CN1309841C - Primer for detecting yersinia pestis and detecting method thereof - Google Patents
Primer for detecting yersinia pestis and detecting method thereof Download PDFInfo
- Publication number
- CN1309841C CN1309841C CNB2004100295470A CN200410029547A CN1309841C CN 1309841 C CN1309841 C CN 1309841C CN B2004100295470 A CNB2004100295470 A CN B2004100295470A CN 200410029547 A CN200410029547 A CN 200410029547A CN 1309841 C CN1309841 C CN 1309841C
- Authority
- CN
- China
- Prior art keywords
- yersinia pestis
- dna
- primer
- gene
- chip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a specific primer of Yersinia pestis and a method of amplifying 28 Yersinia pestis identification genes with the special primer for detecting Yersinia pestis, the present invention also provides the application of the special primer in Yersinia pestis detection.
Description
Technical field
The present invention relates to the detection method of a kind of Yersinia pestis, relate in particular to and a kind ofly 28 Yersinia pestis sign genes are increased, and then detect the method for Yersinia pestis with the Yersinia pestis special primer.
Background technology
The plague is the deadly infectious disease that is caused by Yersinia pestis, also is a kind of Amphixenosis simultaneously, and in China, plague natural focus has accounted for about 10% of area.In recent years, plague case happens occasionally between Chinese, and presents serious gradually trend.The plague also exists bigger threat to the society and economy construction and the people ' s health life of China.Yersinia pestis still is the biological warfare agent of standard, also is one of important pathogenic agent of anti-bio-terrorism research.
Generally exist the sign dna sequence dna that is different from other species in the bacterial genomes.At identifier development nucleic acid detection technique, can on the level of planting, distinguish nearly edge bacterium, reach the purpose of rapid detection and evaluation.Yersinia pestis be by artificial tuberculosis yersinia genus 1,500～20,000 year evolution and come.Completely different with Yersinia pestis, artificial tuberculosis yersinia genus only causes the gastrointestinal tract disease of non-lethality.But the gene of two kinds of bacteriums more than 90% all is identical, and this identical level that directly shows Nucleotide.All the time, Yersinia pestis is carried out detection of nucleic acids and evaluation, mostly at two exclusive plasmids of Yersinia pestis.But, exist the plasmid loss phenomenon in the strain of Yersinia pestis natural separation.And in going down to posterity in the laboratory, these plasmids are very easily lost.
Past in two years, Britain Sanger research centre Deng W, Burland V, Plunkett Getal.Genome sequence of Yersinia pestis KIM.J Bacteriol, 2002,184:4601-4611. and U.S. Wisconsin university have successively finished the whole genome sequence of Yersinia pestis CO92 strain (east type) and KIM strain (type in Middle Ages) and have measured.If can conclusively find several Yersinia pestis sign genes, based on these identifiers, then can design and some the Yersinia pestis special primer is used for rapid detection and the evaluation of Yersinia pestis, this can promote undoubtedly greatly, and Yersinia pestis detects and the development of authenticate technology and perfect.
Up to now, also the report and the patent of not carrying out the nucleic acid identification sequence systematic study at a certain bacterial species especially at identifier design species specificity primer, further adopts PCR method to carry out detection and the evaluation of plague bacillus, still do not have report at present.
Summary of the invention
The applicant has finished in the laboratory genome sequencing work of Chinese Microtus brandti plague plague area bacterial strain 91001 (to the unlikely diseased plants of people).The acquisition of whole genome sequence makes identifies that the Yersinia pestis nucleic acid identification sequence becomes possibility.The present invention is based on representational sign gene, designed three pairs of PCR primers, can be used for rapid detection and the evaluation of Yersinia pestis.
The present invention finds that simultaneously the DNA identifier is that the fabulous Yersinia pestis that is used for detects and the sign molecule of identifying.The comparative genome hybridization technology based on the complete genome DNA chip is adopted in this research, has found 28 Yersinia pestis sign genes; Based on identifier, designed somely to the Yersinia pestis special primer, PCR result shows, can be used for rapid detection and the evaluation of Yersinia pestis.
The object of the present invention is to provide 28 Yersinia pestis sign genes,, can design, be used for rapid detection and the evaluation of Yersinia pestis the Yersinia pestis special primer based on these gene orders.
The present invention also aims to provide to the Yersinia pestis special primer, PCR result shows, can be used for rapid detection and the evaluation of Yersinia pestis.
The present invention also aims to provide to the rapid detection of Yersinia pestis and the method for evaluation,, can carry out rapid detection and the evaluation of Yersinia pestis by carrying out pcr amplification at the DNA identifier.
The invention provides 28 Yersinia pestis sign genes that exist in Yersinia pestis, the nucleotide sequence of the DNA identifier of these 28 genes is open in GenBank, and details are referring to table 2.
The present invention also provides at three pairs of designed primers of above-mentioned 28 Yersinia pestis sign gene, its sequence following (seeing Table 3):
The present invention also provides the method for carrying out pcr amplification at above-mentioned DNA identifier, provides this method to obtain above-mentioned three primers, can carry out rapid detection and the evaluation of Yersinia pestis.The present invention also provides the rapid detection of Yersinia pestis and the method for evaluation, and PCR reacts in 96 orifice plates and carries out, and each composition of reaction system is as follows: KCl; Tris-HCl (pH8.0); MgCl
2Gelatin; BSA; DATP, dCTP, dGTP, dTTP; Primer; Taq archaeal dna polymerase and prokaryotic organism or Eukaryotic template DNA; DNA thermal cycler operation a plurality of circulations are altogether got the PCR product and are carried out electrophoresis detection with agarose gel.
Be tested and appraised the DNA identifier of yersinia pestis, carry out pcr amplification, can carry out rapid detection and the evaluation of Yersinia pestis at this DNA identifier.
28 Yersinia pestis sign genes that exist in the Yersinia pestis provided by the invention, the nucleotide sequence of the DNA identifier of these 28 genes is open in GenBank, (bacterial classification in table 1 and the table 2 number is the unified code name of Chinese DSMZ to see Table 2, the genome annotation of gene code name GenBank number is generally acknowledged mark and states mode).
Provided by the inventionly carry out method and resultant three primers of pcr amplification at above-mentioned DNA identifier, its sequence is as follows:
CATCAGAGTTAAAGATAATAATTTCCG/
AATCTGTTGTTATAGGAATCTTAATTC；
GGGATTAGCGTCTCAGGTGGTAGTC/
CTCATGGTTAGCCTCCTCTGCATCC；
ATATGACACTGCGTGAATGCCTTATC/
ATTGGACGGCATCACGATTCTCTAC。
The concrete grammar of pcr amplification is as follows:
Experiment material and method:
1, experimental strain
Experiment relates to 260 strain Yersinia pestis Chinese pathogenic strains, 20 strain plague living vaccine strains and 5 strain artificial tuberculosis yersinia genus.Yeast culture and DNA extraction reference literature Achtman M, Zurth K, Morelli G et al.Yersinia pestis, the cause of plague, is a recentlyemerged clone of Yersinia pseudotuberculosis.Proc Natl Acad Sci USA, 1999,96:14043-14048, all Yersinia pestis Chinese pathogenic strain DNA all extract in Qinghai Prov. Inst. of The Prevention and Cure of Endemic Diseases, and other DNA extracts in this laboratory.Having extracted DNA from some other pathogenic agent and higher animal is used for pcr analysis in addition.
2, chip comparative genome hybridization
Our Yersinia pestis complete genome DNA chip of developing in advance of this research and utilization, the chip that carries out some representative strain is relatively hybridized.Have 6 strain Yersinia pestis and 5 strain artificial tuberculosis yersinia genus and be used for hybridization, every bacterial strain recross 3 times, carry out data analysis then, concrete grammar is referring to document Eisen MB, Spellman PT, Brown PO et al.Cluster analysis and displayof genome-wide expression patterns.Proc Natl Acad Sci USA, 1998,95:14863-14868..Judge all 3661 Yersinia pestis genes disappearance and existence in each bacterial strain according to the chip hybridization result, chip data is used software TREEVIEW at last, see Rhodius V, VanDyk TK, Gross C et al.Impact of genomic technologies on studiesof bacterial gene expression.Annu Rev Microbiol, 2002, the 56:599-624 diagram.
3, pcr analysis
PCR reacts in 96 orifice plates and carries out, and reaction system is 25 μ L, and each composition is as follows: the KCl of 50mmol/L, the Tris-HCl of 10mmol/L (pH8.0), the MgCl of 2.5mmol/L
2, 0.001% gelatin, 0.1% BSA, the dATP of 100 μ mol/L, dCTP, dGTP, dTTP, the primer of 0.3 μ mol/L, the template DNA of the Taq archaeal dna polymerase of 1U (MBI Fermentas) and 10ng (prokaryotic organism) or 100ng (eukaryote).The operating parameter of DNA thermal cycler (Biometra UNOII) is: pre-95 ℃ of 3min of sex change, 94 ℃ of 30s, 60 ℃ or 56 ℃ of 30s, 72 ℃ of 1min totally 30 circulations, last 72 ℃ of 5min.The PCR product of getting 10 μ L carries out electrophoresis detection with 1% agarose gel.
Experimental result
1, the evaluation of Yersinia pestis DNA identifier
As one of gordian technique of bacterium functional genomics research, DNA microarray chip has been widely used in gene expression profile research; By the full genome chip hybrid experiment of several times, can be in full genome range each expression of gene level of check and analysis.In addition, the DNA chip also is successfully applied to the research of bacterium comparative genomics, the difference of genetic composition and variation between the different strains of check and analysis bacterium, type, species.This research and utilization Yersinia pestis complete genome DNA chip, pass through comparative genome hybridization, 3661 distributions of Yersinia pestis gene between other Yersinia pestis of different shaped and artificial tuberculosis yersinia genus have been compared, having found 28 exclusive genes of Yersinia pestis, may be the DNA identifier of Yersinia pestis.
Chinese scholar is divided into 18 ecotypes with the Yersinia pestis Chinese pathogenic strain.3 strain bacterium are picked out in this research from each ecotype, other comprises that 20 strains are from all over the world plague living vaccine strain.Genomic dna with this 74 strain Yersinia pestis and 5 strain artificial tuberculosis yersinia genus is a template, gene-specific primer in the recycling chip triturating, carry out pcr amplification at above-mentioned 28 candidate identification genes, the result shows: all are that the PCR reaction of template is all positive with Yersinia pestis DNA, and artificial tuberculosis yersinia genus is then negative.Thereby obtain: the DNA identifier that these 28 gene bacterium are Yersinia pestis to draw a conclusion.
These 28 identify three sections that are distributed in the gene set on the karyomit(e), are called genomic cluster I, II and III respectively.(seeing Table 2).Deng W such as Parkhill, Burland V, Plunkett G et al.Genome sequence of Yersinia pestis KIM.J Bacteriol, 2002,184:4601-4611. by the information biology means, identified 21 genomic islands on CO92 bacterium karyomit(e), they all shift and the external source acquisition by gene level.Gene cluster II and gene cluster III promptly are two islands wherein, owing to exist only in Yersinia pestis but not in its ancestors' artificial tuberculosis yersinia genus, therefore, these two islands external source in the Yersinia pestis origin is evolved obtains.Gene cluster I is arranged in another chromosome segment that is similar to genomic island (YP00385～YP00396), except IS related protein gene and three transposase genes, other all genes exist only in Yersinia pestis but not in its ancestors' artificial tuberculosis yersinia genus, point out the external source acquisition in the Yersinia pestis origin is evolved equally of this section.
The chip comparative genome hybridization has been found the exclusive base of another Yersinia pestis (YP02096～YP02135 is called gene cluster IV).But chip hybridization and PCR checking show that all this gene cluster exists only in part in the examination Yersinia pestis bacterial strain.Radnedge etc. had once identified the exclusive chromosome segment of Yersinia pestis of a 41.7kb with the subtractive hybridization method; Designed 4 pairs of primers across this section, carried out pcr amplification, only found that wherein a pair of primer to all bacterial strains positive that all increases, points out the target site of other three pairs of primers to lack in some Yersinia pestis at some strain Yersinia pestis.Gene cluster III of this research and IV all are positioned at this 41.7kb section, and above-mentioned unique valuable primer is positioned at gene cluster III, and other 3 pairs of primers are positioned at gene cluster IV.Obviously, gene cluster IV exists only in the part Yersinia pestis bacterial strain, can not be as identifier.
2, the design of Yersinia pestis Auele Specific Primer and application thereof
The present invention respectively chooses a gene as representative from gene cluster I, II and III, each designs a pair of primer (seeing Table 3).
Carry out pcr amplification at the positive DNA of theory (from 18 ecotypic 260 strain Yersinia pestis Chinese pathogenic strains) and 32 kinds of negative DNA of theory respectively, verify the specificity that each primer is right.The source reference literature of theoretical negative DNA, Radnedge L, Gamez-Chin S, McCready PM etal.Identification of nucleotide sequences for the specific and rapiddetection of Y.pestis.Appl Environ Microbiol, 2001,67:3759-3762, mainly be those pathogenic agent that cause similar plague symptom, or may mark (sample) pollution organism together with Yersinia pestis, such as the various host animal DNA of Yersinia pestis, streptococcus aureus, Salmonella typhimurium, influenza virus, adenovirus etc.; In addition, all classical bacillary biological warfare agent DNA except that plague Yersinia have also been added.
The present invention adopts double-blind method to carry out pcr amplification, and the result shows: for 260 strain Yersinia pestis DNA, all primers all can go out the big or small dna fragmentation of expection by specific amplification; And for the negative DNA of theory, all primers all do not have the specific amplified band, any false positive results do not occur.In the sample (sample), Yersinia pestis DNA may pollute numerous in other biological nucleic acid at the scene.This research can amplify the expection product specifically in conjunction with the target site in the Yersinia pestis genome based on three pairs of primers of sign gene design; Not with other dna profiling generation non-specific amplification, so can be used for detection and the evaluation of Yersinia pestis.
By DNA chip comparative genome hybridization and PCR checking, 28 DNA identifiers (sign gene) in the karyomit(e) of Yersinia pestis, have been identified.These 28 sign genes possess following feature: be positioned at (stable, as to be difficult for losing) on the karyomit(e); Exist only in (non-false positive) in the Yersinia pestis; Be present in all in the examination Yersinia pestis bacterial strain (no false negative).At these sign genes, design Yersinia pestis specific PCR primer, be successfully applied to detection and the evaluation of Yersinia pestis.
The present invention has identified the DNA identifier of yersinia pestis, and carries out pcr amplification at the DNA identifier, can carry out rapid detection and the evaluation of Yersinia pestis.
Adopting the genomics research method, found some Yersinia pestis DNA identifiers, is that Yersinia pestis is stablized special sign molecule.At these DNA identifiers, carry out pcr amplification, can carry out rapid detection and the evaluation of Yersinia pestis.
Bacterial classification in table 1 and the table 2 number is the unified code name of Chinese DSMZ, and the genome annotation of gene code name GenBank number is generally acknowledged mark and states mode.
Description of drawings
Fig. 1: 91001 bacterium DNA+ are with reference to the chip hybridization fitted figure of DNA;
Fig. 2: 91001 bacterium DNA+ are with reference to the results of hybridization of DNA combination;
Fig. 3: 82009 bacterium DNA+ are with reference to the results of hybridization of DNA combination;
Fig. 4: with reference to the results of hybridization of DNA+ with reference to the DNA combination.
Embodiment
Following examples describe the present invention in detail, but do not constitute any limitation of the invention.
As follows by the PCR primer to the method for the detection of Yersinia pestis and evaluation:
The PCR reaction system is 25 μ L, each composition is as follows: the KCl of 50mmol/L, the Tris-HCl of 10mmol/L (pH8.0), 2.5mmol/L MgCl2,0.001% gelatin, 0.1% BSA, the dATP of 100 μ mol/L, dCTP, dGTP, dTTP, 0.3 the primer of μ mol/L, the template DNA of the Taq archaeal dna polymerase of 1U (MBI Fermentas) and 10ng.
The operating parameter of DNA thermal cycler (Biometra UNOII) is: pre-95 ℃ of 3min of sex change, 94 ℃ of 30s, 60 ℃ or 56 ℃ of 30s, 72 ℃ of 1min totally 30 circulations, last 72 ℃ of 5min.
Get 10 μ LPCR products and carry out electrophoresis detection, as seen bright special electrophoretic band with 1% agarose gel.Utilize chip to compare concrete grammar, step and the operational condition of hybridization, and the source of the certain situation of DNA chip and this chip, see also following explanation:
The development of Yersinia pestis complete genome DNA chip and be used for the comparative genomics analysis
1 materials and methods
1.1 82009 strains of experimental strain Yersinia pestis separate from Rattusflauipectus plague plague area, Guangdong, Fujian, Yunnan, this bacterium is under the jurisdiction of the east type, in this research as the substitute of CO92.Yersinia pestis 91001 strains separate from Microtus brandti plague plague area, plateau, Siklingelei.Bacterial strain all is stored in Qinghai Province endemy prevention and control institute.The method reference literature Hinnebusch BJ of microbial culture and extracting genome DNA, Gage KL, Schwan TG et al.Estimation of vector infectivity rates forplague by means of a standard curve-based competitive polymerase chainreaction method to quantify Y.pestis in fleas.Am J Trop Med Hyg, 1998,58:562-569.
1.2 gene is selected arrangement CO92 and 91001 full genomic datas, extracts whole ORF (comprise CDS and pseudogene, do not comprise rna gene).If not otherwise specified, each ORF all is known as gene, and names with " bacterial strain name-genetic code ".Select whole CO92 genes, replenish, reject all IS sequence genes involveds, integrase gene, transposase gene, size then at the gene below the 100bp, height homologous gene on nucleotide level to each other with 91001 exclusive genes.Obtain 4015 Yersinia pestis genes at last altogether.
1.3 design of primers adopts software Array Designer 2.0 to carry out design of primers, a pair of special primer of every gene requires amplified production to reach the total length of gene as far as possible.Mrna length is greater than 2000bp, and amplified production is no more than 2000bp.At full genomic data, each primer is to all having carried out the BLAST analysis, to guarantee theoretic specificity.Primer is transferred to (the San Diego of Illumina company, CA USA) directly synthesizes in 96 orifice plates, and some scattered primers give birth to worker biotechnology company limited by Shanghai or Beijing three rich polygala root Bioisystech Co., Ltd are synthetic, add the mother liquor that an amount of water dissolution becomes 100 μ mol/L ,-20 ℃ of storages.
1.4 the pcr amplification PCR reaction system of gene is 100 μ L, each composition is as follows: the KCl of 50mmol/L, the Tris-HCl of 10mmol/L (pH8.0), the MgCl of 2.5mmol/L
2, 0.001% gelatin, 0.1% BSA, the dATP of 150 μ mol/L, dCTP, dGTP, dTTP, the primer of 0.6 μ mol/L, the template DNA of the Taq archaeal dna polymerase of 5U (MBI Fermentas) and 20ng.PCR reacts in 96 orifice plates (QSP) and carries out, and the operating parameter of DNA thermal cycler (Biometra UNOII) is: pre-95 ℃ of 5min of sex change, 94 ℃ of 1min30s, 60 ℃ of 2min, 72 ℃ of 2min totally 30 circulations, last 72 ℃ of 10min.Reach 96% success ratio after the disposable amplification approximately.Fail to increasing, change amplification condition and increase again.Last still do not have success to increase, the redesign primer.The CO92 gene is a template with 82009 bacterium genomic dnas, and 91001 exclusive genes are template with 91001 bacterium genomic dnas.Successfully amplify 4005 genes at last, every gene has obtained the product of 300 μ L.
1.5 the centrifugal 40min of purified pcr product 3000rpm of amplified production changes among the MultiScreen-PCR Plate (Millipore), 16 inchs Hg negative pressure leaching 25min.Every hole adds the water of 80 μ L, 16inchs Hg negative pressure leaching 8min.Every hole adds (pH7.5) of 80 μ L, and 200rpm shakes 30min.Purified product is collected in another 96 hole PCR plate.Every hole adds the water (pH7.5) of 80 μ L, and after shaking, twice purified product is collected in together.Get 7 μ L electrophoresis, as seen bright single band.65 ℃ of dry DNAs.Every hole adds the 50%DMSO of 30 μ L, and vibration 5min spends the night under 4 ℃, fully dissolving DNA.-20 ℃ of storages.
1.6 behind the centrifugal 40min of DNA sample 3000rpm in chip point sample 96 orifice plates, supernatant is changed in 384 orifice plates (Genetix 7020) over to every hole 10 μ L.Existing 4005 Yersinia pestis genes, together with control sample (91001 genomic dnas, 50%DMSO, salmon sperm dna), totally 11 384 orifice plates, i.e. 4224 samples.The chip point sample instrument is a SpotArray72 chip point sample system (PerkinElmer).The point sample slide is a CSS-1000 aldehyde radical slide (CEL).Point needle is the little point needle of SMP3 (Telechem).32 inferior matrixes of point (4 * 8 arrange) on every sheet base, every inferior matrix is by the design of 17 * 17 dot matrix.
1.7 the fluorescein-labelled employing Two Colour Fluorescence mark of genomic dna, DNA to be measured (each strain gene group DNA that promptly is used to analyze) uses the Cy5 mark, with reference to DNA Cy3 mark.With reference to DNA is the equal amount of mixture of 82009 bacterium and 91001 bacterium genomic dnas, has included all Yersinia pestis genes on the chip with reference to DNA.Get the to be measured of 3 μ g or with reference to the hexabasic basic random primer of DNA and 9 μ g (Beijing three rich polygala root companies are synthetic), after 95 ℃ of 10min sex change, add 10 * Klenow enzyme buffer liquid of 5 μ L, the 5U/ μ L Klenow enzyme (MBI Fermentas) of 4 μ L, 50 * dNTPs (5mmol/LdATP of 1 μ L, 5mmol/LdGTP, 5mmol/LdTTP, 2mmol/LdCTP), the Cy3-of 1.5 μ L or Cy5-dCTP (1mmol/L, Amersham), moisturizing is to cumulative volume 50 μ L, and 37 ℃ are reacted 3h.Concentrate on together with the DNA-Cy3 to be measured of correspondence with reference to the DNA-Cy5 reaction system,, use the H of 15 μ L at last with MinEluteReaction Cleanup Kit (Qiagen) purifying
2O (pH7.5～8.0) reclaims.DNA is in 50～60 ℃ of dryings behind the purifying.But long storage under-20 ℃.
1.8 chip hybridization totally three Two Colour Fluorescence cross combinations: 91001 bacterium DNA+ are with reference to DNA, and 82009 bacterium DNA+ are with reference to DNA, with reference to DNA+ with reference to DNA.Each combination recross three times.Chip behind the point sample is pressed total energy pattern 60mJ crosslinked twice in UV-crosslinked instrument (Hoefer) behind drying at room temperature 12h.Chip is rinsing 2min in deionized water, promptly is used for hybridization after drying up.The hybridization solution that in marker DNA, adds 35 μ L, behind 98 ℃ of sex change 5min, 12, the centrifugal 5min of 000rpm is added on the hybridization solution point on the chip, covers cover plate.42 ℃ of hybridization 18h～20h in the wet box.Hybridization back chip washs 2min in 1 * SSC among the 0.06%SDS, wash 2min among 0.06 * SSC, washs 1min in 95% ethanol.Dry up, with GenePix Personal 4100A chip scanner (Axon Instruments) scanning chip.
1.9 software GenePix Pro 4.1 (Axon Instruments) are adopted in data analysis, and are auxiliary with software Excel, carry out picture and handle and data analysis.Each sampling point fluorescent signal value (intermediate value) after the calculating background correction.Adopt overall normalization method (Global normalization) that the Two Colour Fluorescence data are carried out normalized.Every fluorescent signal value is less than or equal to zero, and unification is replaced into 0.0001, represents that the fluorescent signal of corresponding sampling point approaches not have.With reference DNA-Cy3 signal value is benchmark, and the fluorescence data of 10% sampling point that signal value is minimum is rejected.The data of the regional area place sampling point of high background or no signal in the chip are further rejected.Calculate the fluorescent signal ratio (if because data reject cause do not have ratio, then vacate) of the DNA-Cy5/ to be measured of each sampling point, and convert Log (2.5) value to reference to DNA-Cy3.Each gene has six data that repeat sampling point at most, calculates its mean value, is worth whether judge the disappearance of a gene in DNA to be measured with this.
2 results and discussion
2.1 the development of Yersinia pestis complete genome DNA chip
The development of complete genome DNA chip is a rapid process of multistep, and workload is huge, complex operation, the strict standardized program of abideing by.The chip of this research belongs to PCR product microarray chip, and every gene need design a pair of special primer.The length of most primers is at 16～18bp, and primer desalination or HPLC purifying get final product, and reduction primer length and simplification purification process can reduce expense greatly.Array Designer2.0 is the very powerful primer-design software of function, singlely can finish 10,000 above primer design in a week.Primer should directly synthesize in 96 orifice plates (2mL deep-well plates), and adjacent batch of row of upstream and downstream primer help downstream process.
Pcr amplification has adopted the reaction system of 100 μ L, and is higher to requirement for experiment condition, and wherein the factor of Taq enzyme is the most important, and (article No.: EP0402) amplification efficiency is higher, and price is very cheap, and cost performance has advantage most for the Taq enzyme of MBI company.We successfully amplify 4005 Yersinia pestis genes at last, and every gene has obtained the product of 300 μ L.The PCR product needs purified, and the effect of test kit (MultiScreen-PCRPlate) purifying is better than ethanol precipitation.Behind pcr amplification and the amplified production purifying, all need to carry out electrophoresis detection.PCR product behind the purifying need concentrate, and the DNA concentration requirement is more than 100ng/ μ L.So far, all operations all carries out in 96 orifice plates.
After changing the DNA sample over to 384 orifice plates, can carry out the chip point sample.Should be centrifugal for a long time before the flap, get the sample that supernatant is used as point sample.Note the gene data in every hole in arrangement 384 orifice plates, press the required form of point sample instrument and preserve; In view of the above, point sample instrument is according to the point sample parameter, pio chip sampling point data file.This document will be used by scanner software in the downstream data treating processes.The DNA sample retention that finally obtains is overlapped in 384 orifice plates every cover 10 μ L two.The point sample instrument that this research is used is a collection of puts 68 chips, about 6h consuming time.The DNA sample of per 10 μ L can prepare the chip about 1000.We have prepared 700 chips continuously in a week, have 8448 points (two points of every gene point) on the chip, and corresponding 4005 Yersinia pestis genes comprise some contrast sampling points (91001 bacterium genomic dnas, 50%DMSO, salmon sperm dna) simultaneously.
Point needle belongs to slit needle, once dip in sample thief after, but the sampling point of about 200 of continuity points.But 20 points of original treaty shape is bigger, causes the fusion between sampling point easily.Therefore, need pre-point after dipping in sample thief, pre-point still uses the CEL slide at every turn.We have compared several sampling liquids, find that the effect of 50%DMSO is best, show sampling point size homogeneous, regular shape, and anti-evaporating is suitable for long-time point sample especially; Shortcoming is that sampling point is bigger, if carry out the point sample of very high-density, should use 3 * SSC as sampling liquid.Point sample is the aldehyde radical slide with the sheet base, and the product price ratio of CEL company has advantage most, and we have been applied to it development of oligonucleotide chip, PCR product chip, protein chip, have all obtained good result.The science of point sample instrument parameter is set for finishing the chip preparation in high quality particularly important, and because of the difference of DNA sample, sheet base, point sample density, dot matrix arrangement etc., the point sample parameter is had nothing in common with each other, and must utilizing in a small amount, sample carries out preliminary experiment.The chip point sample needs to carry out in the height clean environment, and point needle needs regularly to clean up hill and dale.
2.2 chip evaluation and be used for comparative genome hybridization
The purpose of this research is that the complete genome DNA chip application is studied in the Yersinia pestis comparative genomics.The chip of genomic dna relatively hybridization analysis adopts the Two Colour Fluorescence strategy.That is to say, each hybridization all has with reference to DNA, with reference to having included all Yersinia pestis genes on the chip among the DNA, its results of hybridization is used to the normalization method of data when data statistics, make a gene disappearance whether by to be measured with judge with reference to the fluorescence ratio of DNA, reach objective unified purpose.For the chip hybridization of any strain bacterium, all need to repeat at least 3 times, to reduce the appearance of false sun (the moon) property data to the full extent.Existing dna marker and chip hybridization experimental program are simplified the most, but effect is fine.Fig. 1 has provided the hybridization picture of 91001 bacterium.The hybridization of isodose has taken place with reference to DNA and DNA to be measured in yellow signal representative, and both corresponding gene was present among the DNA to be measured.On behalf of corresponding gene, green lack in DNA to be measured.The danger signal representative is than the exclusive gene of 82009 (CO92) bacterium 91001 bacterium.
The whole genome sequence of 91001 bacterium is known, and 82009 bacterium can amplify all CO92 bacterium genes in above-mentioned 4005 genes.Therefore we carry out the chip hybridization of following three kinds of combinations: 91001 bacterium DNA+ are with reference to DNA, 82009 bacterium DNA+ are with reference to DNA, with reference to DNA, set up the standard program of chip data analysis with reference to DNA+ in view of the above, and the feasibility of chip quality and chip comparative genome hybridization is estimated.We select-1 as threshold value; If the Log of certain gene (2.5) signal ratio is less than-1, this gene lacks in DNA to be measured so, otherwise this gene exists.In view of the above, have 25 genes in three kinds of cross combinations and false positive occurred, promptly chip hybridization shows the corresponding gene disappearance, and actually this is not so.And the gene of all actual disappearances includes in the chip hybridization result.These 25 genes all no longer count in all hybridization afterwards.In data analysis, adopted comparatively strict low quality data to reject step, so portion gene does not have hybridization data, these genes also no longer count ultimate analysis.Finally having 3661 genes has believable hybridization data, accounts for 91.4% of original 4005 genes.
The final results of hybridization statistics of three kinds of combinations is as Fig. 2, Fig. 3 and Fig. 4.Fig. 1 represents the results of hybridization of 91001 bacterium, shows that 91001 bacterium have lacked following gene: CO92-YPMT1.73, CO92-YP00378～0379, CO92-YP01986～1987, CO92-YP02096～2135, CO92-YP02271～2281, CO92-YP02487～2489 and CO92-YP03046-3047.Fig. 2 represents the results of hybridization of 82009 bacterium, and the exclusive gene of all 91001 bacterium lacks in 82009 bacterium.Fig. 3 represents the results of hybridization of 82009 bacterium and 91001 bacterium mixtures, without any genetically deficient.All results all conform to genome sequencing.So far, we have carried out Quality Control hybridization with several DNA of gene distribution that know, have set up the standard scheme of chip data analysis in view of the above, have obtained good result.
2.3 Yersinia pestis comparative genomics based on the DNA chip
Bacterium comparative genomics research is by the otherness between the different genes group relatively, the molecule mechanism of further investigation otherness, and with the phenotypic characteristic of bacterium (or) the evolution rule connects.Based on the comparative analysis of whole genome sequence, can differentiate little heritable variation undoubtedly to a base.But present still great research engineering of the mensuration of finishing a bacterium whole genome sequence; Obviously, think what genome of comparison, just survey its whole genome sequence, this is unpractical.Based on existing whole genome sequence, employing DNA microarray chip technology compares the genomic hybridization analysis, identifies the not genetic composition of sequenced genes group, and the disappearance that detects each gene or DNA zone whether.The outstanding feature of chip comparative genomics is its relatively low cost and high-throughput, be successfully applied to a plurality of bacterial species at present, has promoted the deep understanding of people to aspects such as bacterium diversity, pathogenic, evolution.
The detected object of said chip comparative genome hybridization can only be than reference DNA, the disappearance of corresponding gene among the DNA to be measured.And for insertion and disappearance, inversion and the displacement of single base mutation, minority base, and than DNA to be measured and with reference to the gene that lacks among the DNA, this technology is helpless.Yet, more and more to study the fact and show, the acquisition of complete genome and disappearance are the main policies that bacterial genomes is evolved.Yersinia pestis is " bacterium is many, type is assorted " in natural distribution.Only just there are 11 plague natural focuss that differ from one another in China, and has separated at present and has preserved a large amount of Yersinia pestis bacterial strains.The China Yersinia pestis is divided into 18 ecotypes.The Yersinia pestis bacterial strain of different sources differs greatly at biochemical character and aspect such as pathogenic, and these bacterial strains must exist difference on genomic composition.And the comparative result of existing three strain Yersinia pestis whole genome sequences has also been verified this point.The Yersinia pestis comparative genomics research platform based on the complete genome DNA chip has successfully been set up in this research, after finishing the preparation of a collection of DNA chip, can finish the comparative genome hybridization of hundreds of strain bacterium in a short time, and then verify chip and include the difference distribution of gene between each bacterial strain.The DNA chip technology is used for the research of Yersinia pestis comparative genomics and has huge researching value.
Annotate: the bacterial classification in table 1 and the table 2 number is the unified code name of Chinese DSMZ, and the genome annotation of gene code name GenBank number is generally acknowledged mark and states mode.
Table 1, the Yersinia pestis that is used for chip hybridization and artificial tuberculosis yersinia genus bacterial strain
| Bacterial classification | Bacterial strain | Biotype/serotype | Strain characteristics |
| Y.pestis | 91001 132002 49006 82009 EV76 Tjiwidej | Type east, type east, the classic type east of type type in Middle Ages in Middle Ages type | China's natural separation strain is to the strain of the Chinese natural separation strain of the not pathogenic Chinese natural separation strain China's natural separation strain of people living vaccine strain living vaccine |
| K pseudotuberculosis | 53518 53519 53520 53521 53522 | I II III IV V | Type strain type strain type strain type strain type strain |
Table 2,28 Yersinia pestis sign gene table look-ups
| Gene | Length (bp) | Product | The place gene cluster |
| YP00387 YP00388 YP00389 YP00391 YP00392 YP00393 YP00394 YP00396 | 2064 1317 231 1326 723 1236 288 1413 | The Unknown Function protein function agnoprotein Unknown Function albumen modification enzyme Unknown Function protein function agnoprotein Unknown Function protein function agnoprotein that methylates | Cluster I |
| YP01087 YP01088 YP01089 YP01090 YP01091 YP01092 YP01092a YP01094 YP01095 YP01096 YP01097 | 312 321 1089 960 543 897 291 174 228 1671 1089 | Prophage proteins prophage DBP prophage modulin proteinogen bacteriophage primase prophage proteins prophage DBP Unknown Function protein function agnoprotein Unknown Function proteinogen bacteriophage albumen prophage proteins | Cluster II |
| YP02087 YP02087a YP02088 YP02089 YP02090 YP02091 YP02092 YP02093 YP02094 | 261 201 645 429 606 390 219 564 183 | Prophage exonuclease prophage proteins methylated transferase prophage proteins prophage proteins prophage antitermination protein prophage proteins prophage proteins prophage proteins | Cluster III |
Annotate: the numbering of gene and the functional description of product all are the genome annotation according to CO92.
Table 3, be used for the PCR primer of Yersinia pestis specific detection and evaluation
| Goal gene | The place gene cluster | Mrna length (bp) | Upstream primer/downstream primer sequence | Amplified production length (bp) |
| YP00392 YP01091 YP02088 | Cluster I Cluster II Cluster III | 723 543 645 | CATCAGAGTTAAAGATAATAATTTCCG/ AATCTGTTGTTATAGGAATCTTAATTC GGGATTAGCGTCTCAGGTGGTAGTC/ CTCATGGTTAGCCTCCTCTGCATCC ATATGACACTGCGTGAATGCCTTATC/ ATTGGACGGCATCACGATTCTCTAC | 300 300 300 |
Sequence table
＜110〉Microbiology and Epidemic Disease Inst., Academy of Military-Medical Sciences (C
＜120〉evaluation of Yersinia pestis DNA identifier and application thereof
<130>041033
<160>6
PatentIn version 3.1
<210>1
<211>27
＜212〉oligonucleotide
＜213〉come from yersinia's genus
<220>
＜223〉PCR upstream primer can be used for plague bacillus specific detection and evaluation
<400>1
CATCAGAGTT AAAGATAATA ATTTCCG 27
<210>2
<211>27
＜212〉oligonucleotide
＜213〉come from yersinia's genus
<220>
＜223〉PCR downstream primer can be used for plague bacillus specific detection and evaluation
<400>2
AATCTGTTGT TATAGGAATC TTAATTC 27
<210>3
<211>25
＜212〉oligonucleotide
＜213〉come from yersinia's genus
<220>
＜223〉PCR upstream primer can be used for plague bacillus specific detection and evaluation
<400>3
GGGATTAGCG TCTCAGGTGG TAGTC 25
<210>4
<211>25
＜212〉oligonucleotide
＜213〉come from yersinia's genus
<220>
＜223〉PCR downstream primer can be used for plague bacillus specific detection and evaluation
<400>4
CTCATGGTTA GCCTCCTCTG CATCC 25
<210>5
<211>26
＜212〉oligonucleotide
＜213〉come from yersinia's genus
<220>
＜223〉PCR upstream primer can be used for plague bacillus specific detection and evaluation
<400>5
ATATGACACT GCGTGAATGC CTTATC 26
<210>6
<211>25
＜212〉oligonucleotide
＜213〉come from yersinia's genus
<220>
＜223〉PCR downstream primer can be used for plague bacillus specific detection and evaluation
<400>6
ATTGGACGGC ATCACGATTC TCTAC 25
Claims (3)
1, be used to detect the primer of Yersinia pestis, it is characterized in that, the upstream primer/downstream primer of described primer has following sequence:
CATCAGAGTTAAAGATAATAATTTCCG/
AATCTGTTGTTATAGGAATCTTAATTC。
2, the primer of claim 1 is characterized in that the detection method of Yersinia pestis:
At the DNA identifier that is present in 28 Yersinia pestis sign genes in the Yersinia pestis, carry out pcr amplification with described primer, the nucleotide sequence of this Yersinia pestis sign gene is open in GenBank, and the gene code name is as shown in table 2, and this pcr amplification comprises:
PCR reacts in 96 orifice plates and carries out, and reaction system is 25 μ L, and each composition is as follows: the KCl of 50mmol/L, and the Tris-HCl of 10mmol/L, pH are 8.0; 2.5mmol/L MgCl
20.001% gelatin; 0.1% BSA; The dATP of 100 μ mol/L, dCTP, dGTP, dTTP, the primer of 0.3 μ mol/L; The Taq archaeal dna polymerase of 1U and 10ng prokaryotic organism or the Eukaryotic template DNA of 100ng; The operating parameter of DNA thermal cycler is: pre-95 ℃ of 3min of sex change, 94 ℃ of 30s, 60 ℃ or 56 ℃ of 30s, 72 ℃ of 1min totally 30 circulations, last 72 ℃ of 5min; The PCR product of getting 10 μ L carries out electrophoresis detection with 1% agarose gel.
3, the application of the described primer of claim 1 aspect the detection Yersinia pestis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100295470A CN1309841C (en) | 2004-03-22 | 2004-03-22 | Primer for detecting yersinia pestis and detecting method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100295470A CN1309841C (en) | 2004-03-22 | 2004-03-22 | Primer for detecting yersinia pestis and detecting method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1673389A CN1673389A (en) | 2005-09-28 |
| CN1309841C true CN1309841C (en) | 2007-04-11 |
Family
ID=35046163
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100295470A Expired - Fee Related CN1309841C (en) | 2004-03-22 | 2004-03-22 | Primer for detecting yersinia pestis and detecting method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1309841C (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100404691C (en) * | 2005-11-23 | 2008-07-23 | 中国人民解放军军事医学科学院微生物流行病研究所 | Method of detecting bioterror related pathogen bacteria and its special DNA chip |
| CN109293751B (en) * | 2018-10-18 | 2020-09-11 | 中国人民解放军军事科学院军事医学研究院 | Yersinia pestis virulence related protein sORF34 and coding gene and application thereof |
| CN110157823A (en) * | 2019-05-24 | 2019-08-23 | 中国人民解放军疾病预防控制中心 | Primed probe group, kit and its application of RAA Fluorometric assay Yersinia pestis |
| CN112695017B (en) * | 2019-10-23 | 2022-04-15 | 吉林大学 | Phage vB_Yen_X1 and its application in the prevention and treatment of Yersinia pestis infection |
| CN112609013A (en) * | 2021-01-12 | 2021-04-06 | 深圳市赛格诺生物科技有限公司 | Fluorescent PCR reagent and method for detecting Yersinia pestis |
| CN112899383B (en) * | 2021-02-09 | 2021-11-23 | 中国人民解放军军事科学院军事医学研究院 | Yersinia pestis detection kit based on real-time fluorescence RPA technology and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SU1643611A1 (en) * | 1988-03-23 | 1991-04-23 | Научно-исследовательский противочумный институт Кавказа и Закавказья | Method for determination of antibacterial activity of pesticin 1 jersinia pestis |
| EP1389242A2 (en) * | 2001-05-18 | 2004-02-18 | Biotecon Diagnostics GmbH | Detecting microorganisms of the yersinia pestis/yersinia pseudotuberculosis species and/or differentiating between yersinia pestis and yersinia pseudotuberculosis |
-
2004
- 2004-03-22 CN CNB2004100295470A patent/CN1309841C/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SU1643611A1 (en) * | 1988-03-23 | 1991-04-23 | Научно-исследовательский противочумный институт Кавказа и Закавказья | Method for determination of antibacterial activity of pesticin 1 jersinia pestis |
| EP1389242A2 (en) * | 2001-05-18 | 2004-02-18 | Biotecon Diagnostics GmbH | Detecting microorganisms of the yersinia pestis/yersinia pseudotuberculosis species and/or differentiating between yersinia pestis and yersinia pseudotuberculosis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1673389A (en) | 2005-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ehrenreich | DNA microarray technology for the microbiologist: an overview | |
| CN108504744B (en) | A microhaplotype genetic marker for forensic detection and its kit | |
| Platonov et al. | Molecular typing of Yersinia pestis | |
| JP5801349B2 (en) | Method for identifying the clonal source of restriction fragments | |
| CN102877136B (en) | Genome simplification and next-generation sequencing-based deoxyribose nucleic acid (DNA) library preparation method and kit | |
| Good | Reduced representation methods for subgenomic enrichment and next-generation sequencing | |
| Xiao et al. | Rapid construction of genome map for large yellow croaker (Larimichthys crocea) by the whole-genome mapping in BioNano Genomics Irys system | |
| CN105506111A (en) | Method for detecting CNV (copy number variation) mark of MAPK10 gene of Nanyang cattle and application thereof | |
| CN109706231B (en) | High-throughput SNP (single nucleotide polymorphism) typing method for molecular breeding of litopenaeus vannamei | |
| CN1195070C (en) | Detection type gene chip for detecting various infectious desease and use thereof | |
| CN114657261A (en) | A SNP molecular marker, primer set, kit, detection method and application related to the number of thoracic vertebrae in sheep | |
| CN1309841C (en) | Primer for detecting yersinia pestis and detecting method thereof | |
| CN111647649B (en) | Method for assisted selection of cattle growth traits based on CCDC39 gene CNV detection | |
| Yee et al. | Quality assessment of cross‐species hybridization of CHO transcriptome on a mouse DNA oligo microarray | |
| Swenie et al. | PacBio high‐throughput multi‐locus sequencing reveals high genetic diversity in mushroom‐forming fungi | |
| Deng et al. | Systematic evaluation of single-cell RNA-seq analyses performance based on long-read sequencing platforms | |
| JP6588536B2 (en) | Artificial exogenous reference molecules for comparing species and abundance ratios between microorganisms of different species | |
| CN118726616A (en) | SNP molecular markers associated with growth traits of large yellow croaker and their application | |
| CN106191253B (en) | Beijing duck based on GBS technology simplifies gene order surveying method | |
| KR20140019760A (en) | Molecular methods for identification of oyster species using species-specific probes, dna chip, and molecular kits | |
| CN1834261A (en) | Gene typing chips, prepn. process and uses thereof | |
| CN112359120B (en) | A method for detecting CNV marker of cattle MFN1 gene and its application | |
| Karim et al. | A review of image analysis techniques for gene spot identification in cDNA Microarray images | |
| CN109071590B (en) | System and method for data driven design, synthesis and application of molecular probes | |
| CN1200115C (en) | Oligonucleotide chip and its application of detecting muatatonal site of hepatitis B virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |