ 18 68.1 44.4 12 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACAC3′ 18 70.4 50 552 13 5′NH 2-(CH2) 6-T 15-GCTCAAGGAACCTCTA 3′ 16 66.9 50 14 5′NH 2-(CH2) 6-T 15-GCTCAAGGAACCTCTAT 3′ 17 67.6 47.1 15 5′NH 2-(CH2) 6-T 15-GCTCAAGGAACCTCTAC 3′ 17 70 52.9 16 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAAC 3′ 16 66.9 50 17 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACA 3′ 17 67.6 47.1
18 5′NH 2-(CH2) 6-T 15-GCAACAAGAGGGAAACG 3′ 17 70 52.9 585 19 5′NH 2-(CH2) 6-T 15-CTGTACAAAACCTTCGG 3′ 17 67.6 47.1 20 5′NH 2-(CH2) 6-T 15-CTGTACAAAACCTTCGGA 3′ 18 68.1 44.4 21 5′NH 2-(CH2) 6-T 15-CTGTACAAAACCTTCGGC 3′ 18 70.4 50 22 5′NH 2-(CH2) 6-T 15-ACAGGTGCAGTTTCCG 3′ 16 69.5 56.2 23 5′NH 2-(CH2) 6-T 15-ACAGGTGCAGTTTCCGT 3′ 17 70 52.9 24 5′NH 2-(CH2) 6-T 15-ACAGGTGCAGTTTCCGG 3′ 17 72.4 88.8 25 5′NH 2-(CH2) 6-T 15-GTACAAAACCTTCGGAC 3′ 17 67.6 47.1 26 5′NH 2-(CH2) 6-T 1 5-GTACAAAACCTTCGGACG 3′ 18 70 4 50 587 27 5′NH 2-(CH2) 6-T 15-GTACAAAACCTTCGGACA 3′ 18 68.1 44.4 28 5′NH 2-(CH2) 6-T 15-AATACAGGTGCAGTTTC 3′ 17 65.1 41.2 29 5′NH 2-(CH2) 6-T 15-AATACAGGTGCAGTTTCC 3′ 18 68 44.4 30 5′NH 2-(CH2) 6-T 15-AATACAGGTGCAGTTTCT 3′ 18 65.8 38.9 1762 31 5′NH 2-(CH2) 6-T 15-GGAGGAGATTAGGTTAA 3′ 17 65.1 41.2 32 5′NH 2-(CH2) 6-T 15-GGAGGAGATTAGGTTAAA 3′ 18 65.8 38.9 33 5′NH 2-(CH2) 6-T 15-GGAGGAGATTAGGTTAAT 3′ 18 65.8 38.9 34 5′NH 2-(CH2) 6-T 15-CTCCTAGTACAAAGA 3′ 15 60.7 40 35 5′NH 2-(CH2) 6-T 15-CTCCTAGTACAAAGACCT 3′ 18 68.1 44.4 36 5′NH 2-(CH2) 6-T 15-CTCCTAGTACAAAGATCA 3′ 18 65.8 38.9 1764 37 5′NH 2-(CH2) 6-T 15-GAGGAGATTAGGTTAA 3′ 16 61.8 37.5 38 5′NH 2-(CH2) 6-T 15-GAGGAGGTTAGGTTAAAGG 3′ 19 70.8 47.4 39 5′NH 2-(CH2) 6-T 15-GAGGAGGTTAGGTTAATGA 3′ 19 68.6 42.1 40 5′NH 2-(CH2) 6-T 15-GCCTCCTAGTACAAAGA 3′ 17 67.6 47.1 41 5′NH 2-(CH2) 6-T 15-GCCTCCTAGTACAAAGAC 3′ 18 70.4 50 42 5′NH 2-(CH2) 6-T 15-GCCTCCTAGTACAAAGAT 3′ 18 68.1 44.4 1858 43 5′NH 2-(CH2) 6-T 15-ATCTCATGTTCATGTCC 3′ 17 65.1 41.2 44 5′NH 2-(CH2) 6-T 15-ATCTCATGTTCATGTCCC 3′ 18 65.8 38.9 45 5′NH 2-(CH2) 6-T 15-ATCTCATGTTCATGTCCT 3′ 18 68.1 44.4 46 5′NH 2-(CH2) 6-T 15-TGGAGGCTTGAACAGT 3′ 16 66.9 50 47 5′NH 2-(CH2) 6-T 15-TGGAGGCTTGAACAGTG 3′ 17 67.6 47.1
48 5′NH 2-(CH2) 6-T 15-TGGAGGCTTGAACAGTA 3′ 17 70 52.9 1862 49 5′NH 2-(CH2) 6-T 15-CATGTTCATGTCCTACT 3′ 17 65.1 45 2 50 5′NH 2-(CH2) 6-T 15-CATGTTCATGTCCTACTG 3′ 18 68.1 44.4 51 5′NH 2-(CH2) 6-T 15-CATGTTCATGTCCTACTT 3′ 18 65.8 38.9 52 5′NH 2-(CH2) 6-T 15-AGCTTGGAGGCTTGAA 3′ 16 66.9 50 53 5′NH 2-(CH2) 6-T 15-AGCTTGGAGGCTTGAAC 3′ 17 70 52.9 54 5′NH 2-(CH2) 6-T 15-AGCTTGGAGGCTTGAAA 3′ 17 67.6 47.1 1896 55 5′NH 2-(CH2) 6-T 15-GCCTTGGGTGGCTTT 3′ 15 68.9 60 56 5′NH 2-(CH2) 6-T 15-GCCTTGGGTGGCTTTG 3′ 16 72 62.5 57 5′NH 2-(CH2) 6-T 15-GCCTTGGGTGGCTTTA 3′ 16 69.5 56.2 58 5′NH 2-(CH2) 6-T 15-GTCAATGTCCATGCCC 3′ 16 69.5 56.2 59 5′NH 2-(CH2) 6-T 15-GTCAATGTCCATGCCCC 3′ 17 72.4 58.8 60 5′NH 2-(CH2) 6-T 15-GTCAATGTCCATGCCCT 3′ 17 70 52.9 1898 61 5′NH 2-(CH2) 6-T 15-CTTGGGTGGCTTTGG 3′ 15 68.9 60 62 5′NH 2-(CH2) 6-T 15-CTTGGGTGGCTTTGGG 3′ 16 72 62.5 63 5′NH 2-(CH2) 6-T 15-CTTGGGTGGCTTTGGA 3′ 16 69.5 56.2 64 5′NH 2-(CH2) 6-T 15-GGGTCAATGTCCATGC 3′ 16 69.5 56.2 65 5′NH 2-(CH2) 6-T 15-GGGTCAATGTCCATGCC 3′ 17 72.4 58.8 66 5′NH 2-(CH2) 6-T 15-GGGTCAATGTCCATGCT3′ 17 70 52.9 1901 67 5′NH 2-(CH2) 6-T 15-GGTGGCTTTGGGGC 3′ 14 71.2 71.4 68 5′NH 2-(CH2) 6-T 15-GGTGGCTTTGGGGCG 3′ 15 74.4 73.3 69 5′NH 2-(CH2) 6-T 15-GGTGGCTTTGGGGCA 3′ 15 71.7 66.7 70 5′NH 2-(CH2) 6-T 15-TACGGGTCAATGTCCA 3′ 16 66.9 50 71 5′NH 2-(CH2) 6-T 15-TACGGGTCAATGTCCAC 3′ 17 70 52.9 72 5′NH 2-(CH2) 6-T 15-TACGGGTCAATGTCCAT 3′ 17 67.6 47.1
2. oligonucleotide chip as claimed in claim 1 is characterized in that, described glass substrate is the silanized glass slide glass, or modifies and Succinic Acid-N-hydroxylation succimide ester activatory glass slide through trimethoxy propyl group-ethyleneimine.
3. oligonucleotide chip as claimed in claim 1 or 2 is characterized in that, described oligonucleotide probe by 5 ' terminal aminohexane is connected on the slide after the modification.
4. oligonucleotide chip as claimed in claim 1, it is characterized in that, described oligonucleotide probe, each site to be detected comprises 6 probes, the positive and negative adopted chain probe in mutational site and wild site amounts to 4,2 of positive control probes lay respectively at positive and negative adopted chain, and it lacks 3 ' terminal base to be detected.
5. oligonucleotide chip as claimed in claim 1 is characterized in that, the length of described oligonucleotide probe is 14-19mer, and the Tm value differs and is no more than 10 ℃, and the GC percentage composition is 50%-70%.
6. the application of the described oligonucleotide chip of claim 1 in the hepatitis B virus mutational site is detected comprises that the design of (1) hepatitis B mutational site detection oligonucleotide probe reaches synthetic; (2) modification of glass substrate and oligonucleotide probe is fixing; (3) extraction of hepatitis B sample DNA; (4) solid phase pcr amplification; (5) washing of oligonucleotide chip and signal detection analysis; Described solid phase PCR carries out on oligonucleotide chip; The solid phase primer is the probe on the oligonucleotide chip simultaneously, and the liquid phase primer is the mixture of upstream primer 1,2,3 and downstream primer 1,2,3; Adopt Cy3-dCTP fluorescence to mix mark among the pcr amplification; 3 pairs of liquid phase primers in the described solid phase pcr amplification, be respectively to be used to increase the upstream primer 3 and downstream primer 3 in the zone that comprises known mutations site, S district, the C district unites in 1762,1764 sites the upstream primer 1 and downstream primer 1 of sudden change before being used to increase, the upstream primer 2 in other mutational site, C district is specific as follows with 2,3 pairs of liquid phase primers of downstream primer before being used to increase: Primer Initiation site Sequence Length The Tm value GC％ Upstream primer 1 1700 5’GAGGCATACTTCAAAGACTG 3’ 20 71.1 45 Downstream primer 1 1779 5’ATTTATGCCTACAGCCTCC 3’ 19 70.8 47.4 Upstream primer 2 1828 5’CACCTCTGCCTAATCATCT 3’ 19 70.8 47.4 Downstream primer 2 1919 5’AG CTCCAAATTCTTTAT 17 60.3 29.4 Upstream primer 3 460 5’GGTATGTTGCCCGTTTGTCC 3’ 20 75.2 55.5 Downstream primer 3 601 5’GATGGGATGGGAATACA 3’ 17 67.6 47.1
CN 02135625 2002-10-14 2002-10-14 Oligonucleotide chip and its application of detecting muatatonal site of hepatitis B virus Expired - Fee Related CN1200115C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 02135625 CN1200115C (en) 2002-10-14 2002-10-14 Oligonucleotide chip and its application of detecting muatatonal site of hepatitis B virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 02135625 CN1200115C (en) 2002-10-14 2002-10-14 Oligonucleotide chip and its application of detecting muatatonal site of hepatitis B virus

Publications (2)

Publication Number Publication Date
CN1431317A CN1431317A (en) 2003-07-23
CN1200115C true CN1200115C (en) 2005-05-04

Family

ID=4748282

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 02135625 Expired - Fee Related CN1200115C (en) 2002-10-14 2002-10-14 Oligonucleotide chip and its application of detecting muatatonal site of hepatitis B virus

Country Status (1)

Country Link
CN (1) CN1200115C (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009201361A (en) * 2008-02-26 2009-09-10 Jsr Corp Probe for catching hepatitis b virus dna and solid phase support on which probe is immobilized
TW201303013A (en) * 2011-04-21 2013-01-16 Isis Pharmaceuticals Inc Modulation of hepatitis B virus (HBV) expression
CN107937507B (en) * 2017-11-17 2021-06-01 中国人民解放军第三〇二医院 Soluble microneedle patch and preparation method thereof

Also Published As

Publication number Publication date
CN1431317A (en) 2003-07-23

Similar Documents

Publication Publication Date Title
CN1195873C (en) Multi-local genomic analysis by method of improved cycle sequencing
CN1606475A (en) Manufacturing process for array plate assembly
CN1500150A (en) Methods for amplifying and detecting multiple polynucleotides on solid phase support
CN101034061A (en) Method for detecting mononucleotide polymorphism with biochip
CN1847848A (en) System and method for processing large number of biological microarrays
JP2009171969A (en) Method for assaying microarray hybridization
CN1489632A (en) Isothermal amptification of nuclear acids on solid support
CN1284168A (en) Solid-phase tips and uses relating thereto
CN1483083A (en) Process for producing hydrogel biochip by using epoxy-contained radial polyethylene glycol derivative
CN1195070C (en) Detection type gene chip for detecting various infectious desease and use thereof
CN1834261A (en) Gene typing chips, prepn. process and uses thereof
CN1388797A (en) Method for obtaining a surface activation of a solid support for building biochips microarrays
CN1203169C (en) Substrates for nucleic acid immobilization onto solid supports
CN1526827A (en) Laboratory nucleic acid analyzing chip system and its application
CN1200115C (en) Oligonucleotide chip and its application of detecting muatatonal site of hepatitis B virus
CN1467294A (en) Multiplex pcr primer set for human glucokinase gene amplification
CN1782097A (en) Method of designing probe set and use in microarray
CN101045939A (en) HBV DNA gene subtype detecting method and kit
CN1309841C (en) Primer for detecting yersinia pestis and detecting method thereof
CN1274847A (en) Method of making marker signal amplifying probe
CN1289691C (en) Quick detection method of pathogenic microbe diagnosis type gene chip
CN101065483A (en) Method of identifying nucleotide polymorphisms
CN2574056Y (en) Hepatitis B virus mutational site oligonucleotide testing chip
CN1431318A (en) Peptide nucleic acid chip for detecting muatatonal site of hepatitis B virus and its preparing method
CN1150335C (en) Endoreference of equivalent competition polymerase chain reaction and its preparing process and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20050504

Termination date: 20121014