CN109810986A - A kind of sorghum 14-3-3 Protein G F14a gene and its recombinant vector and expression - Google Patents

Abstract

The invention discloses a kind of sorghum 14-3-3 Protein G F14a genes, and nucleotide sequence is as shown in SEQ ID NO.1.Invention additionally discloses a kind of protein of sorghum 14-3-3 Protein G F14a gene coding, and amino acid sequence is as shown in SEQ ID NO.2.The invention also discloses recombinant vectors and expression comprising above-mentioned sorghum 14-3-3 Protein G F14a gene.The present invention passes through the protein sequence of corn GF14a gene, sorghum homologous gene GF14a is obtained from sorghum genome database, full length gene 780bp, and according to the gene constructed prokaryotic expression carrier, it is purified with protein purification system, as a result further research albumin crystal structure and biological characteristics lay the foundation, and then foundation is provided for the resistance for improving sorghum by gene editing method.

Description

A kind of sorghum 14-3-3 Protein G F14a gene and its recombinant vector and expression

Technical field

The present invention relates to a kind of sorghum 14-3-3 Protein G F14a gene and its recombinant vector and expressions, belong to biology Technical field.

Background technique

Sorghum (Sorghum bicolor (L.) Moench) also known as reed broomcorn millet, sorgo are a kind of important cereal crops, With stronger degeneration-resistant border ability and feed, wine brewing, the important source material for producing bio-fuel, papermaking and industrial starch, together When be also a kind of herding forage crops widely used in recent years.Cultivation history of the sorghum in China is long, before foundation Not large-scale planting, until 1970s, with the development of economy and society, China just gradually payes attention to and scale is planted Train sorghum.Sorghum belongs to short-day C4 plant, and compared to other energy crops, sorghum has more obvious photosynthetic efficiency And therefore higher yield heterosis is known as " high energy crop ".In recent years, as global environmental problem and the energy are endangered Machine is got worse, and people constantly seek a kind of safe and pollution-free, efficient biomass energy again.Wherein sorghum is as one The good energy-source plant of kind causes the attention and research of scientific circles.In order to more further investigate sorghum, U.S. Department of Energy biology and Environmental Research Center was smoothly sequenced and was assembled to sorghum genome in 2009, this indicate the research work to sorghum into Enter gene level, while also providing convenience for the clone of sorghum important gene and functional analysis.

14-3-3 albumen is found in brain tissue earliest, is considered unique related to neuronal tissue, and name comes from pair Starch gel mobility and the isolated component number of brain total protein.Currently, the study found that 14-3-3 albumen is prevalent in It is highly conserved eukaryotic protein in all types of eukaryocytes, can be in conjunction with target protein, in most cases, this Kind, which combines, needs to occur phosphorylation modification, and then the activity, stability, subcellular localization and the participation that adjust them form albumen Compound.In plant growth and development process, 14-3-3 albumen participates in various plants by the interaction with other albumen and swashs The regulation processes such as plain signal transduction, various metabolic regulations, matter transportation and optical signal response.In arabidopsis, tobacco and barley etc. 14-3-3 protein gene is had been found that in many plants.But so far, both at home and abroad there is not yet 14-3-3 protein gene is in sorghum Research report.

Summary of the invention

In view of the deficiencies of the prior art, the object of the present invention is to provide a kind of sorghum 14-3-3 Protein G F14a gene and its Recombinant vector and expression.

The technical scheme is that a kind of sorghum 14-3-3 Protein G F14a gene, nucleotide sequence such as SEQ ID Shown in NO.1.

The present invention also provides the protein of sorghum 14-3-3 Protein G F14a gene coding, amino acid sequence such as SEQ Shown in ID NO.2.

Correspondingly, the present invention provides recombinant vector and expression comprising above-mentioned sorghum 14-3-3 Protein G F14a gene.

Specifically, the recombinant vector the preparation method is as follows: extracting sorghum RNA, and reverse transcription goes out cDNA；It is with cDNA Template amplification GF14a gene；By GF14a amplified production after BamHI and XhoI double digestion, by DNA ligase be inserted into through In the pET-28a expression vector of same double digestion, recombinant plasmid pET-28a-GF14a is obtained.

Preferably, using cDNA as template, using following primer amplification GF14a gene, primer sequence is as follows:

Upstream primer: GF14a-F:GCGAATTCATGGCCGCCGCCGCC underscore is BamHI restriction enzyme site；

Downstream primer: GF14a-R:CGCTCGAGCTACTCATCATCAGGCTTGCTTG underscore is XhoI restriction enzyme site；

Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.

Specifically, the method for sorghum 14-3-3 Protein G F14a gene is expressed, comprising the following steps:

(1) Bacillus coli cells are converted with the recombinant vector, obtains the recombined pronucleus expression bacterial strain of expression GF14a；

(2) it by recombined pronucleus expression strain inoculated to kanamycins or kanamycins+chloramphenicol fluid nutrient medium, stays overnight Cultivate activated strains；

(3) the recombined pronucleus expression bacterial strain of activation is transferred to kanamycins or kanamycins+chloramphenicol fluid nutrient medium In, the expression of IPTG induction recombination GF14a is added after shake culture；

(4) it after the completion of inducing, recycles and purifies expressed GF14a recombinant protein.

Preferably, when earthquake culture is to OD600=0.5 in step (3), the IPTG of final concentration of 0.8mM is added, 25 DEG C Fiber differentiation.

Kanamycins is 50ug/mL in the kanamycins fluid nutrient medium.

Kanamycins is 50ug/mL, chloramphenicol 50ug/mL in the kanamycins+chloramphenicol fluid nutrient medium

The beneficial effects of the present invention are: for fewer to the gene studies in sorghum at present, especially 14-3-3 albumen GF14a gene does not have relevant report, and the present invention passes through the protein sequence of corn GF14a gene, from sorghum genome database Obtain sorghum homologous gene GF14a, gene C DS overall length 780bp, according to the amino acid sequence that the gene is derived, in NCBI The GF14a gene in other species is downloaded in database, unrooted chadogram is constructed with adjacent method, the results showed that its amino acid sequence Gathering with corn GF14a is one, and affiliation is closer, illustrates that GF14a gene is sorghum 14-3-3 protein gene.

The prokaryotic expression of gene is one of the common technology for studying gene function, but in prokaryotic expression, albumen usually with The form of inclusion body is present in precipitating, and how to allow albumen is face in prokaryotic expression with soluble form expression in cell conditioned medium The technical problem faced.In addition, the present invention is to obtain GF14a soluble protein, sorghum 14-3-3 Protein G F14a gene is constructed Prokaryotic expression carrier, and carry out a series of optimization for protein expression condition, discovery GF14a can at BL21 (DE3), It is expressed in this 4 bacterial strains of JM109 (DE3), Tuner (DE3), NovaBlue (DE3), wherein expression quantity is most in BL21 (DE3) It is more；When inducing temperature is 25 DEG C, expression quantity is best；With the increase of IPTG concentration, expressing quantity is gradually increased, most preferably Induced concentration is 0.8mM；At 25 DEG C, when IPTG concentration is 0.8mM, expression quantity is best.Through SDS-PAGE electrophoresis detection, obtain The purpose band that molecular weight is about 35kDa finally obtains GF14a soluble protein for the expected size of GF14a albumen.Meanwhile this Invention purifies it with protein purification system, as a result further research albumin crystal structure and biological characteristics are established Basis, and then foundation is provided for the resistance for improving sorghum by gene editing method.

Detailed description of the invention

Fig. 1 is the systematic evolution tree of sorghum GF14a gene；

Fig. 2 is digestion result schematic diagram, and 1 is the Plasmid DNA of digestion, and 2 be the digestion of BamHI and XhoI inscribe as a result, 3 are DNA Marker；

Fig. 3 is the albumen peak figure that GF14a albumen is obtained by the purifying of AKTA protein purification system and desalination；

Fig. 4 is the electrophoresis result figure after GF14a protein purification；

Fig. 5 is the result figure that SDS-PAGE electrophoresis tests optimum expression bacterial strain；

Fig. 6 is the result figure that SDS-PAGE electrophoresis tests best IPTG induced concentration；

Fig. 7 is the result figure that SDS-PAGE electrophoresis tests best inducing temperature；

Fig. 8 is western blot detection figure.

Specific embodiment

With reference to the accompanying drawing and invention is described further in specific embodiment:

Embodiment 1: the acquisition and analysis of sorghum 14-3-3 Protein G F14a gene

According to the protein sequence of reported corn GF14a gene, blastP searches for sorghum genome database (https: //phytozome) finds sorghum homologous gene GF14a (gene number is Sb03g028430).With GF14a protein searches Ncbi database downloads the GF14a gene in other species, with 7.0 software of MEGA, with adjacent method (Neighbor- Joining, NJ) (bootstrap=1000) building unrooted chadogram, as seen from Figure 1, GF14a gathers with corn GF14a is One, affiliation is nearest.

Embodiment 2: the building and identification of sorghum 14-3-3 Protein G F14a gene recombined vector

1, sorghum RNA is extracted, and reverse transcription goes out cDNA

Sorghum BTx623 material is taken, extracts seedling using RNA extracts kit (TIANGEN Biotech (Beijing) Co., Ltd.) Phase total serum IgE obtains cDNA with reverse transcription reagent box (Promega) reverse transcription.

2, using cDNA as template amplification GF14a gene；

Design primer expands GF14a gene using cDNA as template.

Primer is as follows:

Upstream primer: GF14a-F:GCGAATTCATGGCCGCCGCCGCC underscore is BamHI restriction enzyme site；

Downstream primer: GF14a-R:CGCTCGAGCTACTCATCATCAGGCTTGCTTG underscore is XhoI restriction enzyme site；

Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.

PCR amplification system used in gene magnification for vector construction is as follows: 5 × buffer 10 μ L, FastPfu 4 μ L, cDNA template of Fly DNA Polymerase 1 μ L (Quan Shijin), 2.5mmol dNTPs, 0.5 μ L, 10 μm of ol upstream and downstream are drawn Object each 1 μ L, ddH₂O 32.5μL。

The following are PCR amplification conditions: 95 DEG C of 2min, 35 circulations (95 DEG C of 20s, 58 DEG C of 20s, 72 DEG C of 30s-1min (according to DNA fragmentation length determines), 72 DEG C of 5min.

3, GF14a gene recombined vector is constructed

After PCR product is purified, it is connected to pET-28a carrier.PCR product is detected using 1% agarose.PCR Product is recycled with reference to Nanjing Vazyme Biotechnology Co., Ltd.'s Ago-Gel QIAquick Gel Extraction Kit specification.It is after the recovery Product is inserted into the pET-28a expression vector through same double digestion after BamHI and XhoI double digestion by DNA ligase, 16 DEG C connect 16 hours, construct pET-28a-GF14a recombinant plasmid.

By recombinant plasmid transformed to coli strain DH5a, trained on 50ug/mL kanamycins solid plate in 37 DEG C It supports, picking individual colonies hold up the limited public affairs of section's biotechnology after digestion identification is correct (digestion result is as shown in Figure 2), then through Beijing Take charge of its correct sequence of sequence verification.Sequencing result shows that GF14a coding sequence obtained fulfills the expectation, and says Bright construction of recombinant plasmid success is simultaneously named as pET-28a-GF14a, i.e. recombinant vector.

The inducing expression of embodiment 3:GF14a albumen

1, the recombined pronucleus expression bacterial strain of GF14a is obtained

It selects and successful monoclonal is sequenced in embodiment 2 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C, 200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a- GF14a recombinant expression carrier extracts, and recombinant expression carrier plasmid is taken to convert E. coli expression strains BL21 (DE3), JM109 (DE3), Rosetta (DE3), BL21 (DE3) pLysS, Tuner (DE3), NovaBlue (DE3) detect GF14a albumen Expression.

2, activated strains are incubated overnight

It is incubated overnight and activates above-mentioned recombined pronucleus expression bacterial strain.For example, by BL21 (DE3), JM109 (DE3), Tuner (DE3), NovaBlue (DE3) bacterial strain is transferred in 50ug/mL kanamycins fluid nutrient medium, by Rosetta (DE3), BL21 (DE3) pLysS bacterial strain is transferred in 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C, 200rpm it is overnight Cultivate activated strains.

3, inducing expression

The recombined pronucleus expression bacterial strain of activation is transferred in the fluid nutrient medium containing corresponding antibiotic, for example, will activation BL21 (DE3), JM109 (DE3), Tuner (DE3), NovaBlue (DE3) bacterial strain is transferred to 50ug/mL kanamycins liquid In culture medium, by Rosetta (DE3), BL21 (DE3) pLysS bacterial strain is transferred to 50ug/mL kanamycins+50ug/mL chloramphenicol In fluid nutrient medium, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 0.8mM is added, is trained in 25 DEG C of inductions It supports 10 hours, obtains the recombinant protein of GF14a.

4, the purifying of GF14a recombinant protein

After the completion of induction, expressed GF14a recombinant protein is recycled and purified, is carried out using AKTA protein purification system pure Change and desalination, it is preferable that protein purification is carried out using AKTA purifier10 fast protein purification system, steps are as follows:

Since pET28a has 6 His coded sequences before terminator, so pET28a-GF14a recombinant expression carrier obtains The albumen taken can use Ni-NTA and carry out affinitive layer purification.Affinity chromatography is with protein or large biological molecule and to be incorporated in Based on special affinity on medium between aglucon, because being connected to a NTA in the matrix of chromatography gel used in His-tags [(nitrilotriacetic acid) nitrilotriacetic acid], can with Ni ions binding, and the 6 of Ni ion and fusion protein × Attraction is generated between His amino acid, so that the fusion protein with His-tags histidine tag be distinguished with other albumen It comes, five yuan of imidazole rings of histidine residues are the key that albumen and Ni ionization, therefore when we use the imidazoles of high concentration (Imidazole) solution elution when marquis (such as 400mM), imidazoles be convenient for protein His-tags imidazole ring competitive binding, most Fusion protein is eluted from gel at last.

Concrete operations: taking out the thallus of -80 DEG C of preservations, and Lysis buffer is added and is resuspended, the bacterium solution after resuspension is in ice bath Middle carry out ultrasonic disruption, power 350W, duty ratio 50%, each circulation 30s, total time 35min.It is broken even Slurry, 4 DEG C, 1,2000rpm centrifugation 30min.Supernatant is adsorbed on Ni-NTA adsorption column with peristaltic pump, 5mL/min, repeats one It is secondary, retain 20 μ L by the sample of adsorption column and carries out protein adhesive electrophoresis；Ni-NTA adsorption column is connected to fast protein purifying system On system, eluted；Albumen is collected according to UV absorption curve, and samples and carries out protein adhesive electrophoresis detection.

Fig. 3 is AKTA protein purification system purifying protein peak figure.GF14a albumen is purified by AKTA protein purification system The albumen peak figure arrived.GF14a purifying figure ultraviolet (UV) absorption value when being purifying GF14a albumen.

Fig. 4 is the electrophoretogram after GF14a protein purification.It is the expression and purification GF14a at 25 DEG C, IPTG concentration 0.8mM Albumen result.1 is the albumen after Ni column is affine after purification；2 be the affine rear albumen efflux of Ni column；M is albumen marker； Arrow meaning is shown as GF14a albumen.Fig. 5 shows that GF14a albumen often has in supernatant under this condition, passes through AKTA egg The GF14a purity of protein that white purification system obtains after purification reaches requirement, can be used for subsequent experimental.

The verifying of the protein induced expression condition of embodiment 4:GF14a

1, the recombinant strains of GF14a are obtained

It selects and successful monoclonal is sequenced in embodiment 2 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C, 200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a- GF14a recombinant expression carrier extracts, and recombinant expression carrier is taken to convert respectively e. coli bl21 (DE3), JM109 (DE3), Rosetta (DE3), BL21 (DE3) pLysS, Tuner (DE3), NovaBlue (DE3) bacterial strain, be coated on card containing 50ug/mL that It is incubated overnight on mycin (Rosetta (DE3), BL21 (DE3) pLysS need to add 50ug/mL chloramphenicol) plate in 37 DEG C, Picking single colonie is inoculated into 50ug/mL kanamycins, and (Rosetta (DE3), it is mould that BL21 (DE3) pLysS need to add 50ug/mL chlorine Element) in fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight, 50% glycerol of sterilizing is added in bacterium solution, freezes after mixing in -80 DEG C refrigerator obtains the prokaryotic expression bacterial strain of expression GF14a.

2, the determination of GF14a Primary structure optimum strain

It is inoculated with above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3), JM109 (DE3), Tuner (DE3) respectively, NovaBlue (DE3) bacterial strain, into 50ug/mL kanamycins fluid nutrient medium, Rosetta (DE3), BL21 (DE3) pLysS is arrived In 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.

By the BL21 (DE3) of activation, JM109 (DE3), BL21 (DE3) pLysS, Tuner (DE3), NovaBlue (DE3) Bacterial strain is transferred in 50ug/mL kanamycins fluid nutrient medium, and Rosetta (DE3) bacterial strain is transferred to 50ug/mL kanamycins In+50ug/mL chloramphenicol fluid nutrient medium, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 1mM is added, 25 DEG C Fiber differentiation 12 hours (pET-28a bacterium is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min, It collects thallus, bacterial precipitation and negative control 2mL and PBS buffer (with preceding addition 1mM PMSF) suspension is pre-chilled, it is broken with ultrasound Broken instrument progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes supernatant, SDS-PAGE electrophoresis detection tests optimum expression bacterial strain, as a result as shown in figure 5, GF14a can be in BL21 (DE3), JM109 (DE3), it is expressed in this 4 bacterial strains of Tuner (DE3), NovaBlue (DE3), wherein expression quantity is most in BL21 (DE3).

3, the determination of the best IPTG concentration of GF14a Primary structure

Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to the training of 50ug/mL kanamycins liquid It supports in base, when 37 DEG C of shake cultures are to OD600=0.5, is separately added into the IPTG of final concentration of 0.4,0.6,0.8,1.0mM, 25 DEG C Fiber differentiation 10 hours (bacterium not induced is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min is received Collect thallus, bacterial precipitation and negative control 2mL and PBS buffer (with preceding addition 1mM PMSF) suspension is pre-chilled, uses ultrasonication Instrument progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes supernatant, SDS- PAGE electrophoresis detection tests best IPTG induced concentration, as a result as shown in fig. 6, when IPTG concentration is 0.8mM, GF14a expression At most.

4, the determination of GF14a Primary structure optimum temperature

Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to the training of 50ug/mL kanamycins liquid Support in base, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 0.8mM be added, respectively 16,20,25,30, With 37 DEG C Fiber differentiation 8-16 hours (pET-28a bacterium is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min collects thallus, bacterial precipitation and negative control 2mL and PBS buffer (with preceding addition 1mM PMSF) suspension is pre-chilled, uses Ultrasonic Cell Disruptor progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes Clearly, SDS-PAGE electrophoresis detection tests best inducing temperature, as a result sees Fig. 7, and in 25 DEG C of Fiber differentiations, GF14a expression quantity is most It is more.

The western blot of embodiment 5:GF14a recombinant protein is detected

(1) it extracts by GF14a albumen after purification:

1. cultivating the E. coli expression strains containing pET-28a-GF14a plasmid, IPTG inducing expression；

2. protein lysate (50mM Tris pH 8.0,120mM NaCl, 1mM DTT, 0.5%NP-40, before is added 1mM PMSF, 1mM DTT is added), after ultrasonic disruption cell, supernatant is collected by centrifugation, places 20min on ice；

3.15,000g, 4 DEG C of centrifugation 5min abandon precipitating；

4. taking 200 μ L supernatants that 5 × Loading Buffer is added, concussion is mixed, and -80 DEG C of remaining sample freeze；

5. boiling water boiling 5min, ice bath, 12,000rpm centrifugation 5min draw 15 μ L of supernatant and carry out protein electrophoresis, remaining sample - 20 DEG C of product freeze；

6. prepare SDS-PAGE glue, first carry out electrophoresis 20min with 90V, when sample enters separation gel, with 150V voltage into Row electrophoresis, until bromophenol blue stops electrophoresis when running out of separation gel.

(2) transferring film

Cut with a paper cutter out the pvdf membrane more somewhat larger than glue (for pvdf membrane, first with methanol impregnate 30 seconds, then ddH₂3-5min is impregnated in O, is then placed in transferring film buffer) rubber plate clamp is put into electrophoretic blotting groove.Transferring film buffer is poured into, 4 DEG C, 100V 90min.

(3) it closes

After the completion of transferring film, pvdf membrane is taken out, is put in the PBST solution with 5% skimmed milk power, 2h is closed on shaking table.

(4) primary antibody is incubated for

Confining liquid is discarded, is added Anti His antibody (1:5000), shaking table is incubated for 12h.

(5) secondary antibody is incubated for

Primary antibody is outwelled, washs pvdf membrane 3 times with 1 × PBST, each 5min；Corresponding secondary antibody (sheep anti-Mouse) is added, shakes Bed is incubated for 1h.

(6) ECL exposes

Secondary antibody is abandoned, washs pvdf membrane 3 times with 1 × PBST, each 5min；HRP chemiluminescent substrate is added on pvdf membrane Liquid can detect protein expression signal (as shown in Figure 8) on 5200 chemiluminescence detectors in day, and succeed table as can be seen from the results Up to GF14a albumen out.

SEQUENCE LISTING

Sequence table

<110>Guizhou University

<120>a kind of sorghum 14-3-3 Protein G F14a gene and its recombinant vector and expression

<160> 4

<210>1

<211>780

<212>DNA

<213>sorghum 14-3-3 Protein G F14a

<400>1

ATGGCCGCCG CCGCCGCCGG CACCCGGGAG GAGATGGTCT ACATGGCCAA GCTAGCGGAG 60

CAGGCGGAGC GGTACGAGGA GATGGTCGAC TTCATGGAGA AGGTCGTGGC GGCCGCCGCG 120

TCCTCCGAGC TCACCGTCGA GGAGCGCAAC CTGCTCTCCG TCGCCTACAA GAACGTCATC 180

GGCGCGCGCA GGGCGTCCTG GCGCATCGTA TCCTCCATCG AGCACAAGGA GGAGACGCGG 240

GGCGCAGCGG GCCACGCCGC TGCCGCCAGA GGGTACCGCG CCCGCGTCGA GGCTGAGCTC 300

TCCGGGATCT GCGCGGGCAT CCTCCGCCTC CTCGACGACC GCCTCGTCCC CGCTGCCGCC 360

GCCGTTGATG CTAAGGTCTT CTACCTTAAG ATGAAGGGGG ACTATCACCG TTACCTCGCC 420

GAGTTCAAGA CCGCTGCTGA GCGTAAGGAC GCCGCCGACT CCACGCTCGC AGCATACCAG 480

GCAGCGCAGG ACATCGCCGT CAAGGAGCTG CCGCCCACGC ACCCCATCAG GCTCGGCCTC 540

GCCCTCAACT TCTCCGTCTT CTACTACGAG ATCCTCAACT CGCCCGACCG CGCATGCTCC 600

CTCGCCAAGC AGGCCTTCGA CGAAGCTATT TCGGAGCTGG ATACTCTTGG GGAAGAGTCC 660

TACAAGGATA GCACCCTCAT CATGCAGCTC CTACGTGACA ACCTCACCTT GTGGACTTCT 720

GACATGCAGG AGGATGGCAG TGATGAAATG AGGGATGCAA GCAAGCCTGA TGATGAGTAG 780

<210>2

<211>259

<212>PRT

<213>sorghum 14-3-3 Protein G F14a

<400>2

MAAAAAGTRE EMVYMAKLAE QAERYEEMVD FMEKVVAAAA SSELTVEERN LLSVAYKNVI 60

GARRASWRIV SSIEHKEETR GAAGHAAAAR GYRARVEAEL SGICAGILRL LDDRLVPAAA 120

AVDAKVFYLK MKGDYHRYLA EFKTAAERKD AADSTLAAYQ AAQDIAVKEL PPTHPIRLGL 180

ALNFSVFYYE ILNSPDRACS LAKQAFDEAI SELDTLGEES YKDSTLIMQL LRDNLTLWTS 240

DMQEDGSDEM RDASKPDDE 259

<210>3

<211>23

<212>DNA

<213>artificial sequence

<400>3

GCGAATTCAT GGCCGCCGC CGCC 23

<210>4

<211>31

<212> DNA

<213>artificial sequence

<400>4

CGCTCGAGCT ACTCATCATC AGGCTTGCTT G 31

Claims (9)

1. a kind of sorghum 14-3-3 Protein G F14a gene, which is characterized in that its nucleotide sequence is as shown in SEQ ID NO.1.

2. the protein of sorghum 14-3-3 Protein G F14a gene coding as described in claim 1, amino acid sequence such as SEQ ID Shown in NO.2.

3. the recombinant vector comprising gene described in claim 1.

4. recombinant vector according to claim 3, which is characterized in that the recombinant vector the preparation method is as follows: extract Sorghum RNA, and reverse transcription goes out cDNA；Using cDNA as template amplification GF14a gene；By GF14a amplified production through BamHI and XhoI After double digestion, it is inserted into the pET-28a expression vector through same double digestion by DNA ligase, obtains recombinant plasmid pET- 28a-GF14a。

5. recombinant vector according to claim 4, which is characterized in that using cDNA as template, utilize following primer amplification GF14a gene, primer sequence are as follows:

Upstream primer: GF14a-F:GCGAATTCATGGCCGCCGCCGCC underscore is BamHI restriction enzyme site；

Downstream primer: GF14a-R:CGCTCGAGCTACTCATCATCAGGCTTGCTTG underscore is XhoI restriction enzyme site；

Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.

6. a kind of method for expressing sorghum 14-3-3 Protein G F14a gene, which comprises the following steps:

(1) recombinant vector described in claim 3 or 4 converts Bacillus coli cells, obtains the recombination protokaryon table of expression GF14a Up to bacterial strain；

(2) it by recombined pronucleus expression strain inoculated to kanamycins or kanamycins+chloramphenicol fluid nutrient medium, is incubated overnight Activated strains；

(3) the recombined pronucleus expression bacterial strain of activation is transferred in kanamycins or kanamycins+chloramphenicol fluid nutrient medium, is shaken The expression that IPTG induction recombinates GF14a is added after swinging culture；

(4) it after the completion of inducing, recycles and purifies expressed GF14a recombinant protein.

7. the method for expression sorghum 14-3-3 Protein G F14a gene according to claim 6, which is characterized in that step (3) When middle earthquake culture is to OD600=0.5, the IPTG of final concentration of 0.8mM is added, in 25 DEG C of Fiber differentiations.

8. the method for expression sorghum 14-3-3 Protein G F14a gene according to claim 6, which is characterized in that the card Kanamycins is 50ug/mL in that mycin fluid nutrient medium.

9. the method for expression sorghum 14-3-3 Protein G F14a gene according to claim 6, which is characterized in that the card Kanamycins is 50ug/mL, chloramphenicol 50ug/mL in that mycin+chloramphenicol fluid nutrient medium.