CN110093363A - A kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene - Google Patents
A kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene Download PDFInfo
- Publication number
- CN110093363A CN110093363A CN201910358655.9A CN201910358655A CN110093363A CN 110093363 A CN110093363 A CN 110093363A CN 201910358655 A CN201910358655 A CN 201910358655A CN 110093363 A CN110093363 A CN 110093363A
- Authority
- CN
- China
- Prior art keywords
- expression
- gene
- peach aphid
- protein
- black peach
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Insects & Arthropods (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of recombinant vectors of black peach aphid effect protein Mp1 gene, and invention additionally discloses a kind of expressions of black peach aphid effect protein Mp1 gene.The present invention constructs the prokaryotic expression carrier of black peach aphid effect protein Mp1 gene, and a series of optimization is carried out for protein expression condition, finally obtain Mp1 soluble protein, as a result further research albumin crystal structure and biological characteristics lay the foundation, thinking is provided for the pesticide manufacturing of target for Mp1 for design, and then provides foundation for prevention and treatment black peach aphid.
Description
Technical field
The present invention relates to the recombinant vectors and expression of a kind of black peach aphid effect protein Mp1 gene, belong to biotechnology neck
Domain.
Background technique
More than 20 generations occur within peach aphid general 1 year, it is overwintering on peach with ovum, it can also be with aptery viviparous female in air partition
Spinach is overwintering in clamp with brassicaceous vegetable.Overwintering on peach with ovum, early spring in next year peach bud was sprouted to florescence,
Ovum starts to hatch, and is clustered on tender shoots and sucks juice.March between April, is bred in a manner of virginopara and is caused harm.Adult and children
Worm cluster blade back is killed blade from leaf margin to the vertical volume of blade back, organizes thickness of growing fat, chlorisis, and drains mucus pollution branches and leaves, inhibits new
Tip growth, causes to fall leaves.
Severity whether generation with prevalence of entomophila disease, depends on virus-Insect-Plant three's interaction.
In plant and plant-feed insect defence with the anti-game defendd, when plant experiences the signal of plant-feed insect, energy is rapidly
The relevant immune signal transduction of plant-feed insect molecular pattern is activated, the transcriptional expression of numerous resistance related genes is then regulated and controled,
The synthesis of defensive substance is mediated, to improve the resilience of plants against insects infringement.In order to which the resistance for coping with plant is immune, plant
Feeding habits insect can secrete the saliva effector of specificity to inhibit the immune activation of plant, to inhibit to plant during feeding
The expression of object defensin gene and the synthesis of resisting substance, so guarantee insect on host plant normal feeding, grow with it is numerous
Spread out.In recent years, the report for constantly thering is insect effect protein gene to be cloned, such as Bemisia tabaci, root-knot nematode, cereal crop spore
Effect protein gene in capsule nematode etc. has also successively been cloned by separation.
The prokaryotic expression of gene is one of the common technology for studying gene function.Large intestine is usually present when albumen pronucleus expression
Since rare codon causes expression to limit in bacillus, inclusion body is formed；It can inhibit albumen when the stronger protein expression of toxicity
Expression causes expression yield too low；Another easy the problem of ignoring, which is that reproducibility is excessively high in Escherichia coli, will lead to two sulphur
Key cannot be properly formed, and cause expression product insoluble.For above-mentioned problem, it is common practice to after dissolving inclusion body with urea
It is purified in the case of a degenerated, then renaturation.But the method complex steps, success rate are low.Black peach aphid effect protein Mp1 at present
Gene has been found, but how it to be expressed with soluble form be still this field problem.The present invention is by selecting not
Bacterium bacterial strain together screens Mp1 solubility expression of protein using the concentration of different inducing temperatures and inducer IPTG
Condition lays the foundation for researchs such as gene function, protein crystals.
Summary of the invention
In view of the deficiencies of the prior art, the object of the present invention is to provide a kind of recombination of black peach aphid effect protein Mp1 gene loads
Body and expression.
The technical scheme is that a kind of recombinant vector of black peach aphid effect protein Mp1 gene, the system of the recombinant vector
Preparation Method is as follows: extracting the RNA of black peach aphid, and reverse transcription goes out cDNA；Using cDNA as template amplification Mp1 gene；By Mp1 amplified production
After BamHI and XhoI double digestion, it is inserted into the pET-28a expression vector through same double digestion, is obtained by DNA ligase
Recombinant plasmid pET-28a-Mp1.
Preferably, using cDNA as template, using following primer amplification Mp1 gene, primer sequence is as follows:
Upstream primer: Mp1-F:GCGAATTCATGAGTCTCTACCAGCCGC underscore is BamHI restriction enzyme site；
Downstream primer: Mp1-R:CGCTCGAGTTACAATAATTCACGATCGATG underscore is XhoI restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
The present invention also provides a kind of methods for expressing black peach aphid effect protein Mp1 gene, comprising the following steps:
(1) recombinant vector described in claim 1 or 1 converts Bacillus coli cells, obtains the recombination protokaryon of expression Mp1
Express bacterial strain；
(2) recombined pronucleus expression strain inoculated to kanamycins fluid nutrient medium or kanamycins+chloramphenicol liquid are trained
It supports in base, is incubated overnight activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to kanamycins fluid nutrient medium or kanamycins+chloramphenicol
The expression of IPTG induction recombination Mp1 is added in fluid nutrient medium, after shake culture；
(4) it after the completion of inducing, recycles and purifies expressed Mp1 recombinant protein.
Preferably, when earthquake culture is to OD600=0.5 in step (3), the IPTG of final concentration of 0.8mM is added, 37
DEG C Fiber differentiation.
Preferably, kanamycins is 50ug/mL in the kanamycins fluid nutrient medium.
Preferably, kanamycins is 50ug/mL, chloramphenicol 50ug/ in the kanamycins+chloramphenicol fluid nutrient medium
mL。
The beneficial effects of the present invention are: the present invention is to obtain Mp1 soluble protein, black peach aphid effect protein Mp1 base is constructed
The prokaryotic expression carrier of cause, and a series of optimization is carried out for protein expression condition, it finds when inducing temperature is 37 DEG C,
Its expression quantity is best；With the increase of IPTG concentration, expressing quantity is gradually increased, and best induced concentration is 0.8mM；37
DEG C, when IPTG concentration is 0.8mM, expression quantity is best.Through SDS-PAGE electrophoresis detection, the mesh that molecular weight is about 17kDa is obtained
Band finally obtain Mp1 soluble protein for the expected size of Mp1 albumen.Meanwhile present invention protein purification system is to it
It is purified, as a result further research albumin crystal structure and biological characteristics lay the foundation, being directed to Mp1 for design is target
Target pesticide manufacturing provides thinking, and then provides foundation for prevention and treatment black peach aphid.
Detailed description of the invention
Fig. 1 is digestion result schematic diagram, and 1 is the Plasmid DNA of digestion, and 2 be the digestion of BamHI and XhoI inscribe as a result, M is
DNA Marker；
Fig. 2 is the albumen peak figure that Mp1 albumen is obtained by the purifying of AKTA protein purification system and desalination；
Fig. 3 is the electrophoresis result figure after Mp1 protein purification；
Fig. 4 is the result figure that SDS-PAGE electrophoresis tests optimum expression bacterial strain；
Fig. 5 is the result figure that SDS-PAGE electrophoresis tests best IPTG induced concentration；
Fig. 6 is the result figure that SDS-PAGE electrophoresis tests best inducing temperature；
Fig. 7 is western blot detection figure.
Specific embodiment
With reference to the accompanying drawing and invention is described further in specific embodiment:
Embodiment 1: the building and identification of black peach aphid effect protein Mp1 gene recombined vector
1, black peach aphid RNA is extracted, and reverse transcription goes out cDNA
Black peach aphid material is taken, it is total to extract seedling stage using RNA extracts kit (TIANGEN Biotech (Beijing) Co., Ltd.)
RNA obtains cDNA with reverse transcription reagent box (Promega) reverse transcription.
2, using cDNA as template amplification Mp1 gene；
Design primer expands Mp1 gene using cDNA as template, the nucleotide sequence of Mp1 gene such as SEQ ID
Shown in NO.1, the amino acid sequence of the protein encoded as Mp1 gene is as shown in SEQ ID NO.2.
Primer is as follows:
Upstream primer: Mp1-F:GCGAATTCATGAGTCTCTACCAGCCGC underscore is BamHI restriction enzyme site；
Downstream primer: Mp1-R:CGCTCGAGTTACAATAATTCACGATCGATG underscore is XhoI restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
PCR amplification system used in gene magnification for vector construction is as follows: 5 × buffer 10 μ L, FastPfu
4 μ L, cDNA template of Fly DNA Polymerase 1 μ L (Quan Shijin), 2.5mmol dNTPs, 0.5 μ L, 10 μm of ol upstream and downstream are drawn
Object each 1 μ L, ddH2O 32.5μL。
The following are PCR amplification conditions: 95 DEG C of 2min, 35 circulation (95 DEG C of 20s, 58 DEG C of 20s, 72 DEG C of 30s-1min, 72 DEG C
5min。
3, Mp1 gene recombined vector is constructed
After PCR product is purified, it is connected to pET-28a carrier.PCR product is detected using 1% agarose.PCR
Product is recycled with reference to Nanjing Vazyme Biotechnology Co., Ltd.'s Ago-Gel QIAquick Gel Extraction Kit specification.It is after the recovery
Product is inserted into the pET-28a expression vector through same double digestion after BamHI and XhoI double digestion by DNA ligase,
16 DEG C connect 16 hours, construct pET-28a-Mp1 recombinant plasmid.
By recombinant plasmid transformed to coli strain DH5a, trained on 50ug/mL kanamycins solid plate in 37 DEG C
It supports, picking individual colonies hold up the limited public affairs of section's biotechnology after digestion identification is correct (digestion result is as shown in Figure 1), then through Beijing
Take charge of its correct sequence of sequence verification.Sequencing result shows that Mp1 coding sequence obtained fulfills the expectation, explanation
Construction of recombinant plasmid success is simultaneously named as pET-28a-Mp1, i.e. recombinant vector.
The inducing expression of embodiment 2:Mp1 albumen
1, the recombined pronucleus expression bacterial strain of Mp1 is obtained
It selects and successful monoclonal is sequenced in embodiment 1 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-Mp1
Recombinant expression carrier extracts, and recombinant expression carrier is taken to convert e. coli bl21 (DE3), Rosetta (DE3), BL21
(DE3) pLysS, Tuner (DE3) bacterial strain detects the expression of Mp1 albumen.
2, activated strains are incubated overnight
It is incubated overnight and activates above-mentioned recombined pronucleus expression bacterial strain.For example, BL21 (DE3), Tuner (DE3) bacterial strain are turned
It is connected in 50ug/mL kanamycins fluid nutrient medium, Rosetta (DE3), BL21 (DE3) pLysS bacterial strain is transferred to 50ug/
In mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.
3, inducing expression
The recombined pronucleus expression bacterial strain of activation is transferred in the fluid nutrient medium containing corresponding antibiotic, for example, will activation
BL21 (DE3), Tuner (DE3) bacterial strain be transferred in 50ug/mL kanamycins fluid nutrient medium, by Rosetta (DE3),
BL21 (DE3) pLysS bacterial strain is transferred in 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C of concussion trainings
When supporting to OD600=0.5, the IPTG of final concentration of 0.8mM is added, 25 DEG C Fiber differentiation 10 hours, obtain the recombination egg of Mp1
It is white.
4, the purifying of Mp1 recombinant protein
After the completion of induction, expressed Mp1 recombinant protein is recycled and purified, is purified using AKTA protein purification system
And desalination, it is preferable that protein purification is carried out using AKTA purifier10 fast protein purification system, steps are as follows:
Since pET28a has 6 His coded sequences before terminator, so pET28a-Mp1 recombinant expression carrier obtains
Albumen can use Ni-NTA carry out affinitive layer purification.Affinity chromatography is with protein or large biological molecule and to be incorporated in Jie
Based on special affinity in matter between aglucon, because being connected to a NTA in the matrix of chromatography gel used in His-tags
[(nitrilotriacetic acid) nitrilotriacetic acid], can with Ni ions binding, and the 6 of Ni ion and fusion protein ×
Attraction is generated between His amino acid, so that the fusion protein with His-tags histidine tag be distinguished with other albumen
It comes, five yuan of imidazole rings of histidine residues are the key that albumen and Ni ionization, therefore when we use the imidazoles of high concentration
(Imidazole) solution elution when marquis (such as 400mM), imidazoles be convenient for protein His-tags imidazole ring competitive binding, most
Fusion protein is eluted from gel at last.
Concrete operations: taking out the thallus of -80 DEG C of preservations, and Lysis buffer is added and is resuspended, the bacterium solution after resuspension is in ice bath
Middle carry out ultrasonic disruption, power 350W, duty ratio 50%, each circulation 30s, total time 35min.It is broken even
Slurry, 4 DEG C, 1,2000rpm centrifugation 30min.Supernatant is adsorbed on Ni-NTA adsorption column with peristaltic pump, 5mL/min, repeats one
It is secondary, retain 20 μ L by the sample of adsorption column and carries out protein adhesive electrophoresis；Ni-NTA adsorption column is connected to fast protein purifying system
On system, eluted；Albumen is collected according to UV absorption curve, and samples and carries out protein adhesive electrophoresis detection.
Fig. 2 is AKTA protein purification system purifying protein peak figure.Mp1 albumen purifies to obtain by AKTA protein purification system
Albumen peak figure.
Fig. 3 is the electrophoretogram after Mp1 protein purification.It is the expression and purification Mp1 albumen at 37 DEG C, IPTG concentration 0.8mM
As a result.1 is albumen of the albumen supernatant after Ni column affinity purification；2 be efflux of the albumen supernatant after Ni column affinity purification；M
For albumen marker；Red arrow meaning is shown as Mp1 albumen.Fig. 4 shows that Mp1 albumen often has in supernatant under this condition
In, it is solubility expression, the Mp1 purity of protein obtained after purification by AKTA protein purification system reaches requirement, after can be used for
Continuous experiment.
The verifying of the protein induced expression condition of embodiment 3:Mp1
1, the recombinant strains of Mp1 are obtained
It selects and successful monoclonal is sequenced in embodiment 1 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-Mp1
Recombinant expression carrier extracts, take recombinant expression carrier convert respectively e. coli bl21 (DE3), Rosetta (DE3),
BL21 (DE3) pLysS, Tuner (DE3) bacterial strain, is coated on the plate of kanamycins containing 50ug/mL (Rosetta (DE3), BL21
(DE3) pLysS bacterial strain need to add 50ug/mL chloramphenicol) on be incubated overnight in 37 DEG C, picking single colonie is inoculated into containing corresponding
In the fluid nutrient medium of antibiotic, 37 DEG C, 200rpm be incubated overnight, in bacterium solution be added sterilizing 50% glycerol, frozen after mixing
In -80 DEG C of refrigerators, the prokaryotic expression bacterial strain of expression Mp1 is obtained.
2, the determination of Mp1 Primary structure bacterial strain
Be inoculated with respectively above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3), Rosetta (DE3), BL21 (DE3) pLysS,
Tuner (DE3), to 50ug/mL kanamycins, (Rosetta (DE3), that BL21 (DE3) pLysS bacterial strain need to add 50ug/mL chlorine is mould
Element) in fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to
50ug/mL kanamycins (Rosetta (DE3), BL21 (DE3) pLysS bacterial strain need to add 50ug/mL chloramphenicol) fluid nutrient medium
In, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 1mM is added, (is taken within Fiber differentiation 13 hours at 16 DEG C
PET-28a bacterium makees negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min collects thallus, bacterial precipitation and feminine gender
Control is suspended with 2mL pre-cooling PBS buffer (with preceding addition 1mM PMSF), carries out clasmatosis with Ultrasonic Cell Disruptor, every time
10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes supernatant, and SDS-PAGE electrophoresis detection tests table
Up to bacterial strain, as a result as shown in figure 4, Rosetta (DE3), BL21 (DE3) pLysS, BL21 (DE3), Tuner (DE3) can be preferable
Mp1 albumen is expressed, wherein expressing in BL21 (DE3) bacterial strain best.
3, the determination of the best IPTG concentration of Mp1 Primary structure
Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37
DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to the training of 50ug/mL kanamycins liquid
It supports in base, when 37 DEG C of shake cultures are to OD600=0.5, is separately added into the IPTG of final concentration of 0,0.4,0.6,0.8,1.0mM,
25 DEG C Fiber differentiation 8 hours (bacterium not induced is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min,
It collects thallus, bacterial precipitation and negative control 2mL and PBS buffer (with preceding addition 1mM PMSF) suspension is pre-chilled, it is broken with ultrasound
Broken instrument progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes supernatant,
SDS-PAGE electrophoresis detection tests best IPTG induced concentration, as a result as shown in figure 5, the best IPTG concentration of Mp1 inducing expression is
0.8mM。
4, the determination of Mp1 Primary structure optimum temperature
Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37
DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to the training of 50ug/mL kanamycins liquid
Support in base, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 0.8mM be added, respectively 16,20,25,30,
With 37 DEG C Fiber differentiation 8-16 hours (pET-28a bacterium is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation
2min collects thallus, bacterial precipitation and negative control 2mL and PBS buffer (with preceding addition 1mM PMSF) suspension is pre-chilled, uses
Ultrasonic Cell Disruptor progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes
Clearly, SDS-PAGE electrophoresis detection tests best inducing temperature, as a result as shown in fig. 6, best inducing temperature is 37 DEG C.
The western blot of embodiment 4:Mp1 recombinant protein is detected
(1) it extracts by Mp1 albumen after purification:
1. cultivating the E. coli expression strains containing pET-28a-Mp1 plasmid, IPTG inducing expression；
2. protein lysate (50mM Tris pH 8.0,120mM NaCl, 1mM DTT, 0.5%NP-40, before is added
1mM PMSF, 1mM DTT is added), after ultrasonic disruption cell, supernatant is collected by centrifugation, places 20min on ice；
3.15,000g, 4 DEG C of centrifugation 5min abandon precipitating；
4. taking 200 μ L supernatants that 5 × Loading Buffer is added, concussion is mixed, and -80 DEG C of remaining sample freeze；
5. boiling water boiling 5min, ice bath, 12,000rpm centrifugation 5min draw 15 μ L of supernatant and carry out protein electrophoresis, remaining sample
- 20 DEG C of product freeze；
6. prepare SDS-PAGE glue, first carry out electrophoresis 20min with 90V, when sample enters separation gel, with 150V voltage into
Row electrophoresis, until bromophenol blue stops electrophoresis when running out of separation gel.
(2) transferring film
Cut with a paper cutter out the pvdf membrane more somewhat larger than glue (for pvdf membrane, first with methanol impregnate 30 seconds, then
ddH23-5min is impregnated in O, is then placed in transferring film buffer) rubber plate clamp is put into electrophoretic blotting groove.Transferring film buffer is poured into,
4 DEG C, 100V 90min.
(3) it closes
After the completion of transferring film, pvdf membrane is taken out, is put in the PBST solution with 5% skimmed milk power, 2h is closed on shaking table.
(4) primary antibody is incubated for
Confining liquid is discarded, is added Anti His antibody (1:5000), shaking table is incubated for 12h.
(5) secondary antibody is incubated for
Primary antibody is outwelled, washs pvdf membrane 3 times with 1 × PBST, each 5min；Corresponding secondary antibody (sheep anti-Mouse) is added, shakes
Bed is incubated for 1h.
(6) ECL exposes
Secondary antibody is abandoned, washs pvdf membrane 3 times with 1 × PBST, each 5min；HRP chemiluminescent substrate is added on pvdf membrane
Liquid can detect protein expression signal (as shown in Figure 7) on 5200 chemiluminescence detectors in day, and succeed table as can be seen from the results
Up to Mp1 albumen out.
Nucleotide series table:
SEQUENCE LISTING
Sequence table
<110>Guizhou University
<120>a kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene
<160> 4
<210>1
<211>426
<212> DNA
<213>black peach aphid effect protein Mp1
<400>1
ATGACGGTTA AAATTTCTGT TTTTGCTGTC GTTCTGATTG TGACTTGTGT CCGCGCTAGT 60
CTCTACCAGC CGCCGCCGCC CACATTATCA ATGAGCATGC CGTATATGCC CAACTATCCA 120
GTCGATTGTC CGTCCTTCAA TGAATTCAAG AAAAGTGTAT ACACATTGAA CCAAGCTTTA 180
GCCAATATAA TTGCCGCTGC TAGAAGTGTC TACAACTACC ATACGTTATA CAAAAACCAG 240
CCTGGCCTCA ATATGGAAAT AAATGAAAAA AAAGAAATTT TCGATAAAGC TCTAAACTTC 300
TTTGAAAATA AGTTGCTTAA ATACCGCCAA GCGTTGATCA ACTACAAAGC GTTATTAGAG 360
TATAGTAACA ATTCTCCAGT CATAACAGTA GACGACGACA TTCCCATCGA TCGTGAATTA 420
TTGTAA 426
<210>2
<211>141
<212> PRT
<213>black peach aphid effect protein Mp1
<400>2
MTVKISVFAV VLIVTCVRAS LYQPPPPTLS MSMPYMPNYP VDCPSFNEFK KSVYTLNQAL 60
ANIIAAARSV YNYHTLYKNQ PGLNMEINEK KEIFDKALNF FENKLLKYRQ ALINYKALLE 120
YSNNSPVITV DDDIPIDREL L 141
<210>3
<211>27
<212> DNA
<213>artificial sequence
<400>3
GCGAATTCAT GAGTCTCTAC CAGCCGC 27
<210>4
<211>30
<212>DNA
<213>artificial sequence
<400>4
CGCTCGAGTT ACAATAATTC ACGATCGATG 30
Claims (6)
1. a kind of recombinant vector of black peach aphid effect protein Mp1 gene, which is characterized in that the preparation method of the recombinant vector is such as
Under: the RNA of black peach aphid is extracted, and reverse transcription goes out cDNA；Using cDNA as template amplification Mp1 gene；By Mp1 amplified production through BamHI
It after XhoI double digestion, is inserted into the pET-28a expression vector through same double digestion by DNA ligase, obtains recombination matter
Grain pET-28a-Mp1.
2. recombinant vector according to claim 2, which is characterized in that using cDNA as template, utilize following primer amplification Mp1
Gene, primer sequence are as follows:
Upstream primer: Mp1-F:GCGAATTCATGAGTCTCTACCAGCCGC underscore is BamHI restriction enzyme site；
Downstream primer: Mp1-R:CGCTCGAGTTACAATAATTCACGATCGATG underscore is XhoI restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
3. a kind of method for expressing black peach aphid effect protein Mp1 gene, which comprises the following steps:
(1) recombinant vector described in claim 1 or 1 converts Bacillus coli cells, obtains the recombined pronucleus expression of expression Mp1
Bacterial strain；
(2) by recombined pronucleus expression strain inoculated to kanamycins fluid nutrient medium or kanamycins+chloramphenicol fluid nutrient medium
In, it is incubated overnight activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to kanamycins fluid nutrient medium or kanamycins+chloromycetin solution again
The expression of IPTG induction recombination Mp1 is added in body culture medium, after shake culture；
(4) it after the completion of inducing, recycles and purifies expressed Mp1 recombinant protein.
4. it is according to claim 3 expression black peach aphid effect protein Mp1 gene method, which is characterized in that in step (3)
When shake culture is to OD600=0.5, the IPTG of final concentration of 0.8mM is added, in 37 DEG C of Fiber differentiations.
5. the method for expression black peach aphid effect protein Mp1 gene according to claim 3, which is characterized in that is mould for the card
Kanamycins is 50ug/mL in plain fluid nutrient medium.
6. the method for expression black peach aphid effect protein Mp1 gene according to claim 3, which is characterized in that is mould for the card
Kanamycins is 50ug/mL, chloramphenicol 50ug/mL in element+chloramphenicol fluid nutrient medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910358655.9A CN110093363A (en) | 2019-04-30 | 2019-04-30 | A kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910358655.9A CN110093363A (en) | 2019-04-30 | 2019-04-30 | A kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110093363A true CN110093363A (en) | 2019-08-06 |
Family
ID=67446565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910358655.9A Pending CN110093363A (en) | 2019-04-30 | 2019-04-30 | A kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110093363A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116732041A (en) * | 2023-05-23 | 2023-09-12 | 贵州大学 | Lethal gene and RNA interference sequence for preventing and controlling myzus persicae by RNA interference and preparation method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030207806A1 (en) * | 1993-05-18 | 2003-11-06 | Ensign Jerald C. | Insecticidal protein toxins from Photorhabdus |
| CN103436551A (en) * | 2013-08-09 | 2013-12-11 | 浙江工业大学 | Preparation method for paddy flowering hormone recombinant protein |
| CN104404010A (en) * | 2014-10-27 | 2015-03-11 | 西北工业大学 | Methicillin-resistant staphylococcus aureus (MRSA) PBP2a transpeptidase region prokaryotic expression and purification method |
-
2019
- 2019-04-30 CN CN201910358655.9A patent/CN110093363A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030207806A1 (en) * | 1993-05-18 | 2003-11-06 | Ensign Jerald C. | Insecticidal protein toxins from Photorhabdus |
| CN103436551A (en) * | 2013-08-09 | 2013-12-11 | 浙江工业大学 | Preparation method for paddy flowering hormone recombinant protein |
| CN104404010A (en) * | 2014-10-27 | 2015-03-11 | 西北工业大学 | Methicillin-resistant staphylococcus aureus (MRSA) PBP2a transpeptidase region prokaryotic expression and purification method |
Non-Patent Citations (7)
| Title |
|---|
| PATRICIA A. RODRIGUEZ等: "An Aphid Effector Targets Trafficking Protein VPS52 in a Host-Specific Manner to Promote Virulence", 《PLANT PHYSIOLOGY》 * |
| RODRIGUEZ,P.等: "Acyrthosiphon pisum Mp1-like effector mRNA, complete cds", 《GENBANK DATABASE》 * |
| RODRIGUEZ,P.等: "Myzus persicae Mp1 effector mRNA, complete cds", 《GENBANK DATABASE》 * |
| 孙佳斌等: "斜纹夜蛾信息素结合蛋白SlitPBP4的分子克隆、组织表达谱及结合特性分析", 《昆虫学报》 * |
| 张燕等: "豌豆蚜唾液蛋白家族的克隆及在不同发育阶段的表达", 《昆虫学报》 * |
| 李燕等主编: "《分子生物学使用实验技术》", 31 December 2011, 第四军医大学出版社 * |
| 魏原杰等: "棉蚜P450 CYP6CY3的克隆、原核表达及多克隆抗体的制备", 《中国农业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116732041A (en) * | 2023-05-23 | 2023-09-12 | 贵州大学 | Lethal gene and RNA interference sequence for preventing and controlling myzus persicae by RNA interference and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103718896B (en) | The method of Control pests | |
| CN104946668A (en) | cry1Ia gene and application thereof, Cry1Ia protein coded by cry1Ia gene, and preparation method and application thereof | |
| CN103718895A (en) | Method for controlling injurious insects | |
| CN103719136A (en) | Pest control method | |
| CN103719137A (en) | Pest control method | |
| CN102187874A (en) | Application of pathogenic gene related to xanthomonas campestris pathovar campestris | |
| CN110093363A (en) | A kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene | |
| BR102014003618A2 (en) | PEST CONTROL METHODS | |
| CN110042115A (en) | A kind of recombinant vector and expression of potato aphid effect protein Me23 gene | |
| CN110747199B (en) | Bee stress-resistance related gene NF-Y and application thereof | |
| CN110117606A (en) | A kind of recombinant vector and expression of Potato Aphid effect protein Me10 gene | |
| CN110117607A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene | |
| CN110423770A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein CMU1 gene | |
| CN103757049A (en) | Pest control constructor and method thereof | |
| BR102013018436B1 (en) | INSECTICIDE PROTEIN, INSECTICIDE GENE, EXPRESSION CASSETTE, RECOMBINANT VECTOR, TRANSGENIC MICRO-ORGANISM, AND METHODS FOR THE PRODUCTION OF INSECTICIDE PROTEINS, EXPANDING THE REACH OF TARGET INSECTS, PRODUCTION OF INSECT-RESISTANT PLANTS, PROTECTION OF PLANTS FROM DAMAGE CAUSED BY INSECT PESTS, AND CONTROL INSECT PESTS | |
| CN109971770A (en) | A kind of sorghum C2H2 zinc finger protein gene SbZFP36 and its recombinant vector and expression | |
| CN102465132B (en) | Application of WRKY polypeptide Glyma02g39870 in promotion of salicylic acid biosynthesis and enhancement of disease resistance of plants | |
| CN110093364A (en) | A kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene | |
| CN109912705A (en) | A kind of sorghum 14-3-3 Protein G F14c gene and its recombinant vector and expression | |
| CN109810986A (en) | A kind of sorghum 14-3-3 Protein G F14a gene and its recombinant vector and expression | |
| CN109943574A (en) | A kind of sorghum 14-3-3 Protein G F14b gene and its recombinant vector and expression | |
| CN109913471A (en) | A kind of sorghum transcription factor SbGRF4 gene and its recombinant vector and expression | |
| Zadrobílková et al. | Morphological and molecular diversity of the neglected genus Rhizomastix Alexeieff, 1911 (Amoebozoa: Archamoebae) with description of five new species | |
| CN109971767A (en) | A kind of sorghum transcription factor SbWRKY45 gene and its recombinant vector and expression | |
| CN104845913B (en) | Bacillus thuringiensis bacterial strain, combined protein and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190806 |
|
| RJ01 | Rejection of invention patent application after publication |