CN110117604A - A kind of recombinant vector and expression of tea tree heat shock protein CssHSP-6 gene - Google Patents
A kind of recombinant vector and expression of tea tree heat shock protein CssHSP-6 gene Download PDFInfo
- Publication number
- CN110117604A CN110117604A CN201910357329.6A CN201910357329A CN110117604A CN 110117604 A CN110117604 A CN 110117604A CN 201910357329 A CN201910357329 A CN 201910357329A CN 110117604 A CN110117604 A CN 110117604A
- Authority
- CN
- China
- Prior art keywords
- csshsp
- expression
- gene
- tea tree
- heat shock
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of recombinant vectors of tea tree heat shock protein CssHSP-6 gene, and invention additionally discloses a kind of expressions of tea tree heat shock protein CssHSP-6 gene.The present invention constructs the prokaryotic expression carrier of tea tree heat shock protein CssHSP-6 gene, and a series of optimization is carried out for protein expression condition, finally obtain CssHSP-6 soluble protein, as a result further research albumin crystal structure and biological characteristics lay the foundation, and then foundation is provided for the disease resistance for improving tea tree by gene editing method.
Description
Technical field
The present invention relates to the recombinant vectors and expression of a kind of tea tree heat shock protein CssHSP-6 gene, belong to biological skill
Art field.
Background technique
Tea tree, original name: tea, Theaceae, Camellia shrub or dungarunga, spray are hairless.Leaf keratin, oblong or ellipse
Shape.The leaf of tea tree can tea making (being different from tea oil tree), seed can extract oil, and tea tree material is fine and closely woven, and wood can be used for carving.Point
Cloth is concentrated mainly between 16 degree to 30 degree of north latitude of south latitude, and tea tree likes warm and moist weather, bud at 10 DEG C of temperature on average or more
Start to sprout, growth optimum temperature is 20~25 DEG C；Annual precipitation will be at 1000 millimeters or more；Light-loving and shade-tolerating, suitable for diffusing
It is given birth under light；All one's life is divided into Seedling Stage, brephic, manhood and declining period.
Heat shock protein is the protein of a kind of great expression after organism is by the stimulation of the adverse circumstances such as high temperature, is biology to inverse
The required constituent of short-term regulation is coerced in border, is played the role of to injury caused by mitigation environment stress very big.It is earliest
It is found in drosophila within 1962 and isolated first in 1974, has been demonstrated that it is prevalent in animal, plant, microorganism
In.
The prokaryotic expression of gene is one of the common technology for studying gene function.Large intestine is usually present when albumen pronucleus expression
Since rare codon causes expression to limit in bacillus, inclusion body is formed；It can inhibit albumen when the stronger protein expression of toxicity
Expression causes expression yield too low；Another easy the problem of ignoring, which is that reproducibility is excessively high in Escherichia coli, will lead to two sulphur
Key cannot be properly formed, and cause expression product insoluble.For above-mentioned problem, it is common practice to after dissolving inclusion body with urea
It is purified in the case of a degenerated, then renaturation.But the method complex steps, success rate are low.Tea tree heat shock protein at present
CssHSP-6 gene has been found, but how it to be expressed with soluble form be still this field problem.The present invention is logical
It crosses and selects different bacterium bacterial strains, screens CssHSP-6 albumen using the concentration of different inducing temperatures and inducer IPTG
The condition of solubility expression lays the foundation for researchs such as gene function, protein crystals.
Summary of the invention
In view of the deficiencies of the prior art, the object of the present invention is to provide a kind of weights of tea tree heat shock protein CssHSP-6 gene
Group carrier and expression.
The technical scheme is that a kind of recombinant vector of tea tree heat shock protein CssHSP-6 gene, the recombination is carried
Body the preparation method is as follows: extracting the RNA of tea leaf, and reverse transcription goes out cDNA；Using cDNA as template amplification CssHSP-6 base
Cause；By CssHSP-6 amplified production after EcoRI and XhoI double digestion, it is inserted by DNA ligase through same double digestion
In pET-28a expression vector, recombinant plasmid pET-28a-CssHSP-6 is obtained.
Preferably, using cDNA as template, using following primer amplification CssHSP-6 gene, primer sequence is as follows:
Upstream primer: CssHSP-6-F:GCGAATTCATGGCGATGATTCCAAG underscore is EcoRI restriction enzyme site；
Downstream primer: CssHSP-6-R:CGCTCGAGTCAACCAGATATCTCAATAGACTTA underscore is XhoI digestion
Site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
The present invention also provides a kind of methods for expressing tea tree heat shock protein CssHSP-6 gene, comprising the following steps:
(1) recombinant vector described in claim 1 or 1 converts Bacillus coli cells, obtains the weight of expression CssHSP-6
Group prokaryotic expression bacterial strain；
(2) recombined pronucleus expression strain inoculated to kanamycins fluid nutrient medium or kanamycins+chloramphenicol liquid are trained
It supports in base, is incubated overnight activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to kanamycins fluid nutrient medium again or kanamycins+chlorine is mould
The expression of IPTG induction recombinant C ssHSP-6 is added in plain fluid nutrient medium, after shake culture；
(4) it after the completion of inducing, recycles and purifies expressed CssHSP-6 recombinant protein.
Preferably, when earthquake culture is to OD600=0.5 in step (3), the IPTG of final concentration of 0.8mM is added, 37
DEG C Fiber differentiation.
Preferably, kanamycins is 50ug/mL in the kanamycins fluid nutrient medium.
Preferably, kanamycins is 50ug/mL, chloramphenicol 50ug/ in the kanamycins+chloramphenicol fluid nutrient medium
mL。
The beneficial effects of the present invention are: the present invention is to obtain CssHSP-6 soluble protein, tea tree heat shock protein is constructed
The prokaryotic expression carrier of CssHSP-6 gene, and a series of optimization is carried out for protein expression condition, discovery is when induction temperature
When degree is 37 DEG C, expression quantity is best；With the increase of IPTG concentration, expressing quantity is gradually increased, and best induced concentration is
0.8mM；At 37 DEG C, when IPTG concentration is 0.8mM, when inducing expression 13h, expression quantity is best.Through SDS-PAGE electrophoresis detection,
The purpose band that molecular weight is about 23kDa is obtained, for the expected size of CssHSP-6 albumen, finally obtains CssHSP-6 solubility egg
It is white.Meanwhile the present invention purifies it with protein purification system, as a result further research albumin crystal structure and biology
It learns characteristic to lay the foundation, and then provides foundation for the disease resistance for improving tea tree by gene editing method.
Detailed description of the invention
Fig. 1 is digestion result schematic diagram, and 1 is the Plasmid DNA of digestion, and 2 be the digestion of EcoRI and XhoI inscribe as a result, M is
DNA Marker；
Fig. 2 is the albumen peak figure that CssHSP-6 albumen is obtained by the purifying of AKTA protein purification system and desalination；
Fig. 3 is the electrophoresis result figure after CssHSP-6 protein purification；
Fig. 4 is the result figure that SDS-PAGE electrophoresis tests optimum expression bacterial strain；
Fig. 5 is the result figure that SDS-PAGE electrophoresis tests best IPTG induced concentration；
Fig. 6 is the result figure that SDS-PAGE electrophoresis tests best inducing temperature；
Fig. 7 is western blot detection figure.
Specific embodiment
With reference to the accompanying drawing and invention is described further in specific embodiment:
Embodiment 1: the building and identification of tea tree heat shock protein CssHSP-6 gene recombined vector
1, the RNA of tea leaf is extracted, and reverse transcription goes out cDNA
Tea leaf material is taken, extracts seedling stage using RNA extracts kit (TIANGEN Biotech (Beijing) Co., Ltd.)
Total serum IgE obtains cDNA with reverse transcription reagent box (Promega) reverse transcription.
2, using cDNA as template amplification CssHSP-6 gene；
Design primer expands CssHSP-6 gene using cDNA as template, the nucleotide sequence of CssHSP-6 gene
As shown in SEQ ID NO.1, the amino acid sequence of the protein encoded as CssHSP-6 gene is as shown in SEQ ID NO.2.
Primer is as follows:
Upstream primer: CssHSP-6-F:GCGAATTCATGGCGATGATTCCAAG underscore is EcoRI restriction enzyme site；
Downstream primer: CssHSP-6-R:CGCTCGAGTCAACCAGATATCTCAATAGACTTA underscore is XhoI digestion
Site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
PCR amplification system used in gene magnification for vector construction is as follows: 5 × buffer 10 μ L, FastPfu
4 μ L, cDNA template of Fly DNA Polymerase 1 μ L (Quan Shijin), 2.5mmol dNTPs, 0.5 μ L, 10 μm of ol upstream and downstream are drawn
Object each 1 μ L, ddH2O 32.5μL。
The following are PCR amplification conditions: 95 DEG C of 2min, 35 circulation (95 DEG C of 20s, 58 DEG C of 20s, 72 DEG C of 30s-1min, 72 DEG C
5min。
3, CssHSP-6 gene recombined vector is constructed
After PCR product is purified, it is connected to pET-28a carrier.PCR product is detected using 1% agarose.PCR
Product is recycled with reference to Nanjing Vazyme Biotechnology Co., Ltd.'s Ago-Gel QIAquick Gel Extraction Kit specification.It is after the recovery
Product is inserted into the pET-28a expression vector through same double digestion after EcoRI and XhoI double digestion by DNA ligase,
16 DEG C connect 16 hours, construct pET-28a-CssHSP-6 recombinant plasmid.
By recombinant plasmid transformed to coli strain DH5a, trained on 50ug/mL kanamycins solid plate in 37 DEG C
It supports, picking individual colonies hold up the limited public affairs of section's biotechnology after digestion identification is correct (digestion result is as shown in Figure 1), then through Beijing
Take charge of its correct sequence of sequence verification.Sequencing result shows that CssHSP-6 coding sequence obtained fulfills the expectation,
Illustrate construction of recombinant plasmid success and is named as pET-28a-CssHSP-6, i.e. recombinant vector.
The inducing expression of embodiment 2:CssHSP-6 albumen
1, the recombined pronucleus expression bacterial strain of CssHSP-6 is obtained
It selects and successful monoclonal is sequenced in embodiment 1 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-
CssHSP-6 recombinant expression carrier extracts, and recombinant expression carrier is taken to convert e. coli bl21 (DE3), Rosetta
(DE3), BL21 (DE3) pLysS bacterial strain detects the expression of CssHSP-6 albumen.
2, activated strains are incubated overnight
It is incubated overnight and activates above-mentioned recombined pronucleus expression bacterial strain.For example, BL21 (DE3) bacterial strain is transferred to 50ug/mL
In kanamycins fluid nutrient medium, by Rosetta (DE3), BL21 (DE3) pLysS bacterial strain be transferred to 50ug/mL kanamycins+
In 50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.
3, inducing expression
The recombined pronucleus expression bacterial strain of activation is transferred in the fluid nutrient medium containing corresponding antibiotic, for example, will activation
BL21 (DE3) bacterial strain be transferred in 50ug/mL kanamycins fluid nutrient medium, by Rosetta (DE3), BL21 (DE3)
PLysS bacterial strain is transferred in 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C of shake cultures to OD600
When=0.5, the IPTG of final concentration of 0.8mM is added, 37 DEG C Fiber differentiation 10 hours, obtain the recombinant protein of CssHSP-6.
4, the purifying of CssHSP-6 recombinant protein
After the completion of induction, recycle and purify expressed CssHSP-6 recombinant protein, using AKTA protein purification system into
Row purifying and desalination, it is preferable that protein purification is carried out using AKTA purifier10 fast protein purification system, steps are as follows:
Since pET28a has 6 His coded sequences before terminator, so pET28a-CssHSP-6 recombinant expression carries
The albumen that body obtains can use Ni-NTA and carry out affinitive layer purification.Affinity chromatography is with protein or large biological molecule and knot
Based on closing the special affinity between aglucon on medium, because being connected to one in the matrix of chromatography gel used in His-tags
NTA [(nitrilotriacetic acid) nitrilotriacetic acid], can be with Ni ions binding, and the 6 of Ni ion and fusion protein
Attraction is generated between × His amino acid, thus by the fusion protein for having His-tags histidine tag and other protein regions
It separates, five yuan of imidazole rings of histidine residues are the key that albumen and Ni ionization, therefore when we use the miaow of high concentration
Azoles (Imidazole) solution elution when marquis (such as 400mM), imidazoles be convenient for protein His-tags imidazole ring competitive binding,
Finally fusion protein is eluted from gel.
Concrete operations: taking out the thallus of -80 DEG C of preservations, and Lysis buffer is added and is resuspended, the bacterium solution after resuspension is in ice bath
Middle carry out ultrasonic disruption, power 350W, duty ratio 50%, each circulation 30s, total time 35min.It is broken even
Slurry, 4 DEG C, 1,2000rpm centrifugation 30min.Supernatant is adsorbed on Ni-NTA adsorption column with peristaltic pump, 5mL/min, repeats one
It is secondary, retain 20 μ L by the sample of adsorption column and carries out protein adhesive electrophoresis；Ni-NTA adsorption column is connected to fast protein purifying system
On system, eluted；Albumen is collected according to UV absorption curve, and samples and carries out protein adhesive electrophoresis detection.
Fig. 2 is AKTA protein purification system purifying protein peak figure.CssHSP-6 albumen is pure by AKTA protein purification system
Change obtained albumen peak figure.
Fig. 3 is the electrophoretogram after CssHSP-6 protein purification.It is the expression and purification at 37 DEG C, IPTG concentration 1.0mM
CssHSP-6 albumen result.1 is the affine rear efflux of Ni column；2 be the albumen after Ni column is affine after purification；M is albumen
marker.Red arrow meaning is shown as CssHSP-6 albumen.Fig. 4 shows, CssHSP-6 albumen often has under this condition
It is solubility expression in clear liquid, the CssHSP-6 purity of protein obtained after purification by AKTA protein purification system reaches requirement,
It can be used for subsequent experimental.
The verifying of the protein induced expression condition of embodiment 3:CssHSP-6
1, the recombinant strains of CssHSP-6 are obtained
It selects and successful monoclonal is sequenced in embodiment 1 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-
CssHSP-6 recombinant expression carrier extracts, and recombinant expression carrier is taken to convert e. coli bl21 (DE3), Rosetta respectively
(DE3), BL21 (DE3) pLysS bacterial strain is coated on the plate of kanamycins containing 50ug/mL (Rosetta (DE3), BL21 (DE3)
PLysS bacterial strain need to add 50ug/mL chloramphenicol) on be incubated overnight in 37 DEG C, picking single colonie is inoculated into containing corresponding antibiosis
Element fluid nutrient medium in, 37 DEG C, 200rpm be incubated overnight, in bacterium solution be added sterilizing 50% glycerol, freeze after mixing in -80
DEG C refrigerator obtains the prokaryotic expression bacterial strain of expression CssHSP-6.
2, the determination of CssHSP-6 Primary structure bacterial strain
It is inoculated with above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3), Rosetta (DE3), BL21 (DE3) pLysS respectively,
To 50ug/mL kanamycins (Rosetta (DE3), BL21 (DE3) pLysS bacterial strain need to add 50ug/mL chloramphenicol) Liquid Culture
In base, 37 DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to 50ug/mL card, and that is mould
In plain (Rosetta (DE3), BL21 (DE3) pLysS bacterial strain need to add 50ug/mL chloramphenicol) fluid nutrient medium, 37 DEG C of concussion trainings
When supporting to OD600=0.5, the IPTG of final concentration of 1mM is added, (takes pET-28a bacterium to make negative within Fiber differentiation 13 hours at 16 DEG C
Control).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min collects thallus, bacterial precipitation and negative control with 2mL and PBS is pre-chilled
Buffer (with preceding addition 1mM PMSF) suspends, and carries out clasmatosis with Ultrasonic Cell Disruptor, each 10sec, and totally 10 times, between each
Every 30sec；1,2000rpm centrifugation 10min takes supernatant, SDS-PAGE electrophoresis detection, test expression bacterial strain, as a result such as Fig. 4 institute
Show, BL21 (DE3), Rosetta (DE3), BL21 (DE3) pLysS can preferably express CssHSP-6 albumen, but in BL21
(DE3) expression is best.
3, the determination of the best IPTG concentration of CssHSP-6 Primary structure
Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37
DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to the training of 50ug/mL kanamycins liquid
It supports in base, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 0,0.6,0.8,1.0mM is separately added into, 25
DEG C Fiber differentiation 8 hours (bacterium not induced is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min is collected
Thallus, bacterial precipitation and negative control 2mL are pre-chilled PBS buffer (with preceding addition 1mM PMSF) and suspend, and use Ultrasonic Cell Disruptor
Progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes supernatant, SDS-
PAGE electrophoresis detection tests best IPTG induced concentration, as a result as shown in figure 5, the best IPTG concentration of CssHSP-6 inducing expression
For 0.8mM.
4, the determination of CssHSP-6 Primary structure optimum temperature
Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37
DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to the training of 50ug/mL kanamycins liquid
Support in base, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 0.8mM be added, respectively 16,20,25,30,
With 37 DEG C Fiber differentiation 4-13 hours (pET-28a bacterium is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation
2min collects thallus, bacterial precipitation and negative control 2mL and PBS buffer (with preceding addition 1mM PMSF) suspension is pre-chilled, uses
Ultrasonic Cell Disruptor progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes
Clearly, SDS-PAGE electrophoresis detection tests best inducing temperature, as a result as shown in fig. 6, best inducing temperature is 37 DEG C.
The western blot of embodiment 4:CssHSP-6 recombinant protein is detected
(1) it extracts by CssHSP-6 albumen after purification:
1. cultivating the E. coli expression strains containing pET-28a-CssHSP-6 plasmid, IPTG inducing expression；
2. protein lysate (50mM Tris pH 8.0,120mM NaCl, 1mM DTT, 0.5%NP-40, before is added
1mM PMSF, 1mM DTT is added), after ultrasonic disruption cell, supernatant is collected by centrifugation, places 20min on ice；
3.15,000g, 4 DEG C of centrifugation 5min abandon precipitating；
4. taking 200 μ L supernatants that 5 × Loading Buffer is added, concussion is mixed, and -80 DEG C of remaining sample freeze；
5. boiling water boiling 5min, ice bath, 12,000rpm centrifugation 5min draw 15 μ L of supernatant and carry out protein electrophoresis, remaining sample
- 20 DEG C of product freeze；
6. prepare SDS-PAGE glue, first carry out electrophoresis 20min with 90V, when sample enters separation gel, with 150V voltage into
Row electrophoresis, until bromophenol blue stops electrophoresis when running out of separation gel.
(2) transferring film
Cut with a paper cutter out the pvdf membrane more somewhat larger than glue (for pvdf membrane, first with methanol impregnate 30 seconds, then
ddH23-5min is impregnated in O, is then placed in transferring film buffer) rubber plate clamp is put into electrophoretic blotting groove.Transferring film buffer is poured into,
4 DEG C, 100V 90min.
(3) it closes
After the completion of transferring film, pvdf membrane is taken out, is put in the PBST solution with 5% skimmed milk power, 2h is closed on shaking table.
(4) primary antibody is incubated for
Confining liquid is discarded, is added Anti His antibody (1:5000), shaking table is incubated for 12h.
(5) secondary antibody is incubated for
Primary antibody is outwelled, washs pvdf membrane 3 times with 1 × PBST, each 5min；Corresponding secondary antibody (sheep anti-Mouse) is added, shakes
Bed is incubated for 1h.
(6) ECL exposes
Secondary antibody is abandoned, washs pvdf membrane 3 times with 1 × PBST, each 5min；HRP chemiluminescent substrate is added on pvdf membrane
Liquid can detect protein expression signal (as shown in Figure 7) on 5200 chemiluminescence detectors in day, and succeed table as can be seen from the results
Up to CssHSP-6 albumen out.
Nucleotide series table:
SEQUENCE LISTING
Sequence table
<110>Guizhou University
<120>a kind of recombinant vector and expression of tea tree heat shock protein CssHSP-6 gene
<160> 4
<210>1
<211>480
<212>DNA
<213>tea tree heat shock protein CssHSP-6
<400>1
ATGGCGATGA TTCCAAGCAT CTTCGGCGGC CGTCGAAGCA ATGTCTTCGA TCCATTCTCT 60
CTCGACATCT GGGATCCCTT TGAGGGCTTT CCCTTCAACA ACGCCCTCGC CAACATCCCC 120
AACTCCGCCC GCGAGACCTC CGCCTTTGCC AACACTCGCA TTGACTGGAA AGAGACTCCA 180
GAGGCTCACA TCTTCAAAGC CGATCTTCCA GGGCTGAAGA AGGAAGAAGT GAAGGTGGAA 240
GTTGAAGAAG GAAGAGTTTT GCAGATCAGC GGGGAGAGAA GCAGAGAGCA TGAGGAGAAG 300
AACGAGAAAT GGCACCTCGT CGAGCGGAGC AGCGGCAAGT TCCTCCGCAG GTTCAGGCTG 360
CCAGAGAATG TGAAGACGGA TCATGTGAAG GCTAATATGG AGGACGGTGT GCTGACTGTG 420
ATGGTGCCTA AGGAAGAAGA GAAGAAGCCT GAGGTTAAGT CTATTGAGAT ATCTGGTTGA 480
<210>2
<211>159
<212>PRT
<213>tea tree heat shock protein CssHSP-6
<400>2
MAMIPSIFGG RRSNVFDPFS LDIWDPFEGF PFNNALANIP NSARETSAFA NTRIDWKETP 60
EAHIFKADLP GLKKEEVKVE VEEGRVLQIS GERSREHEEK NEKWHLVERS SGKFLRRFRL 120
PENVKTDHVK ANMEDGVLTV MVPKEEEKKP EVKSIEISG 159
<210>3
<211>25
<212>DNA
<213>artificial sequence
<400>3
GCGAATTCAT GGCGATGATT CCAAG 25
<210>4
<211>33
<212>DNA
<213>artificial sequence
<400>4
CGCTCGAGTC AACCAGATAT CTCAATAGAC TTA 33
Claims (6)
1. a kind of recombinant vector of tea tree heat shock protein CssHSP-6 gene, which is characterized in that the preparation side of the recombinant vector
Method is as follows: extracting the RNA of tea leaf, and reverse transcription goes out cDNA；Using cDNA as template amplification CssHSP-6 gene；It will
CssHSP-6 amplified production is inserted into the pET- through same double digestion after EcoRI and XhoI double digestion, through DNA ligase
In 28a expression vector, recombinant plasmid pET-28a-CssHSP-6 is obtained.
2. recombinant vector according to claim 1, which is characterized in that using cDNA as template, utilize following primer amplification
CssHSP-6 gene, primer sequence are as follows:
Upstream primer: CssHSP-6-F:GCGAATTCATGGCGATGATTCCAAG underscore is EcoRI restriction enzyme site；
Downstream primer: CssHSP-6-R:CGCTCGAGTCAACCAGATATCTCAATAGACTTA underscore is XhoI digestion position
Point；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
3. a kind of method for expressing tea tree heat shock protein CssHSP-6 gene, which comprises the following steps:
(1) Bacillus coli cells are converted with recombinant vector of any of claims 1 or 2, the recombination for obtaining expression CssHSP-6 is former
Nuclear expression bacterial strain；
(2) by recombined pronucleus expression strain inoculated to kanamycins fluid nutrient medium or kanamycins+chloramphenicol fluid nutrient medium
In, it is incubated overnight activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to kanamycins fluid nutrient medium or kanamycins+chloramphenicol liquid
The expression of IPTG induction recombinant C ssHSP-6 is added in culture medium, after shake culture；
(4) it after the completion of inducing, recycles and purifies expressed CssHSP-6 recombinant protein.
4. the method for expression tea tree heat shock protein CssHSP-6 gene according to claim 3, which is characterized in that step
(3) when earthquake culture is to OD600=0.5 in, the IPTG of final concentration of 0.8mM is added, in 37 DEG C of Fiber differentiations.
5. the method for expression tea tree heat shock protein CssHSP-6 gene according to claim 3, which is characterized in that the card
Kanamycins is 50ug/mL in that mycin fluid nutrient medium.
6. the method for expression tea tree heat shock protein CssHSP-6 gene according to claim 3, which is characterized in that the card
Kanamycins is 50ug/mL, chloramphenicol 50ug/mL in that mycin+chloramphenicol fluid nutrient medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910357329.6A CN110117604A (en) | 2019-04-29 | 2019-04-29 | A kind of recombinant vector and expression of tea tree heat shock protein CssHSP-6 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910357329.6A CN110117604A (en) | 2019-04-29 | 2019-04-29 | A kind of recombinant vector and expression of tea tree heat shock protein CssHSP-6 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110117604A true CN110117604A (en) | 2019-08-13 |
Family
ID=67521651
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910357329.6A Pending CN110117604A (en) | 2019-04-29 | 2019-04-29 | A kind of recombinant vector and expression of tea tree heat shock protein CssHSP-6 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110117604A (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002081695A2 (en) * | 2001-04-06 | 2002-10-17 | Syngenta Participations Ag | Genes that are modulated by posttranscriptional gene silencing |
| US20030172404A1 (en) * | 1999-02-26 | 2003-09-11 | John Peter Crook Lloyd | Method of modifying plant characters by the targeted expression of a cell cycle control protein |
| CN1552858A (en) * | 2003-12-18 | 2004-12-08 | 中国农业科学院茶叶研究所 | Thermal protein differential expression sequence label of tea tree and biological chip |
| US20050055748A1 (en) * | 2003-03-28 | 2005-03-10 | Downie A. Bruce | Stress-responsive genes, regulatory elements, and methods of use for same |
| CN101544983A (en) * | 2009-04-24 | 2009-09-30 | 中国农业科学院油料作物研究所 | Rape heat shock protein gene HSP17.8 and application thereof |
| CN103665125A (en) * | 2013-12-06 | 2014-03-26 | 中国热带农业科学院橡胶研究所 | HbsHsp1 protein coming from hevea brasiliensis, and coding gene and application thereof |
| CN105087602A (en) * | 2014-05-19 | 2015-11-25 | 上海市农业科学院 | Application of heat shock protein gene in construction of high-heat-tolerance escherichia coli |
| KR20170142222A (en) * | 2016-06-16 | 2017-12-28 | 주식회사 바이오에프디엔씨 | Recombinant Protein Expression Vector in Plant cell and the Method for Preparing the Protein |
-
2019
- 2019-04-29 CN CN201910357329.6A patent/CN110117604A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030172404A1 (en) * | 1999-02-26 | 2003-09-11 | John Peter Crook Lloyd | Method of modifying plant characters by the targeted expression of a cell cycle control protein |
| WO2002081695A2 (en) * | 2001-04-06 | 2002-10-17 | Syngenta Participations Ag | Genes that are modulated by posttranscriptional gene silencing |
| US20050055748A1 (en) * | 2003-03-28 | 2005-03-10 | Downie A. Bruce | Stress-responsive genes, regulatory elements, and methods of use for same |
| CN1552858A (en) * | 2003-12-18 | 2004-12-08 | 中国农业科学院茶叶研究所 | Thermal protein differential expression sequence label of tea tree and biological chip |
| CN101544983A (en) * | 2009-04-24 | 2009-09-30 | 中国农业科学院油料作物研究所 | Rape heat shock protein gene HSP17.8 and application thereof |
| CN103665125A (en) * | 2013-12-06 | 2014-03-26 | 中国热带农业科学院橡胶研究所 | HbsHsp1 protein coming from hevea brasiliensis, and coding gene and application thereof |
| CN105087602A (en) * | 2014-05-19 | 2015-11-25 | 上海市农业科学院 | Application of heat shock protein gene in construction of high-heat-tolerance escherichia coli |
| KR20170142222A (en) * | 2016-06-16 | 2017-12-28 | 주식회사 바이오에프디엔씨 | Recombinant Protein Expression Vector in Plant cell and the Method for Preparing the Protein |
Non-Patent Citations (13)
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103981204B (en) | A kind of expression of activated goldfish Tgf2 transposons restructuring transposase albumen | |
| CN109536522A (en) | A kind of preparation and application of the prokaryotic expression, polyclonal antibody of southern rice black-streaked dwarf virus P6 albumen | |
| CN110117604A (en) | A kind of recombinant vector and expression of tea tree heat shock protein CssHSP-6 gene | |
| CN110423770A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein CMU1 gene | |
| CN110093363A (en) | A kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene | |
| CN110042115A (en) | A kind of recombinant vector and expression of potato aphid effect protein Me23 gene | |
| CN110117607A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene | |
| CN103275203A (en) | Gene engineering preparation and identification method for eriocheir sinensis crustacean hyperglycemic hormone | |
| CN110117606A (en) | A kind of recombinant vector and expression of Potato Aphid effect protein Me10 gene | |
| CN110747199B (en) | Bee stress-resistance related gene NF-Y and application thereof | |
| CN107759684B (en) | Recombinant periplaneta americana thymosin protein PaTHY1 and expression method thereof | |
| CN104099362A (en) | Expression vector and preparation method of HNTX (Hainantoxin)-IV analogue rHNIV-01 | |
| CN109943574A (en) | A kind of sorghum 14-3-3 Protein G F14b gene and its recombinant vector and expression | |
| CN109912705A (en) | A kind of sorghum 14-3-3 Protein G F14c gene and its recombinant vector and expression | |
| CN109913471A (en) | A kind of sorghum transcription factor SbGRF4 gene and its recombinant vector and expression | |
| CN109810986A (en) | A kind of sorghum 14-3-3 Protein G F14a gene and its recombinant vector and expression | |
| CN109971770A (en) | A kind of sorghum C2H2 zinc finger protein gene SbZFP36 and its recombinant vector and expression | |
| CN109913478A (en) | A kind of sorghum E3 ubiquitin ligase SbBAG4 gene and its recombinant vector and expression | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN109971767A (en) | A kind of sorghum transcription factor SbWRKY45 gene and its recombinant vector and expression | |
| CN104212779B (en) | A kind of novel ribonuclease A and purifying production process thereof | |
| CN109971769A (en) | A kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expression | |
| CN110042116A (en) | A kind of recombinant vector and expression of rice blast fungus biological clock control gene M oCCG4 | |
| CN110093364A (en) | A kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene | |
| CN105085646A (en) | Centipede analgesic peptide SLP_RhTx and gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190813 |
|
| RJ01 | Rejection of invention patent application after publication |