CN110117607A - A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene - Google Patents
A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene Download PDFInfo
- Publication number
- CN110117607A CN110117607A CN201910357333.2A CN201910357333A CN110117607A CN 110117607 A CN110117607 A CN 110117607A CN 201910357333 A CN201910357333 A CN 201910357333A CN 110117607 A CN110117607 A CN 110117607A
- Authority
- CN
- China
- Prior art keywords
- pit2
- expression
- gene
- protein
- kanamycins
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of recombinant vectors of ustilago zeae effect protein Pit2 gene, and the invention also discloses a kind of methods for expressing ustilago zeae effect protein Pit2 gene；The present invention constructs the prokaryotic expression carrier of ustilago zeae effect protein Pit2 gene, and a series of optimization is carried out for protein expression condition, finally obtain Pit2 soluble protein, as a result further research albumin crystal structure and biological characteristics lay the foundation, thinking is provided for the pesticide manufacturing of target for Pit2 for design, and then provides foundation for prevention and treatment ustilago zeae.
Description
Technical field
The present invention relates to the recombinant vectors and expression of a kind of ustilago zeae effect protein Pit2 gene, belong to biology
Technical field.
Background technique
Ustilago zeae is one of main disease of corn, can all be occurred during the entire fertility of corn.But corn
Smut can also be eaten raw when children is tender with prepared food, pleasantly sweet, stir-fry and eat and have a distinctive flavor.It is often edible to prevent and treat liver
System and gastrointestinal ulceration, and can aid digestion and defaecation.Contain glutamic acid, lysine, alanine, smart ammonia in ustilago zeae
16 kinds of amino acid such as acid, methionine, threonine, histidine.This ustilago zeae can be processed medicinal, and fresh sorus is taken
Or will be aging after collection refined honey ball, cold in nature, sweet in flavor, the effect of advantageous liver benefit liver stomach, and neurasthenia, children's infantile malnutrition due to digestive disturbances or intestinalparasites can be controlled
Product.
During plant and pathogen are confronted with each other, pathogen can secrete some albumen into host cell.These
Albumen is referred to as " effect protein (Avr) ", plant immune can be inhibited to react in several ways, cause of disease is promoted successfully to infect plant
Object.In recent years, the report that continuous pathogen effect protein gene is cloned, such as rice blast fungus, flax rust, oomycetes, tomato
Effect protein gene in leaf mycete, Fusarium oxysporum, real-time fluorescent RCR ulcer bacteria, barley leaf blotch bacterium and ustilago zeae etc.
Also it is successively cloned by separation.
The prokaryotic expression of gene is one of the common technology for studying gene function.Large intestine is usually present when albumen pronucleus expression
Since rare codon causes expression to limit in bacillus, inclusion body is formed；It can inhibit albumen when the stronger protein expression of toxicity
Expression causes expression yield too low；Another easy the problem of ignoring, which is that reproducibility is excessively high in Escherichia coli, will lead to two sulphur
Key cannot be properly formed, and cause expression product insoluble.For above-mentioned problem, it is common practice to after dissolving inclusion body with urea
It is purified in the case of a degenerated, then renaturation.But the method complex steps, success rate are low.Ustilago zeae effect at present
Albumen Pit2 gene has been found, but how it to be expressed with soluble form be still this field problem.The present invention is logical
It crosses and selects different bacterium bacterial strains, to screen Pit2 albumen using the concentration of different inducing temperatures and inducer IPTG solvable
Property expression condition, lay the foundation for the researchs such as gene function, protein crystal.
Summary of the invention
In view of the deficiencies of the prior art, the object of the present invention is to provide a kind of ustilago zeae effect protein Pit2 genes
Recombinant vector and expression.
The technical scheme is that a kind of recombinant vector of ustilago zeae effect protein Pit2 gene, the recombination
Carrier the preparation method is as follows: extracting corn RNA, and reverse transcription goes out cDNA；Using cDNA as template amplification Pit2 gene；By Pit2
Amplified production is inserted into the expression of the pET-28a through same double digestion by DNA ligase and carries after BamHI and XhoI double digestion
In body, recombinant plasmid pET-28a-Pit2 is obtained.
Using cDNA as template, using following primer amplification Pit2 gene, primer sequence is as follows:
Upstream primer: Pit2-F:GCGAATTCATTCCGGTGCGTCGATCG underscore is BamHI restriction enzyme site；
Downstream primer: Pit2-R:CGCTCGAGTTATTCCCAGATGACCACATCT underscore is XhoI restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
The present invention also provides a kind of methods for expressing ustilago zeae effect protein Pit2 gene, comprising the following steps:
(1) Bacillus coli cells are converted with recombinant vector of any of claims 1 or 2, the recombination for obtaining expression Pit2 is former
Nuclear expression bacterial strain；
(2) recombined pronucleus expression strain inoculated to kanamycins fluid nutrient medium or kanamycins+chloramphenicol liquid are trained
It supports in base, is incubated overnight activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to again in kanamycins fluid nutrient medium, is added after shake culture
Enter the expression of IPTG induction recombination Pit2；
(4) it after the completion of inducing, recycles and purifies expressed Pit2 recombinant protein.
Preferably, when earthquake culture is to OD600=0.5 in step (3), the IPTG of final concentration of 1.0mM is added, 25
DEG C Fiber differentiation.
Preferably, kanamycins is 50ug/mL in the kanamycins fluid nutrient medium.
Preferably, kanamycins is 50ug/mL, chloramphenicol 50ug/ in the kanamycins+chloramphenicol fluid nutrient medium
mL。
The beneficial effects of the present invention are: the present invention is to obtain Pit2 soluble protein, ustilago zeae effect egg is constructed
The prokaryotic expression carrier of white Pit2 gene, and a series of optimization is carried out for protein expression condition, inducing temperature is worked as in discovery
When being 25 DEG C, expression quantity is best；With the increase of IPTG concentration, expressing quantity is gradually increased, and best induced concentration is
1.0mM；At 25 DEG C, when IPTG concentration is 1.0, expression quantity is best.Through SDS-PAGE electrophoresis detection, obtaining molecular weight is about
The purpose band of 17kDa finally obtains Pit2 soluble protein for the expected size of Pit2 albumen.Meanwhile present invention albumen is pure
Change system purifies it, as a result further research albumin crystal structure and biological characteristics lay the foundation, for design
Thinking is provided for the pesticide manufacturing of target for Pit2, and then provides foundation for prevention and treatment ustilago zeae.
Detailed description of the invention
Fig. 1 is pET-28a Vector map；
Fig. 2 is digestion result schematic diagram, and 1 is the Plasmid DNA of digestion, and 2 be the digestion of BamHI and XhoI inscribe as a result, M is
DNA Marker；
Fig. 3 is the albumen peak figure that Pit2 albumen is obtained by the purifying of AKTA protein purification system and desalination；
Fig. 4 is the electrophoresis result figure after Pit2 protein purification；
Fig. 5 is the result figure that SDS-PAGE electrophoresis tests best IPTG induced concentration；
Fig. 6 is the result figure that SDS-PAGE electrophoresis tests best inducing temperature；
Fig. 7 is western blot detection figure.
Specific embodiment
With reference to the accompanying drawing and invention is described further in specific embodiment:
Embodiment 1: the building and identification of ustilago zeae effect protein Pit2 gene recombined vector
1, corn RNA is extracted, and reverse transcription goes out cDNA
Ustilago zeae material is taken, extracts seedling using RNA extracts kit (TIANGEN Biotech (Beijing) Co., Ltd.)
Phase total serum IgE obtains cDNA with reverse transcription reagent box (Promega) reverse transcription.
2, using cDNA as template amplification Pit2 gene；
Design primer expands Pit2 gene using cDNA as template, the nucleotide sequence of Pit2 gene such as SEQ ID
Shown in NO.1, the amino acid sequence of the protein encoded as Pit2 gene is as shown in SEQ ID NO.2.
Above-mentioned primer is as follows:
Upstream primer: Pit2-F:GCGAATTCATTCCGGTGCGTCGATCG (removal signal peptide sequence) underscore is
BamHI restriction enzyme site；
Downstream primer: Pit2-R:CGCTCGAGTTATTCCCAGATGACCACATCT underscore is XhoI restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
PCR amplification system used in gene magnification for vector construction is as follows: 5 × buffer 10 μ L, FastPfu
4 μ L, cDNA template of Fly DNA Polymerase 1 μ L (Quan Shijin), 2.5mmol dNTPs, 0.5 μ L, 10 μm of ol upstream and downstream are drawn
Object each 1 μ L, ddH2O 32.5μL。
The following are PCR amplification conditions: 95 DEG C of 2min, 35 circulation (95 DEG C of 20s, 58 DEG C of 20s, 72 DEG C of 30s-1min, 72 DEG C
5min。
3, Pit2 gene recombined vector is constructed
After PCR product is purified, it is connected to pET-28a carrier.PCR product is detected using 1% agarose.PCR
Product is recycled with reference to Nanjing Vazyme Biotechnology Co., Ltd.'s Ago-Gel QIAquick Gel Extraction Kit specification.It is after the recovery
Product is inserted into the pET-28a expression vector through same double digestion after BamHI and XhoI double digestion by DNA ligase
(expression vector map is as shown in Figure 1), 16 DEG C connect 16 hours, construct pET-28a-Pit2 recombinant plasmid.
By recombinant plasmid transformed to coli strain DH5a, trained on 50ug/mL kanamycins solid plate in 37 DEG C
It supports, picking individual colonies hold up the limited public affairs of section's biotechnology after digestion identification is correct (digestion result is as shown in Figure 2), then through Beijing
Take charge of its correct sequence of sequence verification.Sequencing result shows that Pit2 coding sequence obtained fulfills the expectation, explanation
Construction of recombinant plasmid success is simultaneously named as pET-28a-Pit2, i.e. recombinant vector.
The inducing expression of embodiment 2:Pit2 albumen
1, the recombined pronucleus expression bacterial strain of Pit2 is obtained
It selects and successful monoclonal is sequenced in embodiment 1 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-Pit2
Recombinant expression carrier extracts, take recombinant expression carrier conversion E. coli expression strains BL21 (DE3), JM109 (DE3),
BL21 (DE3) pLysS, Tuner (DE3), Rosetta (DE3) detect the expression of Pit2 albumen.
2, activated strains are incubated overnight
It is incubated overnight and activates above-mentioned recombined pronucleus expression bacterial strain.For example, by BL21 (DE3), JM109 (DE3), Tuner
(DE3) bacterial strain is transferred in 50ug/mL kanamycins fluid nutrient medium, by Rosetta (DE3), BL21 (DE3) pLysS bacterial strain
Be transferred in 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.
3, inducing expression
The recombined pronucleus expression bacterial strain of activation is transferred in the fluid nutrient medium containing corresponding antibiotic, for example, will activation
BL21 (DE3), JM109 (DE3), Tuner (DE3) bacterial strain be transferred in 50ug/mL kanamycins fluid nutrient medium, will
Rosetta (DE3), BL21 (DE3) pLysS bacterial strain are transferred to 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium
In, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 1.0mM is added, 25 DEG C Fiber differentiation 10 hours, obtain
Obtain the recombinant protein of Pit2.
4, the purifying of Pit2 recombinant protein
After the completion of induction, expressed Pit2 recombinant protein is recycled and purified, is carried out using AKTA protein purification system pure
Change and desalination, it is preferable that protein purification is carried out using AKTA purifier10 fast protein purification system, steps are as follows:
Since pET28a has 6 His coded sequences before terminator, so pET28a-Pit2 recombinant expression carrier obtains
The albumen taken can use Ni-NTA and carry out affinitive layer purification.Affinity chromatography is with protein or large biological molecule and to be incorporated in
Based on special affinity on medium between aglucon, because being connected to a NTA in the matrix of chromatography gel used in His-tags
[(nitrilotriacetic acid) nitrilotriacetic acid], can with Ni ions binding, and the 6 of Ni ion and fusion protein ×
Attraction is generated between His amino acid, so that the fusion protein with His-tags histidine tag be distinguished with other albumen
It comes, five yuan of imidazole rings of histidine residues are the key that albumen and Ni ionization, therefore when we use the imidazoles of high concentration
(Imidazole) solution elution when marquis (such as 400mM), imidazoles be convenient for protein His-tags imidazole ring competitive binding, most
Fusion protein is eluted from gel at last.
Concrete operations: taking out the thallus of -80 DEG C of preservations, and Lysis buffer is added and is resuspended, the bacterium solution after resuspension is in ice bath
Middle carry out ultrasonic disruption, power 350W, duty ratio 50%, each circulation 30s, total time 35min.It is broken even
Slurry, 4 DEG C, 1,2000rpm centrifugation 30min.Supernatant is adsorbed on Ni-NTA adsorption column with peristaltic pump, 5mL/min, repeats one
It is secondary, retain 20 μ L by the sample of adsorption column and carries out protein adhesive electrophoresis；Ni-NTA adsorption column is connected to fast protein purifying system
On system, eluted；Albumen is collected according to UV absorption curve, and samples and carries out protein adhesive electrophoresis detection.
Fig. 3 is AKTA protein purification system purifying protein peak figure.Pit2 albumen is purified by AKTA protein purification system
The albumen peak figure arrived.
Fig. 4 is the electrophoretogram after Pit2 protein purification.It is the expression and purification Pit2 egg at 25 DEG C, IPTG concentration 1.0mM
White result.1 is the albumen after Ni column is affine after purification；2 be Supernatant samples after cell ultrasonication；M is albumen marker；
Arrow meaning is shown as Pit2 albumen.Fig. 4 shows that Pit2 albumen often has in supernatant under this condition, is solubility expression,
The Pit2 purity of protein obtained after purification by AKTA protein purification system reaches requirement, can be used for subsequent experimental.
The verifying of the protein induced expression condition of embodiment 3:Pit2
1, the recombinant strains of Pit2 are obtained
It selects and successful monoclonal is sequenced in embodiment 1 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-Pit2
Recombinant expression carrier extracts, and takes recombinant expression carrier to convert e. coli bl21 (DE3) bacterial strain, is coated on containing 50ug/mL
It being incubated overnight on kanamycins plate in 37 DEG C, picking single colonie is inoculated into 50ug/mL kanamycins fluid nutrient medium,
37 DEG C, 200rpm be incubated overnight, in bacterium solution be added sterilizing 50% glycerol, frozen after mixing in -80 DEG C of refrigerators, expressed
The prokaryotic expression bacterial strain of Pit2.
2, the determination of the best IPTG concentration of Pit2 Primary structure
Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37
DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to 50ug/mL kanamycins liquid again
In culture medium, when 37 DEG C of shake cultures are to OD600=0.5, it is separately added into the IPTG of final concentration of 0.4,0.8,1.0,1.2mM,
25 DEG C Fiber differentiation 4-16 hours (bacterium not induced is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation
2min collects thallus, bacterial precipitation and negative control 2mL and PBS buffer (with preceding addition 1mM PMSF) suspension is pre-chilled, uses
Ultrasonic Cell Disruptor progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes
Clearly, SDS-PAGE electrophoresis detection tests best IPTG induced concentration, as a result as shown in figure 5, Pit2 Primary structure it is best
IPTG is 1.0mM.
3, the determination of Pit2 Primary structure optimum temperature
Above-mentioned recombined pronucleus expression bacterial strain BL21 (DE3) is inoculated with into 50ug/mL kanamycins fluid nutrient medium, 37
DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to the training of 50ug/mL kanamycins liquid
Support in base, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 1.0mM be added, respectively 16,20,25,30,
With 37 DEG C Fiber differentiation 8-16 hours (pET-28a bacterium is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation
2min collects thallus, bacterial precipitation and negative control 2mL and PBS buffer (with preceding addition 1mM PMSF) suspension is pre-chilled, uses
Ultrasonic Cell Disruptor progress clasmatosis, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes
Clearly, SDS-PAGE electrophoresis detection tests best inducing temperature, as a result sees Fig. 6, the best inducing temperature of Pit2 Primary structure
It is 25 DEG C.
The western blot of embodiment 4:Pit2 recombinant protein is detected
(1) it extracts by Pit2 albumen after purification:
1. cultivating the E. coli expression strains containing pET-28a-Pit2 plasmid, IPTG inducing expression；
2. protein lysate (50mM Tris pH 8.0,120mM NaCl, 1mM DTT, 0.5%NP-40, before is added
1mM PMSF, 1mM DTT is added), after ultrasonic disruption cell, supernatant is collected by centrifugation, places 20min on ice；
3.15,000g, 4 DEG C of centrifugation 5min abandon precipitating；
4. taking 200 μ L supernatants that 5 × Loading Buffer is added, concussion is mixed, and -80 DEG C of remaining sample freeze；
5. boiling water boiling 5min, ice bath, 12,000rpm centrifugation 5min draw 15 μ L of supernatant and carry out protein electrophoresis, remaining sample
- 20 DEG C of product freeze；
6. prepare SDS-PAGE glue, first carry out electrophoresis 20min with 90V, when sample enters separation gel, with 150V voltage into
Row electrophoresis, until bromophenol blue stops electrophoresis when running out of separation gel.
(2) transferring film
Cut with a paper cutter out the pvdf membrane more somewhat larger than glue (for pvdf membrane, first with methanol impregnate 30 seconds, then
ddH23-5min is impregnated in O, is then placed in transferring film buffer) rubber plate clamp is put into electrophoretic blotting groove.Transferring film buffer is poured into,
4 DEG C, 100V 90min.
(3) it closes
After the completion of transferring film, pvdf membrane is taken out, is put in the PBST solution with 5% skimmed milk power, 2h is closed on shaking table.
(4) primary antibody is incubated for
Confining liquid is discarded, is added Anti His antibody (1:5000), shaking table is incubated for 12h.
(5) secondary antibody is incubated for
Primary antibody is outwelled, washs pvdf membrane 3 times with 1 × PBST, each 5min；Corresponding secondary antibody (sheep anti-Mouse) is added, shakes
Bed is incubated for 1h.
(6) ECL exposes
Secondary antibody is abandoned, washs pvdf membrane 3 times with 1 × PBST, each 5min；HRP chemiluminescent substrate is added on pvdf membrane
Liquid can detect protein expression signal (as shown in Figure 7) on 5200 chemiluminescence detectors in day, and succeed table as can be seen from the results
Up to Pit2 albumen out.
Nucleotide series table:
SEQUENCE LISTING
Sequence table
<110>Guizhou University
<120>a kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene
<160> 4
<210>1
<211>363
<212>DNA
<213>ustilago zeae effect protein Pit2
<400>1
ATGCTGTTTC GCTCAGCCTT TGTTCTGCTC ATCGTGGCCT TTGCAAGTGC ATGCCTGGTG 60
CAACATGTTC AAGCTAAGCA GATTCCGGTG CGTCGATCGC TCTCTACCGA TGCCTCAATG 120
AGCTCGGCTG CTGGCAAGCT CAACCGGAGA TGGTGGTTCG GCTTCACAGG TTCGCTCGGC 180
AAGGAACCTG ACAACGGCCA AGTACAGATC AAGATCATCC CAGACGCGCT CATCATCAAG 240
AATCCGCCTG CCAACAAAGA CGATCTGAAC AAGCTAATCG AAAACCTAAA ACGCAAGCAC 300
CCAAGATTCA AGACGGTGGT CATGCCGACA GATCCTAACG GAGATGTGGT CATCTGGGAA 360
TAA 363
<210>2
<211>120
<212>PRT
<213>ustilago zeae effect protein Pit2
<400>2
MLFRSAFVLL IVAFASACLV QHVQAKQIPV RRSLSTDASM SSAAGKLNRR WWFGFTGSLG 60
KEPDNGQVQI KIIPDALIIK NPPANKDDLN KLIENLKRKH PRFKTVVMPT DPNGDVVIWE 120
<210>3
<211>26
<212>DNA
<213>artificial sequence
<400>3
GCGAATTCAT TCCGGTGCGT CGATCG 26
<210>4
<211>30
<212>DNA
<213>artificial sequence
<400>4
CGCTCGAGTT ATTCCCAGAT GACCACATCT 30
Claims (6)
1. a kind of recombinant vector of ustilago zeae effect protein Pit2 gene, it is characterised in that: the preparation of the recombinant vector
Method is as follows: extracting corn RNA, and reverse transcription goes out cDNA；Using cDNA as template amplification Pit2 gene；Pit2 amplified production is passed through
It after BamHI and XhoI double digestion, is inserted into the pET-28a expression vector through same double digestion by DNA ligase, obtains weight
Group plasmid pET-28a-Pit2.
2. recombinant vector according to claim 2, it is characterised in that: using cDNA as template, utilize following primer amplification
Pit2 gene, primer sequence are as follows:
Upstream primer: Pit2-F:GCGAATTCATTCCGGTGCGTCGATCG underscore is BamHI restriction enzyme site；
Downstream primer: Pit2-R:CGCTCGAGTTATTCCCAGATGACCACATCT underscore is XhoI restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
3. a kind of method for expressing ustilago zeae effect protein Pit2 gene, which comprises the following steps:
(1) Bacillus coli cells are converted with recombinant vector of any of claims 1 or 2, obtains the recombination protokaryon table of expression Pit2
Up to bacterial strain；
(2) by recombined pronucleus expression strain inoculated to kanamycins fluid nutrient medium or kanamycins+chloramphenicol fluid nutrient medium
In, it is incubated overnight activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to again in kanamycins fluid nutrient medium, is added after shake culture
The expression of IPTG induction recombination Pit2；
(4) it after the completion of inducing, recycles and purifies expressed Pit2 recombinant protein.
4. the method for expression ustilago zeae effect protein Pit2 gene according to claim 3, which is characterized in that step
(3) when earthquake culture is to OD600=0.5 in, the IPTG of final concentration of 1.0mM is added, in 25 DEG C of Fiber differentiations.
5. the method for expression ustilago zeae effect protein Pit2 gene according to claim 3, which is characterized in that described
Kanamycins is 50ug/mL in kanamycins fluid nutrient medium.
6. the method for expression ustilago zeae effect protein Pit2 gene according to claim 3, which is characterized in that described
Kanamycins is 50ug/mL, chloramphenicol 50ug/mL in kanamycins+chloramphenicol fluid nutrient medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910357333.2A CN110117607A (en) | 2019-04-29 | 2019-04-29 | A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910357333.2A CN110117607A (en) | 2019-04-29 | 2019-04-29 | A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110117607A true CN110117607A (en) | 2019-08-13 |
Family
ID=67521691
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910357333.2A Pending CN110117607A (en) | 2019-04-29 | 2019-04-29 | A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110117607A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113768028A (en) * | 2021-09-14 | 2021-12-10 | 辽宁省农业科学院 | Method for separating protein from ustilago sorghum and application of method |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5196524A (en) * | 1989-01-06 | 1993-03-23 | Eli Lilly And Company | Fusion reporter gene for bacterial luciferase |
| US20030126631A1 (en) * | 1991-02-22 | 2003-07-03 | Moloney Maurice M. | Preparation of heterologous proteins on oil bodies |
| CA2767225A1 (en) * | 2009-07-06 | 2011-01-13 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for enhancing production of a biological product |
| CN108546708A (en) * | 2018-04-19 | 2018-09-18 | 贵州大学 | A kind of screening technique of filamentous fungi knock out mutants body |
| CN110423770A (en) * | 2019-04-30 | 2019-11-08 | 贵州大学 | A kind of recombinant vector and expression of ustilago zeae effect protein CMU1 gene |
-
2019
- 2019-04-29 CN CN201910357333.2A patent/CN110117607A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5196524A (en) * | 1989-01-06 | 1993-03-23 | Eli Lilly And Company | Fusion reporter gene for bacterial luciferase |
| US20030126631A1 (en) * | 1991-02-22 | 2003-07-03 | Moloney Maurice M. | Preparation of heterologous proteins on oil bodies |
| CA2767225A1 (en) * | 2009-07-06 | 2011-01-13 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for enhancing production of a biological product |
| CN108546708A (en) * | 2018-04-19 | 2018-09-18 | 贵州大学 | A kind of screening technique of filamentous fungi knock out mutants body |
| CN110423770A (en) * | 2019-04-30 | 2019-11-08 | 贵州大学 | A kind of recombinant vector and expression of ustilago zeae effect protein CMU1 gene |
Non-Patent Citations (4)
| Title |
|---|
| ANDRÉ N. MUELLER等: "Compatibility in the Ustilago maydis–Maize Interaction Requires Inhibition of Host Cysteine Proteases by the Fungal Effector Pit2", 《PLOS PATHOGENS》 * |
| KAMPER,J.等: "Ustilago maydis 521 cysteine-protease inhibitor (UMAG_01375), partial mRNA", 《GENBANK DATABASE》 * |
| 段丽萍: "玉米黑粉菌现场检测技术的建立与应用研究", 《中国优秀硕士学位论文全文数据库（电子期刊）农业科技辑》 * |
| 段丽萍等: "玉蜀黍黑粉菌环介导等温扩增检测体系的建立及应用", 《植物病理学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113768028A (en) * | 2021-09-14 | 2021-12-10 | 辽宁省农业科学院 | Method for separating protein from ustilago sorghum and application of method |
| CN113768028B (en) * | 2021-09-14 | 2024-01-23 | 辽宁省农业科学院 | Method for separating protein from black powder sorghum and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110643612B (en) | Trachinotus ovatus antimicrobial peptide NK-lysin gene and application thereof | |
| CN111690054B (en) | Pinctada martensii Kunitz type serine protease inhibitor gene, encoded protein and application | |
| CN110551732A (en) | Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof | |
| CN102586286B (en) | Expression system of bacillus thur ingiens (Bt) insecticidal protein Cry1Ac-a | |
| CN110117607A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene | |
| CN110423770A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein CMU1 gene | |
| CN109536522A (en) | A kind of preparation and application of the prokaryotic expression, polyclonal antibody of southern rice black-streaked dwarf virus P6 albumen | |
| CN110042115A (en) | A kind of recombinant vector and expression of potato aphid effect protein Me23 gene | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN110117606A (en) | A kind of recombinant vector and expression of Potato Aphid effect protein Me10 gene | |
| CN110093363A (en) | A kind of recombinant vector and expression of black peach aphid effect protein Mp1 gene | |
| CN106243203A (en) | A kind of Volvariella volvacea (Bull.Ex Franch.) Singer． heatshock protein VvHSP70 and application thereof | |
| CN109971770A (en) | A kind of sorghum C2H2 zinc finger protein gene SbZFP36 and its recombinant vector and expression | |
| CN103012578B (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof | |
| CN109913478A (en) | A kind of sorghum E3 ubiquitin ligase SbBAG4 gene and its recombinant vector and expression | |
| CN109913471A (en) | A kind of sorghum transcription factor SbGRF4 gene and its recombinant vector and expression | |
| CN109912705A (en) | A kind of sorghum 14-3-3 Protein G F14c gene and its recombinant vector and expression | |
| CN109810986A (en) | A kind of sorghum 14-3-3 Protein G F14a gene and its recombinant vector and expression | |
| CN102199202B (en) | Gene of recombinant fungal immunomodulatory protein between ganodermas, protein coded thereby, and application thereof | |
| CN109943574A (en) | A kind of sorghum 14-3-3 Protein G F14b gene and its recombinant vector and expression | |
| CN110093364A (en) | A kind of recombinant vector and expression of root-knot nematode effect protein HgGLAND59 gene | |
| CN110042116A (en) | A kind of recombinant vector and expression of rice blast fungus biological clock control gene M oCCG4 | |
| WO2021258637A1 (en) | Trypsin-like serine protease gene, encoded protein and application | |
| CN104928308B (en) | Thrombolysis enzyme gene and recombinant expression carrier, recombinant bacterium and application containing the gene | |
| CN109971767A (en) | A kind of sorghum transcription factor SbWRKY45 gene and its recombinant vector and expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190813 |
|
| RJ01 | Rejection of invention patent application after publication |