CN110093364A - A kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene - Google Patents
A kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene Download PDFInfo
- Publication number
- CN110093364A CN110093364A CN201910358858.8A CN201910358858A CN110093364A CN 110093364 A CN110093364 A CN 110093364A CN 201910358858 A CN201910358858 A CN 201910358858A CN 110093364 A CN110093364 A CN 110093364A
- Authority
- CN
- China
- Prior art keywords
- hggland59
- expression
- root
- gene
- knot nematode
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43536—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms
- C07K14/4354—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms from nematodes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Abstract
The invention discloses a kind of recombinant vectors of root-knot nematode effect protein HgGLAND59 gene, and invention additionally discloses a kind of expressions of root-knot nematode effect protein HgGLAND59 gene.The present invention constructs the prokaryotic expression carrier of root-knot nematode effect protein HgGLAND59 gene, and a series of optimization is carried out for protein expression condition, finally obtain HgGLAND59 soluble protein, as a result further research albumin crystal structure and biological characteristics lay the foundation, thinking is provided for the pesticide manufacturing of target for HgGLAND59 for design, and then provides foundation for prevention and treatment root-knot nematode.
Description
Technical field
The present invention relates to the recombinant vector and expression of a kind of root-knot nematode effect protein HgGLAND59 gene,
Belong to field of biotechnology.
Background technique
Root-knot nematode is a kind of omnivorousness plant pathogeny line insect of height specialized form.Root knot nematode disease mainly causes harm Soybean Root
Point, the stimulation of beans root nematode, diseased plant is short and small, yellowing leaf, and plant is wilted withered when serious, and field is yellow yellowish green green in flakes, irregular
It is uneven.Pulling up diseased plant can be seen that root system is undeveloped, and root nodule is scattered.The little particle of the visible white in root or yellow-white, i.e. nematode
Cyst, later period cyst color deepens, and is brown.The cyst main foundation that disease diagnoses thus on root.
Severity whether generation with prevalence of entomophila disease, depends on virus-Insect-Plant three's interaction.
In plant and plant-feed insect defence with the anti-game defendd, when plant experiences the signal of plant-feed insect, energy is rapidly
The relevant immune signal transduction of plant-feed insect molecular pattern is activated, the transcriptional expression of numerous resistance related genes is then regulated and controled,
The synthesis of defensive substance is mediated, to improve the resilience of plants against insects infringement.In order to which the resistance for coping with plant is immune, plant
Feeding habits insect can secrete the saliva effector of specificity to inhibit the immune activation of plant, to inhibit to plant during feeding
The expression of object defensin gene and the synthesis of resisting substance, so guarantee insect on host plant normal feeding, grow with it is numerous
Spread out.In recent years, the report for constantly thering is insect effect protein gene to be cloned, such as Bemisia tabaci, root-knot nematode, cereal crop spore
Effect protein gene in capsule nematode etc. has also successively been cloned by separation.
The prokaryotic expression of gene is one of the common technology for studying gene function.Large intestine is usually present when albumen pronucleus expression
Since rare codon causes expression to limit in bacillus, inclusion body is formed；It can inhibit albumen when the stronger protein expression of toxicity
Expression causes expression yield too low；Another easy the problem of ignoring, which is that reproducibility is excessively high in Escherichia coli, will lead to two sulphur
Key cannot be properly formed, and cause expression product insoluble.For above-mentioned problem, it is common practice to after dissolving inclusion body with urea
It is purified in the case of a degenerated, then renaturation.But the method complex steps, success rate are low.Root-knot nematode is imitated at present
Answer albumen HgGLAND59 gene to have been found, but how it to be expressed with soluble form be still this field problem.This
Invention is by selecting different bacterium bacterial strains, being screened using the concentration of different inducing temperatures and inducer IPTG
The condition of HgGLAND59 solubility expression of protein lays the foundation for researchs such as gene function, protein crystals.
Summary of the invention
In view of the deficiencies of the prior art, the object of the present invention is to provide a kind of root-knot nematode effect proteins
The recombinant vector and expression of HgGLAND59 gene.
The technical scheme is that a kind of recombinant vector of root-knot nematode effect protein HgGLAND59 gene, institute
State recombinant vector the preparation method is as follows: extracts the RNA of root-knot nematode, and reverse transcription goes out cDNA；Expand by template of cDNA
Increase HgGLAND59 gene；By HgGLAND59 amplified production after BamHI and XhoI double digestion, it is inserted by DNA ligase
In pET-28a expression vector through same double digestion, recombinant plasmid pET-28a-HgGLAND59 is obtained.
Preferably, using cDNA as template, using following primer amplification HgGLAND59 gene, primer sequence is as follows:
Upstream primer: HgGLAND59-F:GCGAATTCATGGCGATTTTCTGCGACTGT underscore is BamHI digestion position
Point；
Downstream primer: HgGLAND59-R:CGCTCGAGTCATTTCCGTCCAAGGTCAGT underscore is XhoI digestion position
Point；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
It is including following the present invention also provides a kind of method for expressing root-knot nematode effect protein HgGLAND59 gene
Step:
(1) Bacillus coli cells are converted with recombinant vector of any of claims 1 or 2, obtains expression HgGLAND59's
Recombined pronucleus expression bacterial strain；
(2) recombined pronucleus expression strain inoculated to kanamycins fluid nutrient medium or kanamycins+chloramphenicol liquid are trained
It supports in base, is incubated overnight activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to kanamycins fluid nutrient medium again or kanamycins+chlorine is mould
The expression of IPTG induction recombination HgGLAND59 is added in plain fluid nutrient medium, after shake culture；
(4) it after the completion of inducing, recycles and purifies expressed HgGLAND59 recombinant protein.
Preferably, when earthquake culture is to OD600=0.5 in step (3), the IPTG of final concentration of 0.6mM is added,
30 DEG C of Fiber differentiations.
Preferably, kanamycins is 50ug/mL in the kanamycins fluid nutrient medium.
Preferably, kanamycins is 50ug/mL, chloramphenicol 50ug/ in the kanamycins+chloramphenicol fluid nutrient medium
mL。
The beneficial effects of the present invention are: the present invention is to obtain HgGLAND59 soluble protein, root-knot nematode is constructed
The prokaryotic expression carrier of effect protein HgGLAND59 gene, and a series of optimization, discovery are carried out for protein expression condition
When inducing temperature is 30 DEG C, expression quantity is best；With the increase of IPTG concentration, expressing quantity is gradually increased, and is most preferably lured
Leading concentration is 0.6mM；At 30 DEG C, when IPTG concentration is 0.6, expression quantity is best.Through SDS-PAGE electrophoresis detection, divided
The purpose band that son amount is about 27kDa finally obtains HgGLAND59 soluble protein for the expected size of HgGLAND59 albumen.
Meanwhile the present invention purifies it with protein purification system, as a result further research albumin crystal structure and biology
Characteristic lays the foundation, and provides thinking for HgGLAND59 for design for the pesticide manufacturing of target, and then be prevention and treatment Soybean Root tie lines
Worm provides foundation.
Detailed description of the invention
Fig. 1 is pET-28a Vector map；
Fig. 2 is digestion result schematic diagram, and 1 is the Plasmid DNA of digestion, and 2 be the digestion of BamHI and XhoI inscribe as a result, M is
DNA Marker；
Fig. 3 is the albumen peak figure that HgGLAND59 albumen is obtained by the purifying of AKTA protein purification system and desalination；
Fig. 4 is the electrophoresis result figure after HgGLAND59 protein purification；
Fig. 5 is the result figure that SDS-PAGE electrophoresis tests optimum expression bacterial strain；
Fig. 6 is the result figure that SDS-PAGE electrophoresis tests best IPTG induced concentration；
Fig. 7 is the result figure that SDS-PAGE electrophoresis tests best inducing temperature；
Fig. 8 is western blot detection figure.
Specific embodiment
With reference to the accompanying drawing and invention is described further in specific embodiment:
Embodiment 1: the building and identification of root-knot nematode effect protein HgGLAND59 gene recombined vector
1, root-knot nematode RNA is extracted, and reverse transcription goes out cDNA
Root-knot nematode material is taken, is extracted using RNA extracts kit (TIANGEN Biotech (Beijing) Co., Ltd.)
Seedling stage total serum IgE obtains cDNA with reverse transcription reagent box (Promega) reverse transcription.
2, using cDNA as template amplification HgGLAND59 gene；
Design primer expands HgGLAND59 gene using cDNA as template, the nucleotides sequence of HgGLAND59 gene
The amino acid sequence for the protein that column are encoded as shown in SEQ ID NO.1, as HgGLAND59 gene is as shown in SEQ ID NO.2.
Primer is as follows:
Upstream primer: HgGLAND59-F:GCGAATTCATGGCGATTTTCTGCGACTGT underscore is BamHI digestion position
Point；
Downstream primer: HgGLAND59-R:CGCTCGAGTCATTTCCGTCCAAGGTCAGT underscore is XhoI digestion position
Point；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
PCR amplification system used in gene magnification for vector construction is as follows: 5 × buffer 10 μ L, FastPfu
4 μ L, cDNA template of Fly DNA Polymerase 1 μ L (Quan Shijin), 2.5mmol dNTPs, 0.5 μ L, 10 μm of ol upstream and downstream
Primer each 1 μ L, ddH2O 32.5μL。
The following are PCR amplification conditions: 95 DEG C of 2min, 35 circulation (95 DEG C of 20s, 58 DEG C of 20s, 72 DEG C of 30s-1min, 72
℃5min。
3, HgGLAND59 gene recombined vector is constructed
After PCR product is purified, it is connected to pET-28a carrier.PCR product is detected using 1% agarose.PCR
Product is recycled with reference to Nanjing Vazyme Biotechnology Co., Ltd.'s Ago-Gel QIAquick Gel Extraction Kit specification.It is after the recovery
Product is inserted into the pET-28a expression vector through same double digestion after BamHI and XhoI double digestion by DNA ligase
(expression vector map is as shown in Figure 1), 16 DEG C connect 16 hours, construct pET-28a-HgGLAND59 recombinant plasmid.
By recombinant plasmid transformed to coli strain DH5a, trained on 50ug/mL kanamycins solid plate in 37 DEG C
It supports, picking individual colonies hold up the limited public affairs of section's biotechnology after digestion identification is correct (digestion result is as shown in Figure 2), then through Beijing
Take charge of its correct sequence of sequence verification.Sequencing result show HgGLAND59 coding sequence obtained with it is expected that phase
Symbol illustrates construction of recombinant plasmid success and is named as pET-28a-HgGLAND59, i.e. recombinant vector.
The inducing expression of embodiment 2:HgGLAND59 albumen
1, the recombined pronucleus expression bacterial strain of HgGLAND59 is obtained
It selects and successful monoclonal is sequenced in embodiment 1 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-
HgGLAND59 recombinant expression carrier extracts, and recombinant expression carrier is taken to convert e. coli bl21 (DE3), Rosetta
(DE3), JM109 (DE3), BL21 (DE3) pLysS bacterial strain detect the expression of HgGLAND59 albumen.
2, activated strains are incubated overnight
It is incubated overnight and activates above-mentioned recombined pronucleus expression bacterial strain.For example, BL21 (DE3), JM109 (DE3) bacterial strain are turned
It is connected in 50ug/mL kanamycins fluid nutrient medium, Rosetta (DE3), BL21 (DE3) pLysS bacterial strain is transferred to 50ug/
In mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.
3, inducing expression
The recombined pronucleus expression bacterial strain of activation is transferred in the fluid nutrient medium containing corresponding antibiotic, for example, will activation
BL21 (DE3), JM109 (DE3) bacterial strain be transferred in 50ug/mL kanamycins fluid nutrient medium, by Rosetta (DE3),
BL21 (DE3) pLysS bacterial strain is transferred in 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C of concussion trainings
When supporting to OD600=0.5, the IPTG of final concentration of 0.6mM is added, 25 DEG C Fiber differentiation 10 hours, obtain HgGLAND59
Recombinant protein.
4, the purifying of HgGLAND59 recombinant protein
After the completion of induction, recycle and purify expressed HgGLAND59 recombinant protein, using AKTA protein purification system into
Row purifying and desalination, it is preferable that protein purification is carried out using AKTA purifier10 fast protein purification system, steps are as follows:
Since pET28a has 6 His coded sequences before terminator, so pET28a-HgGLAND59 is recombinantly expressed
The albumen that carrier obtains can use Ni-NTA and carry out affinitive layer purification.Affinity chromatography be with protein or large biological molecule and
It is incorporated on medium based on the special affinity between aglucon, because being connected to one in the matrix of chromatography gel used in His-tags
A NTA [(nitrilotriacetic acid) nitrilotriacetic acid], can be with Ni ions binding, and Ni ion and fusion protein
6 × His amino acid between generate attraction, thus will with His-tags histidine tag fusion protein and other albumen
It distinguishes, five yuan of imidazole rings of histidine residues are the key that albumen and Ni ionization, therefore when we use high concentration
Imidazoles (Imidazole) solution elution when marquis (such as 400mM), imidazoles convenient for protein His-tags imidazole ring compete knot
It closes, finally elutes fusion protein from gel.
Concrete operations: taking out the thallus of -80 DEG C of preservations, and Lysis buffer is added and is resuspended, the bacterium solution after resuspension is in ice bath
Middle carry out ultrasonic disruption, power 350W, duty ratio 50%, each circulation 30s, total time 35min.It is broken even
Slurry, 4 DEG C, 1,2000rpm centrifugation 30min.Supernatant is adsorbed on Ni-NTA adsorption column with peristaltic pump, 5mL/min, repeats one
It is secondary, retain 20 μ L by the sample of adsorption column and carries out protein adhesive electrophoresis；Ni-NTA adsorption column is connected to fast protein purifying system
On system, eluted；Albumen is collected according to UV absorption curve, and samples and carries out protein adhesive electrophoresis detection.
Fig. 3 is AKTA protein purification system purifying protein peak figure.HgGLAND59 albumen passes through AKTA protein purification system
Purify obtained albumen peak figure.
Fig. 4 is the electrophoretogram after HgGLAND59 protein purification.It is the expression and purification at 30 DEG C, IPTG concentration 0.6mM
HgGLAND59 albumen result.1 is Supernatant samples after cell ultrasonication；2 be the sample affine by Ni column；3 be empty carrier
Control；M is albumen marker；Arrow meaning is shown as HgGLAND59 albumen.Fig. 4 shows that HgGLAND59 albumen is more under this condition
It has appeared in supernatant, has been solubility expression, the HgGLAND59 albumen obtained after purification by AKTA protein purification system is pure
Degree reaches requirement, can be used for subsequent experimental.
The verifying of the protein induced expression condition of embodiment 3:HgGLAND59
1, the recombinant strains of HgGLAND59 are obtained
It selects and successful monoclonal is sequenced in embodiment 1 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-
HgGLAND59 recombinant expression carrier extracts, and recombinant expression carrier is taken to convert e. coli bl21 (DE3), Rosetta respectively
(DE3), JM109 (DE3), BL21 (DE3) pLysS bacterial strain, are coated on kanamycins containing 50ug/mL (Rosetta (DE3), BL21
(DE3) pLysS bacterial strain need to add 50ug/mL chloramphenicol) it is incubated overnight in 37 DEG C on plate, picking single colonie is inoculated into
50ug/mL kanamycins (Rosetta (DE3), BL21 (DE3) pLysS bacterial strain need to add 50ug/mL chloramphenicol) Liquid Culture
In base, 37 DEG C, 200rpm be incubated overnight, in bacterium solution be added sterilizing 50% glycerol, frozen after mixing in -80 DEG C of refrigerators, obtained
Express the prokaryotic expression bacterial strain of HgGLAND59.
2, the determination of HgGLAND59 Primary structure bacterial strain
It is inoculated with above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3), Rosetta (DE3), JM109 (DE3), BL21 respectively
(DE3) (Rosetta (DE3), that BL21 (DE3) pLysS bacterial strain need to add 50ug/mL chlorine to pLysS to 50ug/mL kanamycins is mould
Element) in fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to
50ug/mL kanamycins (Rosetta (DE3), BL21 (DE3) pLysS bacterial strain need to add 50ug/mL chloramphenicol) Liquid Culture
In base, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 1mM is added, 25 DEG C Fiber differentiation 10 hours.
4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min collects thallus, bacterial precipitation and negative control with 2mL and PBS is pre-chilled
Buffer (with preceding addition 1mM PMSF) suspends, and carries out clasmatosis with Ultrasonic Cell Disruptor, each 10sec, and totally 10 times, between each
Every 30sec；1,2000rpm centrifugation 10min, takes supernatant, and SDS-PAGE electrophoresis detection tests optimum expression bacterial strain, as a result as schemed
Shown in 5, HgGLAND59 can in BL21 (DE3), Rosetta (DE3), JM109 (DE3), BL21 (DE3) pLysS bacterial strain table
It reaches, wherein the expression quantity highest in BL21 (DE3) bacterial strain.
3, the determination of the best IPTG concentration of HgGLAND59 Primary structure
Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37
DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to 50ug/mL kanamycins liquid
In culture medium, when 37 DEG C of shake cultures are to OD600=0.5, be separately added into final concentration of 0.2,0.4,0.6,0.8,1.0,1.2,
The IPTG of 1.4mM, 30 DEG C Fiber differentiation 8 hours (bacterium not induced is taken to make negative control).4 DEG C after the completion of induction, 1,
2000rpm is centrifuged 2min, collects thallus, bacterial precipitation and negative control 2mL and PBS buffer is pre-chilled (with preceding addition 1mM
PMSF it) suspends, carries out clasmatosis with Ultrasonic Cell Disruptor, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm from
Heart 10min, takes supernatant, and SDS-PAGE electrophoresis detection tests best IPTG induced concentration, as a result as shown in Fig. 5, best IPTG
Induced concentration is 0.6mM.
4, the determination of HgGLAND59 Primary structure optimum temperature
Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37
DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to 50ug/mL kanamycins liquid
In culture medium, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 1mM is added, respectively 16,20,25,30
Fiber differentiation 8-16 hours (pET-28a bacterium is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min is collected
Thallus, bacterial precipitation and negative control 2mL are pre-chilled PBS buffer (with preceding addition 1mM PMSF) and suspend, and use ultrasonication
Instrument progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes supernatant, SDS-
PAGE electrophoresis detection tests best inducing temperature, as a result as shown in fig. 7, best inducing temperature is 30 DEG C.
The western blot of embodiment 4:HgGLAND59 recombinant protein is detected
(1) it extracts by HgGLAND59 albumen after purification:
1. cultivating the E. coli expression strains containing pET-28a-HgGLAND59 plasmid, IPTG inducing expression；
2. protein lysate (50mM Tris pH 8.0,120mM NaCl, 1mM DTT, 0.5%NP-40, before is added
1mM PMSF, 1mM DTT is added), after ultrasonic disruption cell, supernatant is collected by centrifugation, places 20min on ice；
3.15,000g, 4 DEG C of centrifugation 5min abandon precipitating；
4. taking 200 μ L supernatants that 5 × Loading Buffer is added, concussion is mixed, and -80 DEG C of remaining sample freeze；
5. boiling water boiling 5min, ice bath, 12,000rpm centrifugation 5min draw 15 μ L of supernatant and carry out protein electrophoresis, remaining sample
- 20 DEG C of product freeze；
6. prepare SDS-PAGE glue, first carry out electrophoresis 20min with 90V, when sample enters separation gel, with 150V voltage into
Row electrophoresis, until bromophenol blue stops electrophoresis when running out of separation gel.
(2) transferring film
Cut with a paper cutter out the pvdf membrane more somewhat larger than glue (for pvdf membrane, first with methanol impregnate 30 seconds, then
ddH23-5min is impregnated in O, is then placed in transferring film buffer) rubber plate clamp is put into electrophoretic blotting groove.Transferring film buffer is poured into,
4 DEG C, 100V 90min.
(3) it closes
After the completion of transferring film, pvdf membrane is taken out, is put in the PBST solution with 5% skimmed milk power, 2h is closed on shaking table.
(4) primary antibody is incubated for
Confining liquid is discarded, is added Anti His antibody (1:5000), shaking table is incubated for 12h.
(5) secondary antibody is incubated for
Primary antibody is outwelled, washs pvdf membrane 3 times with 1 × PBST, each 5min；Corresponding secondary antibody (sheep anti-Mouse) is added, shakes
Bed is incubated for 1h.
(6) ECL exposes
Secondary antibody is abandoned, washs pvdf membrane 3 times with 1 × PBST, each 5min；HRP chemiluminescent substrate is added on pvdf membrane
Liquid can detect protein expression signal (as shown in Figure 8) on 5200 chemiluminescence detectors in day, and succeed table as can be seen from the results
Up to HgGLAND59 albumen out.
SEQUENCE LISTING
Sequence table
<110>Guizhou University
<120>a kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene
<160> 4
<210>1
<211>546
<212>DNA
<213>root-knot nematode effect protein HgGLAND59
<400>1
ATGGCCATTC TGCTGAAGTG TGTGCTGCTC CTCCCAATCA TGGCGATTTT CTGCGACTGT 60
ATGGACCCCG GCAAAAAAGG AAAGAGCAAA GATCCGATCC CAATCCCGAA ACAGGAAGGC 120
TCAGATCCGA TCCCAATCCC GAAACAGGAA GGAAAGCCGA GCAGCAGTGC AGCGAATAGC 180
CCGACAGTAA CAAAAGGCAC TCCGAAACGT GGCGAACTTG ATACTCCCGA ATTTTACAAA 240
AAGAGCCCAA AGAACAAGGT GAATGGAATT AATAGCCCGA GAAAGCCCAA CAACGGCTCT 300
CCGAGAAAGG ATAAAAAAGC TCTACAAAAG GAACGTCAAG AAGAAAGAAA GCAAAAAGAA 360
AGAGAAAGAG AAAACCGTTT CCTGCGAACG AAATCAACAG CAGGTAATAC GACTGACGCG 420
ACTGACGTGG AAACCGAAAG CGAAGTGATT CCGACATTTG TTGCCGAACT CGAAGATTCT 480
ACGGTGGAAT ATCCAACAGA CATTGAATGT CATGTTGCAA CAAAAACTGA CCTTGGACGG 540
AAATGA 546
<210>2
<211>181
<212> PRT
<213>root-knot nematode effect protein HgGLAND59
<400>2
MAILLKCVLL LPIMAIFCDC MDPGKKGKSK DPIPIPKQEG SDPIPIPKQE GKPSSSAANS 60
PTVTKGTPKR GELDTPEFYK KSPKNKVNGI NSPRKPNNGS PRKDKKALQK ERQEERKQKE 120
RERENRFLRT KSTAGNTTDA TDVETESEVI PTFVAELEDS TVEYPTDIEC HVATKTDLGR 180
K 181
<210>3
<211>29
<212>DNA
<213>artificial sequence
<400>3
GCGAATTCAT GGCGATTTTC TGCGACTGT 29
<210>4
<211>29
<212> DNA
<213>artificial sequence
<400>4
CGCTCGAGTC ATTTCCGTCC AAGGTCAGT 29
Claims (6)
1. a kind of recombinant vector of root-knot nematode effect protein HgGLAND59 gene, which is characterized in that the recombinant vector
The preparation method is as follows: extracting the RNA of root-knot nematode, and reverse transcription goes out cDNA；Using cDNA as template amplification HgGLAND59
Gene；By HgGLAND59 amplified production after BamHI and XhoI double digestion, it is inserted by DNA ligase through same double digestion
PET-28a expression vector in, obtain recombinant plasmid pET-28a-HgGLAND59.
2. recombinant vector according to claim 2, which is characterized in that using cDNA as template, utilize following primer amplification
HgGLAND59 gene, primer sequence are as follows:
Upstream primer: HgGLAND59-F:GCGAATTCATGGCGATTTTCTGCGACTGT underscore is BamHI restriction enzyme site；
Downstream primer: HgGLAND59-R:CGCTCGAGTCATTTCCGTCCAAGGTCAGT underscore is XhoI restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
3. a kind of method for expressing root-knot nematode effect protein HgGLAND59 gene, which is characterized in that including following step
It is rapid:
(1) Bacillus coli cells are converted with recombinant vector of any of claims 1 or 2, the recombination for obtaining expression HgGLAND59 is former
Nuclear expression bacterial strain；
(2) by recombined pronucleus expression strain inoculated to kanamycins fluid nutrient medium or kanamycins+chloramphenicol fluid nutrient medium
In, it is incubated overnight activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to kanamycins fluid nutrient medium or kanamycins+chloromycetin solution again
The expression of IPTG induction recombination HgGLAND59 is added in body culture medium, after shake culture；
(4) it after the completion of inducing, recycles and purifies expressed HgGLAND59 recombinant protein.
4. the method for expression root-knot nematode effect protein HgGLAND59 gene according to claim 3, feature exist
In the IPTG of final concentration of 0.6mM being added, in 30 DEG C of Fiber differentiations when earthquake culture is to OD600=0.5 in step (3).
5. the method for expression root-knot nematode effect protein HgGLAND59 gene according to claim 3, feature exist
In kanamycins is 50ug/mL in the kanamycins fluid nutrient medium.
6. the method for expression root-knot nematode effect protein HgGLAND59 gene according to claim 3, feature exist
In kanamycins is 50ug/mL, chloramphenicol 50ug/mL in the kanamycins+chloramphenicol fluid nutrient medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910358858.8A CN110093364A (en) | 2019-04-30 | 2019-04-30 | A kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910358858.8A CN110093364A (en) | 2019-04-30 | 2019-04-30 | A kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110093364A true CN110093364A (en) | 2019-08-06 |
Family
ID=67446471
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910358858.8A Pending CN110093364A (en) | 2019-04-30 | 2019-04-30 | A kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110093364A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9524395D0 (en) * | 1995-11-29 | 1996-01-31 | Nickerson Biocem Ltd | Promoters |
| US20080184391A1 (en) * | 2007-01-29 | 2008-07-31 | Kuppuswamy Subramaniam | Pathogen resistant transgenic plants, associated nucleic acids and techniques involving the same |
| WO2012094529A2 (en) * | 2011-01-05 | 2012-07-12 | The Curators Of The University Of Missouri | Genes implicated in resistance to soybean cyst nematode infection and methods of their use |
| WO2014165227A2 (en) * | 2013-03-13 | 2014-10-09 | Pioneer Hi-Bred International, Inc. | Methods and compositions for plant pest control |
| US20150259700A1 (en) * | 2014-03-06 | 2015-09-17 | Washington State University | Transgenic Plants With RNA Interference-Mediated Resistance Against Root-Knot Nematodes |
| CN108739348A (en) * | 2018-04-19 | 2018-11-06 | 贵州大学 | A kind of method of quick discriminating transgenic positive strain |
-
2019
- 2019-04-30 CN CN201910358858.8A patent/CN110093364A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9524395D0 (en) * | 1995-11-29 | 1996-01-31 | Nickerson Biocem Ltd | Promoters |
| US20080184391A1 (en) * | 2007-01-29 | 2008-07-31 | Kuppuswamy Subramaniam | Pathogen resistant transgenic plants, associated nucleic acids and techniques involving the same |
| WO2012094529A2 (en) * | 2011-01-05 | 2012-07-12 | The Curators Of The University Of Missouri | Genes implicated in resistance to soybean cyst nematode infection and methods of their use |
| WO2014165227A2 (en) * | 2013-03-13 | 2014-10-09 | Pioneer Hi-Bred International, Inc. | Methods and compositions for plant pest control |
| US20150259700A1 (en) * | 2014-03-06 | 2015-09-17 | Washington State University | Transgenic Plants With RNA Interference-Mediated Resistance Against Root-Knot Nematodes |
| CN108739348A (en) * | 2018-04-19 | 2018-11-06 | 贵州大学 | A kind of method of quick discriminating transgenic positive strain |
Non-Patent Citations (8)
| Title |
|---|
| JASON B. NOON等: "A Plasmodium-like virulence effector of the soybean cyst nematode suppresses plant innate immunity", 《NEW PHYTOLOGIST》 * |
| NOON,J.B.等: "GLAND18-3-2 [Heterodera glycines]", 《GENBANK DATABASE》 * |
| NOON,J.B.等: "Heterodera glycines GLAND18-3-2 mRNA, complete cds", 《GENBANK DATABASE》 * |
| 中国农业科学院植物保护研究所主编: "《中国农作物病虫害上》", 31 December 1979, 中国农业出版社 * |
| 姚珂等: "植物寄生线虫效应蛋白调控寄主防卫反应分子机制研究进展", 《植物病理学报》 * |
| 张瀛东等: "大豆孢囊线虫扩展蛋白新基因(Hg-exp-1、Hg-exp-2)的鉴定及功能分析", 《中国农业科学》 * |
| 扈丽丽: "植物寄生线虫效应蛋白功能分析方法和研究进展", 《中国生物工程杂志》 * |
| 田生礼主编: "《分子生物学实验指导》", 30 April 2014, 华南理工大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103718896B (en) | The method of Control pests | |
| CN103718895A (en) | Method for controlling injurious insects | |
| CN107254473A (en) | The insecticidal peptide and application of killing gene PPTX-15 and its coding | |
| CN104711265B (en) | A kind of green plant bug vitellogenin, its specific peptide chain, carrier, bacterial strain and application | |
| BR102014003618A2 (en) | PEST CONTROL METHODS | |
| CN110042115A (en) | A kind of recombinant vector and expression of potato aphid effect protein Me23 gene | |
| CN110117606A (en) | A kind of recombinant vector and expression of Potato Aphid effect protein Me10 gene | |
| CN103757049B (en) | Control structure body and the method thereof of insect | |
| CN110093363A (en) | A kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene | |
| CN107488665A (en) | The insecticidal peptide and application of killing gene PPTX-3a and its coding | |
| CN110117607A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene | |
| CN110423770A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein CMU1 gene | |
| CN110093364A (en) | A kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene | |
| CN109971770A (en) | A kind of sorghum C2H2 zinc finger protein gene SbZFP36 and its recombinant vector and expression | |
| CN109913478A (en) | A kind of sorghum E3 ubiquitin ligase SbBAG4 gene and its recombinant vector and expression | |
| CN109536522A (en) | A kind of preparation and application of the prokaryotic expression, polyclonal antibody of southern rice black-streaked dwarf virus P6 albumen | |
| CN109912705A (en) | A kind of sorghum 14-3-3 Protein G F14c gene and its recombinant vector and expression | |
| CN109913471A (en) | A kind of sorghum transcription factor SbGRF4 gene and its recombinant vector and expression | |
| CN109943574A (en) | A kind of sorghum 14-3-3 Protein G F14b gene and its recombinant vector and expression | |
| CN109810986A (en) | A kind of sorghum 14-3-3 Protein G F14a gene and its recombinant vector and expression | |
| CN109971767A (en) | A kind of sorghum transcription factor SbWRKY45 gene and its recombinant vector and expression | |
| CN110042116A (en) | A kind of recombinant vector and expression of rice blast fungus biological clock control gene M oCCG4 | |
| CN110117604A (en) | A kind of recombinant vector and expression of tea tree heat shock protein CssHSP-6 gene | |
| CN108913697B (en) | Pseudoleopard pardalus B family insecticidal gene, coded mature peptide thereof and application | |
| CN109971769A (en) | A kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190806 |