CN110231480A - A kind of biochip - Google Patents
A kind of biochip Download PDFInfo
- Publication number
- CN110231480A CN110231480A CN201910556357.0A CN201910556357A CN110231480A CN 110231480 A CN110231480 A CN 110231480A CN 201910556357 A CN201910556357 A CN 201910556357A CN 110231480 A CN110231480 A CN 110231480A
- Authority
- CN
- China
- Prior art keywords
- chip
- solution
- biochip
- probe
- handle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/5695—Mycobacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/35—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Mycobacteriaceae (F)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Gastroenterology & Hepatology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The present invention relates to a kind of biochips, belong to technical field of biological.Several chip handles that biochip includes: base and is mounted on base in an array manner, chip handle is stretched out from the base in parallel to each other along the direction perpendicular to base, and is arranged in the chip reaction interface for being used to mark detection probe of the free end of each chip handle.It is detected using this biochip, all sample, reaction solution and cleaning solutions are all pre-assigned to be placed in reactive tank, it does not need to move back and forth addition or removal, only need to move back and forth biochip between the reactive tank for holding sample, reaction solution and cleaning solution can.A large amount of detecting steps and operating time can be saved.
Description
It is on 06 14th, 2017 that the application, which is the applying date that same applicant submits, application No. is
201710446886.6 a kind of divisional application of the Chinese invention patent of entitled " biochip ".
Technical field
The invention belongs to technical field of biological, and in particular to a kind of biochip.
Background technique
In the detection of traditional membrane DNA chip, need each detection sample being singly added sequentially to chip hole or slot
In be incubated for.Then, the sample after incubation is singly removed from chip hole or slot, and in multiple times by cleaning solution according to
It is secondary that the hole for being used to detect is added or is washed in slot.After washing, reaction solution is sequentially added in hole or slot and is reacted, instead
Liquid needs after answering singly successively remove.After removing the liquid after reaction, needs to carry out repeatedly to wash and use
Come the hole detected or slot, and by the liquid removal in hole or slot, drying is kept.Later, needing will be as the liquid of detection signal
Hole or trough, which sequentially add, one by one is reacted.After reaction, it is mixed to need to sequentially add suspension liquid in each hole or slot
It is even to read detection data.
In the detection of traditional glass chip, need each reaction sample solution to be added to chip surface, then glass
Chip is enclosed in clamping in plastic core film magazine.Chip cartridges are placed in water-bath heating a few houres or air bath is heated overnight.Later
Chip cartridges are taken out, chip cartridges is dismantled and takes out chip, be put into beaker.Cleaning solution is added in two portions shake washing, takes out later
Chip simultaneously dries up.Chip scanner reading is placed into later.
Therefore, for traditional die in entire detection process, detecting step is more, and detection time is long.
Summary of the invention
In order to solve the above technical problems, technical solution proposed by the present invention are as follows:
A kind of biochip, comprising: base and several chip handles being mounted on base in an array manner, chip handle edge
It is stretched out from the base in parallel to each other perpendicular to the direction of base, and is arranged in the free end of each chip handle and is used for
Mark the chip reaction interface of detection probe.
As a further improvement of the above technical scheme:
In one embodiment, chip handle is sticking plaster, and detection probe is marked directly on the free end of chip handle.
Material is the chip handle of plastics, and detection probe is marked directly on the free end of sticking plaster, and structure is simple, is fabricated to
This is low.
In one embodiment, chip reaction interface is arranged in the longitudinally perpendicular plane with chip handle.
Chip reaction interface is arranged in the longitudinally perpendicular plane with chip handle, and cross-sectional area is big, therefore outstanding
It is suitable for reactive tank be flat shallow body container the case where.In this way, the reaction interface of all chips can be arranged in it is same
In plane, when detection, all chip reaction interfaces can once be imaged simultaneously when showing testing result, therefore detect knot
The reading efficiency of fruit is high, so as to reduce cost so that the design of reading apparatus is simpler.Secondly, shallow body container makes
It obtains in detection process, the heating speed of reaction solution is fast, therefore chip reaction speed also accelerates, to further increase detection
Efficiency.Furthermore longitudinally perpendicular due to chip reaction interface and chip handle, i.e., either probe and biomolecule to be measured is reacted
Step or probe are in other steps such as washing, and when chip reaction interface immerses in solution, all detection probes are all tieed up
It holds in the same level in the solution, therefore all chip reaction interfaces are identical as the contact conditions of solution, chip reacts boundary
The contact conditions of all probes and solution on face are also identical, so further increase to a certain extent measurement efficiency and
The accuracy of the lateral comparison of the accuracy of testing result and each solution testing result to be measured.
In one embodiment, chip handle is strip, and is equipped on the end face of its free end and is used for fixed chip
The fixture of reaction interface.
It may insure that chip reaction interface is solid in the longitudinally perpendicular plane with chip handle and securely by fixture
It is scheduled on chip handle.
Fixture be include the first support being mounted on the free end of chip handle, and can with first support cooperate and incite somebody to action
The fixed second support therebetween of chip reaction interface.
Two framework constructions worked in coordination are simple, easy to use, and can be realized and quickly and easily assemble and replace core
The effect of piece reaction interface.
In one embodiment, chip handle is strip, and mounting hole is equipped on the end face of its free end.Chip is anti-
Answer interface arrangement in the mounting hole.
The simple structure directly chip reaction interface being arranged in the mounting hole on the section of chip handle free end.Chip is anti-
Answer interface that can be arranged in mounting hole by the modes such as being clamped, bonding.
In one embodiment, chip handle is sticking plaster, and is equipped with fixation hole in its free end.Chip reaction interface is
Sheet material, and be equipped with for the mutually matched fixed column of fixation hole.In the embodiment, chip reaction interface is especially susceptible to more
It changes, can be replaced together with fixed column.Installation is simple, as long as consolidating the fixed column insertion chip handle in chip reaction interface
Determine hole.Also, since chip reaction interface is sheet material, so that response area is sufficiently large, can fix on it a large amount of
Detection probe detects while realizing various biomolecules.In addition, as previously mentioned, all probes in the detection process always
In same level, so that testing result is more accurate.
In one embodiment, chip reaction interface is configured to magnetic bead.Chip handle includes that the end face of free end is closed non-
Magnetic sleeve, and the magnetism stick being arranged in sleeve.The embodiment has particularly pertinent advantage, because can use magnetic
Property principle, advanced biomolecule detection mode is realized by magnetic bead, such as the detection mode of double antibodies sandwich can be used, in conjunction with
Chemical luminous immune detection method efficiently and accurately measures biomolecule.Secondly, in the present invention, it is non-magnetic using magnetism stick-
Property sleeve-magnetic bead fit system, magnetic bead can at any time by magnetism stick adsorb or desorb invest on non magnetic sleeve, thus examining
During survey, magnetic bead can be detached from non magnetic sleeve and freely disperse in the solution, during which can stir or take other
Measure optimizes reacting for probe on magnetic bead and biomolecule to be measured in solution so that magnetic bead and solution fully haptoreaction
Effect, and then improve detection accuracy.In addition, in the embodiment, chip reaction interface is fixed with the magnetic of detection probe
Pearl is particularly susceptible replacement, does not need to assist other disassemblies, mounting process, is also therefore more suitable for the detection of more batches.
The probe of chip reaction interface label is 1~500, preferably 1~50.
Base is the rectangle base with several holes, and each hole is constructed to be permeable to and the installation end of a corresponding chip handle
Removably it is clamped.
It is put using when biochip is detected according to the present invention, all samples, reaction solution and cleaning solution are all pre-assigned
It sets in reactive tank, does not need to move back and forth addition or removal, need to only hold sample, reaction solution and washing solution
Moving back and forth biochip between reactive tank can.Chip detection compared to the prior art needs each sample one by one
Sequentially add, each reaction solution sequentially adds one by one, the liquid after reaction singly successively removes, cleaning solution one
One various step for sequentially adding, removing, biochip of the present invention save a large amount of detecting steps and operating time.
Also, the moving back and forth between reactive tank of this biochip can be by automation chip detector device operation, when operation
Between can be further reduced.
Meanwhile the chip handle for connecting chip reaction interface can be together in series by base recited above, realize different
The combination of chip chamber.In this way it can be ensured that same group of chip for detecting same lot sample sheet is simultaneously operating in each step,
The step and detection time in detection can further be saved.Secondly as base may insure that same group of chip is mutual
Determining spacing can be kept, can prevent the intersection between differential responses liquid from causing the mutual pollution of chip chamber.This combination
Three-dimensional chip simultaneously operating can eliminate the reaction time difference between different samples, reduce the error rate of operation.Simultaneously compared to existing
There is technology, due to reducing the frequency using pipettor and reducing consumptive material tip usage amounts, to reduce costs.
Detailed description of the invention
The invention will be described in more detail below based on embodiments and refering to the accompanying drawings.Wherein:
Fig. 1 schematically illustrates the biochip of embodiment 1 in the present invention；
Fig. 2 shows arrangement schematic diagram and testing result of 1 middle probe of example of the present invention on film.Wherein, Fig. 2 a is to visit
Arrangement schematic diagram of the needle on film, Fig. 2 b are the detection signal graphs of sample 01, and Fig. 2 c is the detection signal graph of sample 02；
Fig. 3 schematically illustrates the biochip of embodiment 2 in the present invention；
Fig. 4 shows arrangement schematic diagram and testing result of 2 middle probe of example of the present invention in chip reaction interface.Its
In, Fig. 4 a is arrangement schematic diagram of the probe on film, and Fig. 4 b, 4c, 4d are the detection signal graph of sample 03,04,05 respectively；
Fig. 5 schematically illustrates another chip handle 3 that can be used in the present invention；
Fig. 6 schematically illustrates another chip handle 4 that can be used in the present invention；
Fig. 7 shows arrangement schematic diagram and testing result of 4 middle probe of example of the present invention in chip reaction interface.Its
In, Fig. 7 a is arrangement schematic diagram of the probe on film, and Fig. 7 b, 7c are the detection signal graph of sample 08,09 respectively；
Fig. 8 schematically illustrates another chip handle 5 that can be used in the present invention；
Fig. 9 shows thyroid hormone linear graph in example 5.
In the accompanying drawings, identical component uses identical appended drawing reference.The attached drawing is not drawn according to the actual ratio.
Specific embodiment
Below in conjunction with the drawings and specific embodiments, invention is further described in detail, but does not therefore limit this
The protection scope of invention.
Embodiment 1
Fig. 1 schematically illustrates the biochip 10 of one embodiment of the present of invention.As shown in Figure 1, the life of the present embodiment
Object chip 10 includes base 3.In this embodiment, base 3 is long strip shape, wherein being provided with several holes 8.Hole 8 is preferably
It is decorated in array.Biochip 10 further includes several chip handles 2.In this embodiment, chip handle 2 is elongated cuboid,
Its quantity is preferably corresponded with the quantity in hole 8.Each chip handle 2 can be plugged into a corresponding hole 8, and be fixed
Ground clamps.It is readily appreciated that, various ways can be used, chip handle 2 is fixed in base 3, such as clamping, gluing etc..?
In one unshowned embodiment, chip handle 2 is removably secured on base 3.
According to the present invention, biochip 10 further includes the chip reaction interface 1 for marking detection probe.Chip reacts boundary
Face 1 is arranged in the longitudinally perpendicular plane with chip handle 2.As shown, being set on the end face of the free end of chip handle 2
There is the fixture 4 for fixed chip reaction interface.It may insure that chip reaction interface is in the longitudinal direction with chip handle by fixture
In vertical plane and it is clamped securely on chip handle.Fixture 4 be include first be mounted on the free end of chip handle 2
Frame 41, and can cooperate with first support 41 and the second support 42 by the fixation of chip reaction interface 1 therebetween.First support
41 and second support 42 be configured with the bracket of hollow region, such as I-shaped bracket, so as to keep chip reaction interface 1 logical
It crosses its hollow region and exposes.The simple structure of this fixture 4, it is easy to use, and can be realized quickly and easily assembly and more
Change the effect of chip reaction interface 1.
Chip reaction interface 1 can be the NC film that detection probe is marked, or nylon membrane, plastics, glass, pottery
Porcelain, etc..The probe that chip reaction interface 1 marks can be 1 to 500, preferably 1~50.
Using when biochip is detected according to the present invention, base recited above can will connect chip reaction interface
Chip handle be together in series, realize the combination of different chip chambers.In this way it can be ensured that detecting same group of core of same lot sample sheet
Piece is simultaneously operating in each step, can save step and detection time in detection.
Since base may insure that same group of chip keeps determining spacing between each other, can prevent between differential responses liquid
Intersection cause the mutual pollution of chip chamber.This combined three-dimensional chip simultaneously operating can be eliminated anti-between different samples
Time difference is answered, the error rate of operation is reduced.Simultaneously compared with prior art, the frequency and reduction of pipettor are used due to reducing
Consumptive material tip usage amounts, to reduce costs.
Secondly, all samples, reaction solution and cleaning solution are all prewired using when biochip is detected according to the present invention
It is placed in reactive tank well, does not need to move back and forth addition or removal, need to only hold sample, reaction solution and wash molten
Moving back and forth biochip between the reactive tank of liquid can.Chip detection compared to the prior art needs each one, sample
One sequentially add, each reaction solution sequentially adds one by one, the liquid after reaction singly successively removes, cleaning solution
The various step sequentially add one by one, removed, biochip of the present invention save a large amount of detecting steps and operation
Time.Also, biochip of the present invention moving back and forth between reactive tank can be by automating chip detector
Device operation, operating time can be further reduced.
Again, chip reaction interface is arranged in the longitudinally perpendicular plane with chip handle, and cross-sectional area is big, because
This is particularly suitable for the case where reactive tank is flat shallow body container.In this way, the reaction interface of all chips can be arranged in together
In one plane, when detection, all chip reaction interfaces can once be imaged simultaneously when showing testing result, therefore examine
The reading efficiency for surveying result is high, so as to reduce cost so that the design of reading apparatus is simpler.Secondly, shallow body holds
Device makes in detection process, and the heating speed of reaction solution is fast, therefore chip reaction speed also accelerates, to further increase
Detection efficiency.
The application of biochip according to an embodiment of the present invention is introduced below by a specific example, wherein using
Biochip as shown in Figure 1.
Example 1
In this example, the identification of subtype of human papilomavirus gene is carried out using biochip as shown in Figure 1, is had
Body is used to detect common type HPV nucleic acid (HPV16, HPV18, HPV6, HPV11).
HPV16 and HPV 18 belong to most common high-risk human mammilla papillomavirus, cause woman uterus cancer；HPV6 and HPV 11
Belong to most common low risk danger type human papilloma virus, causes condyloma acuminatum.There is the human milk for this 4 types at present
Head tumor virus vaccine.
Each step of the method introduced below that human papilloma virus identification is carried out using biochip as shown in Figure 1.
Step 1: being fixed with the production of the chip reaction interface of HPV Genotyping probes
Design synthesizes each HPV probe:
HPV16 probe sequence: TTTTTTTTTTCTGAAGTAGATATGGCAGC
HPV18 probe sequence: TTTTTTTTTTTATTGCCCAGGTACAGGA
HPV6 probe sequence: TTTTTTTTTTGGAAGATGTAGTTACGGA
HPV11 probe sequence: TTTTTTTTTTCAGATTTAGACACAkATGC
Positive control probe: TTTTTTTTTTAACTGCAGCTTGGACTACGC
Negative control probe: TTTTTTTTTTATGCCTTTAAGCATGGCA
Positive control target sequence: (biotin labeling can hybridize GCGTAGTCCAAGCTGCAGTT with positive control probe
Reaction)
Probe solution is prepared: being prepared probe using TE buffer solution (preparing the buffer to be formed using Tris and EDTA)
And it is diluted to 10 μM of concentration.
Fixation of the probe in membrane DNA chip (chip reaction interface 1): in nitrocellulose filter, (10 × SSC buffer impregnates
5min, drying) point sample, it takes on each 1 μ L point to film of 6 probe solutions above, in 80 DEG C of drying 2hr.It is above-mentioned to manufacture two panels fixation
The film of probe.
Arrangement schematic diagram of the probe on film is shown in Fig. 2 a.
The diaphragm of fixed probe is clipped into sticking plaster (chip handle 2) end, and vertical with sticking plaster, with I-shaped support clamp
Firmly, the end for being connected to base fixes.Dry sealing, saves.When detection, the diaphragm of sticking plaster end impregnate in the solution into
The operation such as row chip hybridization, washing and colour developing.
Step 2: detection sample prepares
Sample 01:HPV16 sample of nucleic acid
Sample 02:HPV11 sample of nucleic acid
PCR system amplified sample 01, sample 02 are prepared using HPV universal primer sequence, taq enzyme etc..Upstream primer sequence
Y03:GAAAAATAAACTGTAAATCATATTC (biotin labeling)；Downstream primer sequence Y04:
TTTGTTACTGTGGTAGATACTAC is configured to 20 μM of concentration.
Pcr amplification reaction system prepares (50 μ L):
PCR response procedures: 95 DEG C, 5min；95 DEG C, 1min, 50 DEG C, 0.5min, 65 DEG C, 1min, 35cycles；72 DEG C,
5min.- 20 DEG C of PCR product storages are spare.
Step 3: detection
1) 2 1.5ml EP pipes are taken, are marked, common phosphate buffer (3 × SSPE) 1ml and positive control is added
10 μ L of sequence target column (10 μM).Then it takes the PCR product of 2 samples (01 and 02) of 20 μ L to be added, becomes in 95 DEG C of heating 10min
Property, taking-up is placed in mixture of ice and water processing.
2) prepare one piece of 24 orifice plate, 2 holes is selected to mark, sample correspondence is added in hole by 1) treated.
3) membrane DNA chip for taking out 2 preparations, marks.Then it is inserted into both the above hole respectively, is placed in 48 DEG C of water-baths
Interior incubation 1hr.
4) membrane DNA chip is taken out, is transferred to other two added with 1ml buffer 1 (0.1MTris-HCl, pH7.5；0.1M
NaCl it in hole), shakes and washes 2min.
5) detecting step 4 is come again).
6) membrane DNA chip is taken out, is transferred to other two added with 1ml streptavidin solution (1 μ g/ml, with added with 3% N
The buffer 1 of seralbumin (BSA) dilutes) hole in, 30min is incubated in 42 DEG C of water-baths.
7) membrane DNA chip is taken out, is transferred to other two added with 1ml buffer 2 (0.1MTris-HCl, pH9.5；0.1M
NaCl；50M MgCl2) hole in, shake and wash 2min.
8) detecting step 7 is come again).
9) membrane DNA chip is taken out, is transferred to other two added with 0.5ml developing solution (NBT solution and BCIP solution mixed liquor)
Hole in, room temperature develop the color 10min.
10) membrane DNA chip is taken out, Yu Shuizhong is rinsed twice, interpretation result.
Testing result is shown in Fig. 2 and the following table 1.
Table 1
This example has used two chip reaction interfaces respectively while having measured two samples, and so on, it can be according to need
Increase chip reaction interface number and sample to be tested number, by operating simultaneously, all samples to be tested can be detected simultaneously, be mentioned
High detection efficiency.
Embodiment 2
Fig. 3 schematically illustrates the biochip 11 of one embodiment of the present of invention.As shown in figure 3, the life of the present embodiment
Object chip 11 includes base 31.In this embodiment, base 31 is plate, wherein being provided with several holes 81.Hole 81 is preferably in
Array arrangement.Biochip 11 further includes several chip handles 21.In this embodiment, chip handle 21 is elongated cuboid,
Its quantity is preferably corresponded with the quantity in hole 81.Each chip handle 21 can be plugged into a corresponding hole 81, and by
Fixedly clamp.It is readily appreciated that, various ways can be used, chip handle 21 is fixed in base 31, such as clamping, glue
It glues.In a unshowned embodiment, chip handle 21 is removably secured on base 31.
According to the present invention, biochip 11 further includes the chip reaction interface 12 for marking detection probe.Chip reaction
Interface 12 is arranged in the longitudinally perpendicular plane with chip handle 21.As shown, chip handle 21 is strip, and
The end face of its free end is equipped with mounting hole 5.Each chip reaction interface 12 is arranged in a corresponding mounting hole 5.It is this
The simple structure of chip handle 21, it is easy for installation.
Chip reaction interface 12 is glass-chip.The probe that chip reaction interface 12 marks can be 1 to 8.
The application of biochip according to an embodiment of the present invention is introduced below by a specific example, wherein using
Biochip as shown in Figure 3.
Example 2
In this example, mycobacteria identification is carried out using biochip as shown in Figure 3, detects 4 kinds of mycobacterias
Nucleic acid.Clinic can caused by there are many kinds of Mycobacteriums lungy, wherein common are mycobacterium tuberculosis, bird branch
Bacillus, Mycobacterium intracellulare and mycobacterium kansasii etc..
Chip reaction interface in this example 2 is glass-chip, detects the mode of signal using fluorescent marker mode.Originally show
In example 2, secure in the end aperture of slide insertion sticking plaster of mycobacteria probe, it is vertical with sticking plaster.When detection, make plastics
The slide of stick end impregnates carries out the operations such as chip hybridization, washing and fluorescence signal scanning in the solution.
Each step of the method introduced below that mycobacteria identification identification is carried out using biochip as shown in Figure 3.
Step 1: the production of mycobacteria identification Genotyping glass-chip
Design synthesizes the probe of each mycobacteria kind:
Mycobacterium tuberculosis probe TBTTTTTTTTTTTTTTTTTTTTAAGACATGCATCCCGT
Mycobacterium avium probe: TTTTTTTTTTTTTTTTTTTTCATGCGTCTTGAGGTC
Mycobacterium intracellulare probe: TTTTTTTTTTTTTTTTTTTTAAGACATGCGCCTAAA
Mycobacterium kansasii probe: TTTTTTTTTTTTTTTTTTTTCGCCAAGTGGTCCTAT
Positive control probe: TTTTTTTTTTTTTTTTTTTTAACTGCAGCTTGGACTACGC
Negative control probe: TTTTTTTTTTTTTTTTTTTTATGCCTTTAAGCATGGCA
Positive control target sequence: (5 ' end fluorescein CY3 labels, can be with positive control by GCGTAGTCCAAGCTGCAGTT
Probe hybridization reaction)
Probe solution is prepared: being prepared probe using TE solution, is diluted to 10 μM of concentration.
Fixation of the probe on slide: point sample takes on each 0.2 μ L point to amido modified slide of 6 probe solutions above.It will
Substrate after point sample, which is placed in 80 DEG C of baking ovens, keeps the temperature 80 minutes enhancing fixed effects.The chip of probe will be fixed, is immersed in 60 DEG C
Ultrapure water in shake and wash 1 minute, dry spare.
Probe arrangement mode is shown in Fig. 4 a.
The slide of fixed probe is embedded into sticking plaster end aperture, sticking plaster is connected to and fixes.Dry sealing, -20
DEG C save.
Step 2: test sample prepares
Sample 03: mycobacterium avium sample of nucleic acid
Sample 04: Mycobacterium intracellulare sample of nucleic acid
Negative sample 05: sterile water
PCR system amplified sample 03, sample 04 are prepared using the primer sequence of 16SDNA gene, taq enzyme etc..
Upstream primer sequence Y01:GG TGG CTC AGG ACG AAC G (5 ' end fluorescein CY3 label)；Downstream primer
Sequence Y02:GGCT TGC GCC CAT TGT G, is configured to 20 μM of concentration.
Pcr amplification reaction system prepares (50 μ L):
PCR response procedures: 95 DEG C, 10min；95 DEG C, 2min, 50 DEG C, 1min, 68 DEG C, 1min, 35cycles；72 DEG C,
5min.- 20 DEG C of PCR product storages are spare.
Step 3: detection
1) 3 1.5ml EP pipes are taken, are marked, common phosphate buffer (3 × SSPE) 1ml and positive control is added
10 μ L of sequence target column (10 μM).Then the PCR product of 2 samples (03,04 and 05) of 20 μ L is taken to be added, in 95 DEG C of heating 10min
Denaturation, taking-up are placed in mixture of ice and water processing.
2) prepare one piece of 24 orifice plate, 3 holes is selected to mark, it will (1) treated that sample corresponds to is added in hole.
3) chip for taking out 3 preparations, marks.Then it is inserted into respectively in 3 holes above, is placed in 48 DEG C of water-baths and incubates
Educate 0.5hr.
4) glass-chip is taken out, is transferred to other 3 added with 0.2 × SSC of 1ml solution (pH7.0, every 1000ml solution
Contain 1.75g NaCl, 0.88g sodium citrate) hole in, shake and wash 2min.
5) glass-chip is transferred to shake in pure water and washes 2min.
6) glass-chip is taken out, drying removes the slide of insertion, slide is put into chip Fluorescence Scanner and scans fluorescence
Signal interpretation result.
Testing result see the table below 2 and Fig. 4.
Table 2
This example has used three chip reaction interfaces respectively while having measured three samples, and so on, it can be according to need
Increase chip reaction interface number and sample to be tested number, by operating simultaneously, all samples to be tested can be detected simultaneously, be mentioned
High detection efficiency.
Fig. 5 schematically illustrates another chip handle 22 that can be used in the present invention.The chip handle 22 is configured to sticking plaster.
One end of each sticking plaster is mounted on base, and detection probe is marked directly on the free end of sticking plaster.This simple structure, system
Make at low cost.
The application that the biochip constructed using this chip handle is introduced below by a specific example, wherein using
Biochip as shown in Figure 5.
Example 3
In this example, hepatitis B surface antigen is carried out using the biochip that chip handle as shown in Figure 5 constructs
(HBsAg) double antibody sandwich method detects.The material of chip handle is polystyrene (Polystyrene, abridge PS), diameter 1~
10mm, end mark Anti-HBs antibody Ag antibody.
It is introduced below to carry out hepatitis B surface antigen (HBsAg) using the biochip of chip handle construction as shown in Figure 5
Each step of the method for double antibody sandwich method detection.
Step 1: plastic chip stick end is coated with Anti-HBs antibody Ag antibody
In test tube, Anti-HBs antibody Ag 0.05mol/L, pH9.6 carbonate buffer solution is diluted to 3 μ g/ml of working concentration,
As coating buffer.Plastic chip stick end is immersed in coating buffer, 37 DEG C of incubation 2hr；Chip stick is transferred to added with carbonate
The test tube of solution, shakes and washes；Chip stick is transferred to containing 1%BSA carbonate solution (250 μ l/ test tube), 37 DEG C of incubation 2hr again；It will
Chip stick is transferred to the test tube added with carbonate solution, shakes and washes, spare after dry.
Step 2: detection
1) 3 chip test bars are taken out and are marked.Sample to be tested is added in 3 test tubes (or 3 holes of 96 orifice plates)
H1, H2 and H0.Wherein H0 is sample diluent 5%BSA-0.1MPBS, pH7.2.By the different pipes of the corresponding addition of these chip sticks
It is interior, 37 DEG C of incubation 30min.
2) 3 chip test bars are simultaneously transferred to one group of test tube (3) added with washing lotion, washing lotion respectively is
The Tris-HCl solution of 0.02M, pH7.4 shake containing 0.1%Tween20 and wash 3min；Then chip test bar is transferred to second group
The test tube (3) for filling washing lotion, shakes and washes 3min；Chip test bar is transferred to the test tube (3) that third group fills washing lotion again, shakes and washes
3min。
3) 3 chip test bars are transferred to respectively added with dilution (1:5000) enzyme labelled antibody (anti-HBsAg-HRP)
One group of test tube (3), 37 DEG C of incubation 30min.
4) detecting step 2 is repeated).
5) 3 chip test bars are transferred to respectively added with developing solution H2O2With developing solution tetramethyl benzidine (TMB)
One group of test tube (3, mark).React at room temperature 15min.
6) chip test bar is removed, is added and stops liquid (0.1M sulfuric acid solution) mixing, each hole is measured at 450nm wavelength
OD value.
Testing result see the table below 3.
Table 3
As it can be seen that detecting hepatitis B surface antigen using detection method provided by the invention, accurate testing result is obtained.
This example 3 has used three chip reaction interfaces respectively while having measured three samples, and so on, it can according to need increase core
Piece reaction interface number and sample to be tested number, by operating simultaneously, all samples to be tested can be detected simultaneously, improve detection effect
Rate.
Comparative example 1: conventional ELISA method detects hepatitis B surface antigen
Step 1: ELISA Plate coating
By Anti-HBs antibody Ag 0.05mol/L 0.05mol/L, pH9.6 carbonate buffer solution is diluted to 3 μ g/ of working concentration
Ml, as coating buffer.Take 96 hole elisa Plates of blank that coating buffer, 37 DEG C of incubation 2hr are added；It discards coating buffer and uses carbonate solution
Then washing is added contains 1%BSA carbonate solution (250 hole μ l/), 37 DEG C of incubation 2hr；Discard confining liquid and molten with carbonate
Liquid washing, it is spare after dry.
Step 2: detection
1) it takes out ELISA Plate and marks.Sample to be tested H4, H5 and H0b is one by one added in three holes, and wherein H0b is
Sample diluent 5%BSA-0.1M PBS, pH7.2.37 DEG C of incubation 30min.The composition of H4, H5 and H0b respectively with H 1, H2 and
H0 is identical.
2) liquid in three holes is one by one washed out with liquid-transfering gun and is discarded, then draw washing lotion to three holes with liquid-transfering gun
It one by one washs 3 times, then cleaning solution is sucked out one by one.
3) enzyme labelled antibody that has diluted is added to hole one by one with liquid-transfering gun, and (anti-HBsAg-HRP, 100 holes μ l/, 1:5000 are dilute
Degree of releasing), 37 DEG C of incubation 30min.
4) detecting step 2 is repeated), and liquid in hole is patted dry.
5) developing solution H is added to hole one by one with liquid-transfering gun2O2With developing solution tetramethyl benzidine (TMB), room temperature reaction
15min。
6) it is added to hole one by one with liquid-transfering gun and stops liquid (0.1M sulfuric acid solution) mixing, read optical density.
Testing result is as shown in table 4 below:
Table 4
By table 3 and 4 result of table as it can be seen that using biochip provided by the invention to the testing result of hepatitis B surface antigen with
The testing result detected using traditional ELISA method is suitable.But from the point of view of detection process, detection side provided by the invention
Method but obviously facilitates than traditional ELISA detection method, eliminates and needs the hole one by one to be handled in each processing step
Tedious steps, to greatly improve detection efficiency；Also, synchronous due to each processing step of multiple samples carries out,
It is compared to traditional processing one by one, a possibility that detection method avoids the cross-infection between sample.3 He of example
Comparative example 1 diagrammatically only detects 3 samples, and when detecting with needing huge discharge, multiple, for example dozens of is even
When hundreds of samples, above-mentioned advantage of the invention will be protruded more.
Fig. 6 schematically illustrates another chip handle 23 that can be used in the present invention.Chip handle 23 is configured to sticking plaster, and
And fixation hole 6 is equipped in its free end.Chip reaction interface 13 is sheet material, and is equipped with for mutually matched with fixation hole 6
Fixed column 7.Chip reaction interface 13 is arranged in the longitudinally perpendicular plane with chip handle 23.
The application of the biochip constructed using this chip handle is introduced below by a specific example.
Example 4
In this example, the 4 kinds of HPV nucleic acids of biochip test constructed using chip handle as shown in FIG. 6, HPV16,
HPV18, HPV6 and HPV11.
Using plastic chip as chip reaction interface in this example 4, signal detecting mode uses the cataluminescence side HRP
Method.The thin rounded flakes for securing polystyrene (PS) the material production of HPV probe nucleic acid, are embedded into modeling by the fixed column at center
It is vertical with sticking plaster in the fixation hole 7 of charge bar end.When detection, make fixed diaphragm impregnate carry out in the solution chip hybridization,
The operation such as washing and chemiluminescence.PS material can be with adhesion protein, including streptavidin (SA) etc., then by biotin
The nucleic acid of label fixes probe in conjunction with SA.
The biochip introduced below constructed using chip handle as shown in FIG. 6 detects 4 kinds of HPV nucleic acids, HPV 16,
Each step of the method for HPV18, HPV6, HPV11.
The production of step 1:HPV Genotyping horizontal plastic chip
Design synthesizes each HPV probe:
HPV16 probe sequence: Bio-CTGAAGTAGATATGGCAGC
HPV18 probe sequence: Bio-ATTGCCCAGGTACAGGA
HPV6 probe sequence: Bio-GGAAGATGTAGTTACGGA
HPV11 probe sequence: Bio-CAGATTTAGACACAkATGC
Positive control probe: Bio-AACTGCAGCTTGGACTACGC
Negative control probe: Bio-ATGCCTTTAAGCATGGCA
Positive control target sequence: (digoxigenin labeled can be visited DIg-GCGTAGTCCAAGCTGCAGTT with positive control
Needle hybridization reaction)
Probe solution is prepared: being prepared probe using TE solution, is diluted to 5 μM of concentration.
It customizes the pretreatment of round plastic (PS material) piece of processing: the plastic chip being cleaned by ultrasonic being dried, is transferred to 1
μ g/ml streptavidin solution (uses pH7.0, the dilution of 100mM Tris solution), in 37 DEG C of incubation 1hr, then is transferred to pH7.0,
It is shaken in 100mM Tris solution and washes 5min, then be transferred to pure water and shake and wash 5min.
Fixation of the probe in round plastic on piece: taking on each 0.5 μ L point to plastic sheet of 6 probe solutions above, moisturizing in
37 DEG C of incubation 1hr.Disk is transferred to shake in pure water and washes 2min, is dried.
Probe arrangement mode is shown in Fig. 7 a.
The round plastic piece of fixed probe is embedded into sticking plaster end.Dry sealing, saves.
Step 2: test sample prepares
Sample 08:HPV16 sample of nucleic acid
Sample 09:HPV11 sample of nucleic acid
PCR system amplified sample 08, sample 09 are prepared using HPV universal primer sequence, taq enzyme etc..Upstream primer sequence
Y03D:GAAAAATAAACTGTAAATCATATTC (digoxigenin labeled)；Downstream primer sequence Y04:
TTTGTTACTGTGGTAGATACTAC is configured to 20 μM of concentration.
Pcr amplification reaction system prepares (50 μ L):
PCR response procedures: 95 DEG C, 5min；95 DEG C, 1min, 50 DEG C, 0.5min, 65 DEG C, 1min, 35cycles；72 DEG C,
5min.- 20 DEG C of PCR product storages are spare.
Step 3: detection
1) 2 1.5ml EP pipes are taken, are marked, common phosphate buffer (3 × SSPE) 1ml and positive control is added
10 μ L of sequence target column (10 μM).Then it takes the PCR product of 2 samples (08 and 09) of 20 μ L to be added, becomes in 95 DEG C of heating 10min
Property, taking-up is placed in mixture of ice and water processing.
2) prepare one piece of 24 orifice plate, 2 holes is selected to mark, sample correspondence is added in hole by 1) treated.
3) it takes out the plastic chip of 2 preparations and marks.Then it is inserted into both the above hole respectively, is placed in 48 DEG C of water-baths
1hr is incubated in pot.
4) plastic chip is taken out, is transferred to other two added with 1ml buffer 3 (0.1M Tris-HCl, pH7.5；
0.15M NaCl) hole in, shake and wash 2min.
5) detecting step 4 is come again).
6) plastic chip is taken out, is transferred to other two added with 3 diluted anti-dig-HRP to 150mU/ml of buffer
In the hole of (explaining: 150 every milliliter of milliunits), it is incubated at room temperature 30min.
7) plastic chip is taken out, is transferred in other two hole added with buffer 3, shakes and wash 2min.
8) plastic chip is taken out, is transferred to other two added with (the 0.1M Tris-HCl, pH 9.5 of 1ml buffer 4；
0.15M NaCl, 10mM MgCl2) hole in, shake and wash 2min.
9) plastic chip is taken out, is transferred to other two added with 0.2ml luminescent solution (by luminescent solution I (amino phenyl-diformyl
Amine, reinforcing agent) and the hole that mixes luminescent solution II (oxidant) in, note down the letter that shines from empty bottom using Chemiluminescence Apparatus
Number.It is imaged from bottom with cold CCD (such as day energy chemiluminescence imaging system).
Testing result see the table below 5 and Fig. 7.
Table 5
In this example, a chip can detect multiple indexs simultaneously, be a splendid selection for clinical detection.
Fig. 8 schematically illustrates another chip handle 24 that can be used in the present invention.Chip handle 24 includes the end of free end
The non magnetic sleeve 241 of face closure, and the magnetism stick 242 being arranged in sleeve.Chip reaction interface 14 is configured to magnetic bead.When
When magnetism stick 242 is inserted into sleeve 241, magnetic attracting force can be applied to magnetic bead with magnetism stick 242, magnetic bead is caused to be adsorbed
Onto the end face of sleeve 241.Thus, it is possible to carry out subsequent operation.It, can be by magnetism stick 242 from sleeve after operation
It is extracted out in 241, then magnetic bead can fall off from sleeve 241, to be used for subsequent processing.
The application of the biochip constructed using this chip handle is introduced below by a specific example.
Example 5
In this example, the biochip test thyroid hormone (TSH) constructed using chip handle as shown in Figure 8.
Thyroid hormone (TSH) is the Main Factors for regulating and controlling thyroid cell growth and thyroid hormone synthesis and secretion,
It can reflect thyroid functional status by detecting blood TSH level, facilitate the screening, diagnosis, therapeutic effect of thyroid disease
Judge and Index for diagnosis.
5 relevant parameter of this example is as follows: double antibody sandwich method；Enzyme-catalyzed chemical luminescence, wherein using horseradish peroxidase
(HRP) TSH antibody is marked, selects luminol, hydrogen peroxide as luminous substrate.When bar magnet is inserted into hollow plastic charge bar bottom
When, magnetic bead is adsorbed sticking plaster end, and when detaching bar magnet, magnetic bead will be detached from sticking plaster, splits away off.For capture
Antibody -- anti-tsh monoclonal antibody is coated on magnetic bead, and antibody is connected on carboxylated magnetic bead by carbodiimide, another
A antibody is then used to mark HRP.
The side introduced below that thyroid hormone (TSH) is detected using the biochip of chip handle construction as shown in Figure 8
Each step of method.
Step 1: the assembling of coating and magnetic bead the absorption chip of magnetic bead
The activation of magnetic bead: it takes 1mg carboxyl magnetic bead (about 100 μ l magnetic flaw detection ink) in centrifuge tube, shakes 5 on sample mixed instrument
~10min；Centrifuge tube is placed on Magneto separate frame, is adsorbed completely to magnetic bead, supernatant is taken out；1ml 15mM MES is added
(pH6.0) solution washs magnetic bead, and repeated washing is primary；Magnetic bead is resuspended using 100 μ L 15mM MES (pH6.0), adds 100 μ
L (10mg/ml) carbodiimide (EDC) solution is prepared using the solution of pre-cooling, ready-to-use；It is uniformly mixed, under room temperature,
30min is activated on sample mixed instrument.
Magnetic bead coating: using magnetic bead one time after 15mM MES (PH6.0) the washing activation of 1ml, Magneto separate abandons supernatant；
15mM MES (pH6.0) solution of 500 μ L monoclonal antibodies containing anti-tsh (50 μ g) is added, room temperature reaction overnight, obtains immune magnetic
Pearl.
Save: magnetic bead 2 times after washing coating with the PBST of 1ml, the PBS with 1ml containing 0.1% bovine serum albumin(BSA) is resuspended
Magnetic bead.Will bar magnet be inserted into hollow plastic charge bar in, insertion preserve anti-tsh label magnetic bead centrifugation bottom of the tube, it is to be adsorbed completely after,
It takes out, sealing, 4 DEG C spare.
Step 2: the preparation of horseradish peroxidase mark TSH antibody
Horseradish peroxidase mark TSH antibody is prepared with sodium periodate method, then uses the phosphate-buffered of 0.01M pH7.4
After liquid dialysed overnight, the glycerol that equivalent is added is saved in -20 DEG C.Horseradish peroxidase feeds intake with anti-tsh monoclonal antibody
Than being respectively 1:2.
Step 3: detection
1) preparation of TSH antigen standard
It will be dissolved in inactivation calf serum after the calibration of TSH antigen, being configured to TSH is 0,0.1,0.5,4,10,20,50mIU/
The standard solution of L.
2) 6 magnetic bead absorption chip test bars are taken out and are marked.Each 100 μ L is added in 6 holes of Chemiluminescent plate
The upper surface of 6 standard items samples, and 100 μ L are respectively added and dilute the horseradish peroxidase mark TSH antibody of 1:1000.By these
Chip stick is corresponding to be added in different pipes, takes chip stick away, and magnetic bead is scattering into solution, then removes sticking plaster, oscillation mix so that
Magnetic bead is distributed in solution, 37 DEG C of incubation 40min.
3) bar magnet is inserted into hollow plastic charge bar, is transferred in reaction solution, is gently agitated for, so that the magnetic bead in solution is inhaled again
It is attached to sticking plaster end.
4) 6 magnetic bead absorption chip test bars are transferred to respectively again in 6 holes added with washing lotion, washing lotion 0.02M,
The Tris-HCl solution of pH7.4, containing 0.1%Tween20, every 250 μ L of hole.Take chip stick away, magnetic bead is scattering into solution, then
Remove sticking plaster, oscillation mixes so that magnetic bead is distributed in solution, shakes and washes 3min.
5) step 3), step 4) 2 times are repeated.
6) bar magnet is inserted into hollow plastic charge bar, is transferred in reaction solution, is gently agitated for, so that the magnetic bead in solution is inhaled again
It is attached to sticking plaster end.
7) in 6 chip test bars being transferred to respectively in the hole added with 200 μ L luminol chemiluminescence liquid, chip is taken away
Stick, magnetic bead are scattering into solution, then remove sticking plaster, and oscillation mixes so that magnetic bead is distributed in luminescent solution, by chemiluminescence
Plate is placed in the luminous counting of Chemiluminescence Apparatus detection.
Testing result see the table below 6:
Table 6
As it can be seen that cooperating the same pacing of multisample using the biochip of chip handle construction as shown in Figure 8 provided by the invention
The detection method of amount detects H-TSH, obtains accurate testing result and (obtains good linear relationship, such as
Shown in Fig. 9).This example 5 has used six chip reaction interfaces respectively while having measured six samples, and so on, it can basis
Need to increase chip reaction interface number and sample to be tested number, by operating simultaneously, all samples to be tested can be detected simultaneously,
Improve detection efficiency.
Further, at the same measure 20 " zero " standards luminous counting rate, find out ∑ x=2SD and looked on standard curve
The minimum detection limit 0.02mIU/L of the method out illustrates that this law obtains higher sensitivity.
Although by reference to preferred embodiment, invention has been described, the case where not departing from the scope of the invention
Under, various improvement can be carried out to it and can replace component therein with equivalent.Especially, as long as there is no structures to rush
Prominent, items technical characteristic mentioned in the various embodiments can be combined in any way.The invention is not limited to texts
Disclosed in specific embodiment, but all technical solutions including falling within the scope of the claims.
Claims (3)
1. a kind of biochip characterized by comprising
Base；
Several chip handles being mounted on the base in an array manner, the chip handle is along the direction perpendicular to the base
It is stretched out from the base in parallel to each other；With
It is arranged in the chip reaction interface for being used to mark detection probe of the free end of each chip handle；
The chip reaction interface be arranged in in the longitudinally perpendicular plane of the chip handle；
The chip handle is strip, and mounting hole is equipped on the end face of its free end, the chip reaction interface arrangement
In the mounting hole.
2. biochip according to claim 1, which is characterized in that the probe of chip reaction interface label is 1~
500.
3. biochip according to claim 1 or 2, which is characterized in that the base is the rectangle base with several holes
Support, each hole is constructed to be permeable to removably be clamped with the installation end of a corresponding chip handle.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910556357.0A CN110231480B (en) | 2017-06-14 | 2017-06-14 | Biological chip |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910556357.0A CN110231480B (en) | 2017-06-14 | 2017-06-14 | Biological chip |
| CN201710446886.6A CN107389933B (en) | 2017-06-14 | 2017-06-14 | A kind of biochip |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710446886.6A Division CN107389933B (en) | 2017-06-14 | 2017-06-14 | A kind of biochip |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110231480A true CN110231480A (en) | 2019-09-13 |
| CN110231480B CN110231480B (en) | 2023-03-28 |
Family
ID=60333300
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910555320.6A Pending CN110231479A (en) | 2017-06-14 | 2017-06-14 | A kind of biochip |
| CN201710446886.6A Active CN107389933B (en) | 2017-06-14 | 2017-06-14 | A kind of biochip |
| CN201910556357.0A Active CN110231480B (en) | 2017-06-14 | 2017-06-14 | Biological chip |
Family Applications Before (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910555320.6A Pending CN110231479A (en) | 2017-06-14 | 2017-06-14 | A kind of biochip |
| CN201710446886.6A Active CN107389933B (en) | 2017-06-14 | 2017-06-14 | A kind of biochip |
Country Status (1)
| Country | Link |
|---|---|
| CN (3) | CN110231479A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1635164A (en) * | 2004-11-08 | 2005-07-06 | 北京博奥生物芯片有限责任公司 | High flux biochip and application thereof |
| CN1650167A (en) * | 2002-04-11 | 2005-08-03 | 莫利塞诺瓦昂尼公司 | Device and method to simultaneously detect different antibodies and antigens in clinical alimentary and environmental samples |
| CN2777542Y (en) * | 2004-11-26 | 2006-05-03 | 珠海市永如生物技术发展有限公司 | Combined covex type many person portion protein chip |
| US20070031826A1 (en) * | 2005-08-05 | 2007-02-08 | My Gene | Diagnostic kit for determining the genotype of a human papilloma virus and method of using thereof |
| CN101591711A (en) * | 2009-03-16 | 2009-12-02 | 唐国林 | The detection method of peptide nucleic acid probe biochip and surface plasma body resonant vibration thereof |
| CN102879565A (en) * | 2012-09-26 | 2013-01-16 | 四川大学 | Microorganism sample rapid detection method and detection device thereof |
Family Cites Families (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN2284404Y (en) * | 1997-04-04 | 1998-06-17 | 上海荣盛生物技术有限公司 | Comb type spot immunity assaying box |
| CN2775659Y (en) * | 2005-02-24 | 2006-04-26 | 穆海东 | Plastic chip |
| CN1825121B (en) * | 2005-02-24 | 2011-06-08 | 上海裕隆生物科技有限公司 | Plastic chip |
| CN101334401A (en) * | 2007-06-26 | 2008-12-31 | 上海裕隆生物科技有限公司 | Detachable membrane chip |
| CN201083736Y (en) * | 2007-06-26 | 2008-07-09 | 上海裕隆生物科技有限公司 | Detachable membrane chip |
| US20120151746A1 (en) * | 2010-12-16 | 2012-06-21 | Affymetrix, Inc. | Apparatuses, Systems and Methods for the Attachment of Substrates to Supports with Light Curable Adhesives |
| CN102338801B (en) * | 2011-08-05 | 2013-11-20 | 嘉兴艾锐生物科技有限公司 | High-sensitivity immunochip detection system and application method thereof |
| CN202189053U (en) * | 2011-08-12 | 2012-04-11 | 张灿 | Biological chip |
| KR101350640B1 (en) * | 2012-01-17 | 2014-01-16 | 삼성전기주식회사 | Bio chip |
| JP2014132228A (en) * | 2013-01-04 | 2014-07-17 | Sony Corp | Liquid injection jig set |
| CN203155368U (en) * | 2013-01-31 | 2013-08-28 | 中国科学院广州生物医药与健康研究院 | Micro-pore plate type magnetic bead separator |
| CN103509858B (en) * | 2013-07-26 | 2015-01-21 | 北京普利耐特生物科技有限公司 | Kit for polymorphism detection of human cytochrome enzyme P450 gene |
| KR20150033935A (en) * | 2013-09-25 | 2015-04-02 | 삼성전기주식회사 | Fluid injection chip |
| CN103451313B (en) * | 2013-09-27 | 2016-03-09 | 中国科学院上海微系统与信息技术研究所 | A kind of deposition of gold detection method of gene chip |
| CN104878075A (en) * | 2014-02-27 | 2015-09-02 | 宜宾市第二人民医院 | An electrochemical biochip sensor array for rapidly detecting mycobacterium tuberculosis and a preparing method |
-
2017
- 2017-06-14 CN CN201910555320.6A patent/CN110231479A/en active Pending
- 2017-06-14 CN CN201710446886.6A patent/CN107389933B/en active Active
- 2017-06-14 CN CN201910556357.0A patent/CN110231480B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1650167A (en) * | 2002-04-11 | 2005-08-03 | 莫利塞诺瓦昂尼公司 | Device and method to simultaneously detect different antibodies and antigens in clinical alimentary and environmental samples |
| CN1635164A (en) * | 2004-11-08 | 2005-07-06 | 北京博奥生物芯片有限责任公司 | High flux biochip and application thereof |
| CN2777542Y (en) * | 2004-11-26 | 2006-05-03 | 珠海市永如生物技术发展有限公司 | Combined covex type many person portion protein chip |
| US20070031826A1 (en) * | 2005-08-05 | 2007-02-08 | My Gene | Diagnostic kit for determining the genotype of a human papilloma virus and method of using thereof |
| CN101591711A (en) * | 2009-03-16 | 2009-12-02 | 唐国林 | The detection method of peptide nucleic acid probe biochip and surface plasma body resonant vibration thereof |
| CN102879565A (en) * | 2012-09-26 | 2013-01-16 | 四川大学 | Microorganism sample rapid detection method and detection device thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107389933B (en) | 2019-07-23 |
| CN107389933A (en) | 2017-11-24 |
| CN110231479A (en) | 2019-09-13 |
| CN110231480B (en) | 2023-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US3999948A (en) | Diagnostic reagent holder and method | |
| CN1920559A (en) | Cellular biological technique, reagent kits and preparation device | |
| EP3983803A2 (en) | Multiplexed tissue imaging | |
| CN111351943B (en) | Aptamer recognition-HCR reaction-based rapid detection method for early pregnancy of cattle and application | |
| CN102859359A (en) | Preparation method of antigen-immobilized immunofluorescence slide, and immunofluorescence slide prepared thereby | |
| CN102735728A (en) | Electrochemical immunosensor, preparation method and use of electrochemical immunosensor | |
| CN1313622C (en) | High-flux cell biological chip testing technology and reagent case | |
| CN111239391B (en) | 2019-NCoV novel coronavirus antigen detection reagent and detection device | |
| CN1464977A (en) | Biosensor and method for analyzing blood components using it | |
| CN110095599B (en) | Micro-immunofluorescence detection method without cell loss | |
| CN111474347A (en) | Novel coronavirus detection kit, preparation method and detection method thereof | |
| JP2003066045A (en) | Allergen test chip | |
| CN107340388B (en) | A kind of biomolecule detecting method | |
| AU2005303881A1 (en) | Device for carrying out an individual immunoassay in a fully automatic manner | |
| CN107389933B (en) | A kind of biochip | |
| US9977040B2 (en) | Device and method for reactions between a solid and a liquid phase | |
| CN106645715B (en) | It is a kind of for the protein-chip of 1 protein antibodies joint-detection of Epstein-Barr virus capsid antigen and nuclear antigen and its preparation and application | |
| CN110195079A (en) | Prepare plasmid, antibody, preparation method and the screening technique of AMH antibody, kit and detection method | |
| CN212622620U (en) | Compact immunoassay device | |
| CN115125331A (en) | EB virus detection method based on in-situ hybridization method | |
| WO2018056700A1 (en) | High-sensitivity rapid diagnostic method of single diagnostic chip including reaction and analysis | |
| CN109884299A (en) | One-step method fluorescent detection system and blood coagulation enzyme assay method | |
| CN109239329A (en) | A kind of insulin immue quantitative detection reagent box | |
| CN107338288A (en) | A kind of biomolecule detecting method | |
| CN109374882A (en) | Detect Pseudopleuronectes fish vitellogenin immunity colloidal gold test paper strip and preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |