CN104862331B - A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen - Google Patents
A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen Download PDFInfo
- Publication number
- CN104862331B CN104862331B CN201510273219.3A CN201510273219A CN104862331B CN 104862331 B CN104862331 B CN 104862331B CN 201510273219 A CN201510273219 A CN 201510273219A CN 104862331 B CN104862331 B CN 104862331B
- Authority
- CN
- China
- Prior art keywords
- vapa
- expression
- albumen
- pmal
- iptg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention belongs to field of biotechnology, a kind of method for specifically disclosing solubility expression Rhodococcus equi Disease-causing gene VapA albumen, being will be in VapA gene cloning to PMAL-C5x carrier, construction of expression vector PMAL-VapA, and convert PMAL-VapA to prokaryotic expression bacterium, acquisition is induced at 20 DEG C by IPTG；The recombinant protein almost all in the above way obtained exists in the form of soluble-expression.After the recombinant protein purification, concentration has good immunogenicity, is more suitable for the preparation of clinical treatment hyper-immune serum antibody and vaccine, the development and application of reagent for clinical diagnosis and the research of Rhodococcus equi pathogenesis up to 2mg/mL, the recombinant protein.
Description
Technical field
The present invention relates to field of biotechnology, more particularly, to a kind of solubility expression Rhodococcus equi Disease-causing gene
The method of VapA albumen.
Background technique
Rhodococcus equi belongs to Rhod, is a kind of conditionity pathogenic bacteria of infecting both domestic animals and human.The pathogen is prevalent in
In natural environment soil, investigation shows that there are the bacterium in 50~95% farm soil.Rhodococcus equi can infect people, cause to exhale
Inhale road infection symptoms.The disease is also one of most common disease of young age colt, and disease incidence is up to 80%.Colt catch an illness generally in slow
Property or subacute bronchopneumonia symptom, occur together cecocolon and lymphonodi mesenterici ulcer sometimes.
It is not known all the time about the pathogenic mechanism of Rhodococcus equi, as of late the study found that leading to the bacterial poison
The key of property is whether it contains a pathogenic related plasmids.The plasmid contains the genetic coding DNA of 85~90kb, codified
The toxicity lipoprotein of multiple high immunogenicities.Wherein, toxicity GAP-associated protein GAP A (VapA) is that it mainly expresses albumen.Numerous studies
Show that toxicity and the VapA of Rhodococcus equi are closely related.Though currently, having the report of part recombination VapA protein expression, its table
The albumen reached exists mostly in the form of inclusion body, it is more difficult to the development and application applied to actual medical diagnosis and treatment product.
Summary of the invention
The technical problem to be solved by the present invention is to Rhodococcus equi Disease-causing gene VapA albumen mostly to exist with inclusion bodies
And the technological deficiency of application can not be obtained, a kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen is provided.
The purpose of the present invention is what is be achieved by the following technical programs:
A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen expands VapA gene, and is cloned into
On PMAL-C5x carrier, construction of expression vector PMAL-VapA converts PMAL-VapA to prokaryotic expression bacterium, by IPTG 20
Induction obtains solubility VapA albumen at DEG C.
Rhodococcus equi Disease-causing gene VapA albumen is important toxic protein, in the prior art about the albumen study compared with
It is few.The Rhodococcus equi Disease-causing gene VapA albumen being generally purified into exists mostly in the form of inclusion body, to limit its reality
Using.Applicant passes through a large amount of exploration discoveries: VapA gene being connected with PMAL-C5x carrier, and cooperates 20 DEG C of inducing temperature
The VapA albumen of great amount of soluble expression can be given expression to.
The present invention uses PMAL-C5x carrier, it can promote the solubility expression of recombinant expression protein, experimental study table
Bright, inclusion bodies expression recombinant protein influences its amino acids fold and forms normal protein three-level, level Four topological structure
It is formed, and then influences the antigenicity and bioactivity of recombinant expression protein.This research uses PMAL-C5x for carrier for the first time, to horse
The Disease-causing gene VapA of Rhodococcus sp is recombinated, and recombinant plasmid-PMAL-VapA is obtained.
In addition, inventor is found through experiments that, PMAL-C5x carrier is only used, though to the solubility expression of VapA albumen
So there is facilitation, but effect is not obvious, it is necessary to cooperate low temperature induction, VapA albumen great amount of soluble table can be made
It reaches, inventor, which has studied multiple inducing temperatures, influences the expression of VapA albumen, the results show that can only obtain at 20 DEG C
Obtain largely soluble VapA albumen.
Preferably, prokaryotic expression bacterium of the present invention is in culture to OD600After value is 0.5~0.7, IPTG is added and is lured
It leads；It is highly preferred that prokaryotic expression bacterium is in culture to OD600After value is 0.6, IPTG is added and is induced
Preferably, the concentration of IPTG induction of the present invention is 0.3~0.7mM, and induction time is 8~12h.
It is highly preferred that IPTG induced concentration is 0.7mM it is found by the applicant that the prokaryotic expression bacterium is under 20 DEG C of cultures, and
When induction time is 8h, the expression quantity highest of VapA albumen, and mostly solubility expression.
Specifically, the above method the following steps are included:
S1. the building of recombinant plasmid PMAL-VapA: primer amplification described in design SEQ ID NO:1 and SEQ ID NO:2
VapA gene, VapA gene is connected with pZeroBack/blunt carrier building plasmid pZeroBack-VapA；Finally will
PMAL-c5x and the correct pZeroBack-VapA of sequencing carry out construction of expression vector PMAL-VapA after double digestion；
S2. PMAL-VapA being transformed into BL21 bacterium, sequencing is accredited as after the positive, bacterium solution is inoculated in culture medium,
It cultivates to OD600Value is 0.5~0.7, and after IPTG induction is added, thallus is resuspended in centrifugation, is crushed thallus, collects supernatant, is obtained solvable
Property VapA albumen.
S3. supernatant carries out affinity chromatography by amylose resin, obtains albumen after purification.
It is highly preferred that S2 prokaryotic expression bacterium is in culture to OD600After value is 0.6, IPTG is added and is induced.
The present invention also provides solubility VapA albumen obtained by the above method.
Further, the immune formulation that above-mentioned VapA albumen is prepared also is provided；Specifically, the immune formulation is anti-
Exempt from serum.
Compared with prior art, beneficial effects of the present invention are as follows:
It is by VapA gene the present invention provides a kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen
It is cloned on PMAL-C5x carrier, construction of expression vector PMAL-VapA, and PMAL-VapA is converted to prokaryotic expression bacterium, passes through
IPTG induces acquisition at 20 DEG C；The recombinant protein almost all in the above way obtained exists in the form of soluble-expression.It will
After the recombinant protein purification, concentration has good immunogenicity up to 2mg/mL, the recombinant protein, is more suitable for clinical treatment use
The preparation of hyper-immune serum antibody and vaccine, the development and application of reagent for clinical diagnosis and the research of Rhodococcus equi pathogenesis.
Detailed description of the invention
Fig. 1 is the PCR amplification figure of VapA gene；Wherein, 1:VapA；2:ddH2O control；The DNA molecular amount of M:2000bp
Standard.
Fig. 2 is the digestion identification for recombinating cloned plasmids pZeroBack-VapA；Wherein, 1:pZeroBack-VapA recombinates matter
EcoR I and Not the I double enzyme digestion product of grain；The DNA molecular amount standard of M:5000bp.
Fig. 3 is the sequencing qualification result of recombinant expression plasmid PMAL-VapA；Underscore position is respectively Not I and EcoR
The restriction enzyme site sequence of I.
Fig. 4 is influence of the different inducing temperatures to expressing quantity；Wherein, M: Protein Marker；1:IPTG induction
Preceding protein expression；2-6: the protein expression induced at a temperature of 10 DEG C, 15 DEG C, 20 DEG C, 28 DEG C and 37 DEG C respectively.
Fig. 5 is influence of the different IPTG induction times to expressing quantity；Wherein, M: Protein Marker；1-8 difference
For the protein expression of IPTG induction 0,2,4,8,12,16,20 and 24 hour.
Fig. 6 is influence of the different IPTG concentration to inducible protein expression quantity；Wherein, M: Protein Marker；1-7:
IPTG concentration is respectively as follows: 0,0.1,0.3,0.5,0.7,1.0 and 1.4mM.
Fig. 7 is that 0.7mM IPTG induces the albumen expressed after 8h at 20 DEG C；Wherein, M: Protein Marker；1: induction
The protein expression of preceding BL21 bacterium；2: the protein expression of BL21 bacterium after induction；The BL21 of 3 conversion empty expression vector PMAL-C5x
Protein expression before inducing；Protein expression after 4: conversion empty expression vector PMAL-C5x BL21 induction；5: conversion null representation plasmid
Protein expression before the L21 of PMAL-VapA is induced；Protein expression after 6: conversion expression plasmid PMAL-VapA BL21 induction；7:
VapA albumen after affinitive layer purification；8: the BL21 bacterium solution ultrasonication supernatant of inducing expression VapA albumen is (containing solubility
Express albumen)；9: the BL21 bacterium solution ultrasonication precipitating (expressing albumen containing inclusion body) of inducing expression VapA albumen.
Fig. 8 is the state analysis of the VapA albumen of different temperatures inducing expression；M: Protein Marker；1:IPTG induction
The protein expression of preceding conversion BL21 (containing PMAL-VapA)；2 and 3 are respectively as follows: the ultrasonication supernatant of 20 DEG C of inducing expression products
(containing soluble express protein) and precipitating (express albumen containing inclusion body)；4 and 5 are respectively as follows: the ultrasound of 28 DEG C of inducing expression products
Broken supernatant precipitating；6 and 7 are respectively as follows: the ultrasonication supernatant precipitating of 37 DEG C of inducing expression products.
Fig. 9 is that the Western-blot of VapA albumen after purification analyzes result；Wherein, 1: the VapA albumen of purifying；M: egg
White molecular weight standard.
Specific embodiment
The contents of the present invention are further illustrated with specific embodiment with reference to the accompanying drawings of the specification, but should not be construed as to this
The limitation of invention.Without departing from the spirit and substance of the case in the present invention, to simple made by the method for the present invention, step or condition
Modifications or substitutions all belong to the scope of the present invention；Unless otherwise specified, technological means used in embodiment is art technology
Conventional means known to personnel.
The building and identification of 1 prokaryotic expression recombinant plasmid PMAL-VapA of embodiment
1, the recovery and cultivation of Rhodococcus equi: purchase is preserved in American Type Culture Collecti, and deposit number is ATCC 33701
Rhodococcus equi, according to regulation operating process recovery Rhodococcus equi.
2, design of primers: according to Rhodococcus equi Disease-causing gene VapA sequence (JN990991.1) in NCBI gene pool and
PZeroBack/blunt and PMAL-C5x carrier restriction enzyme site designs a pair of drawing with restriction enzyme site with OLigo6.0 software
Object (Ying Weijieji Bioisystech Co., Ltd synthesizes by Shanghai), primer sequence is as follows:
F:AAGGAAAAAAGCGGCCGCATGAAGACCCTGCACAAGACGGTCTC (underscore is NotI restriction enzyme site)
R:CCGGAATTCCTAAGCGTTGTGCCAACTACCCGAG (underscore is EcoR I restriction enzyme site).
3, the PCR amplification of VapA gene and clone
3.1. illustrate to expand VapA gene, reaction system such as table 1 referring to Fast HiFideLity PCR Kit.
1 PCR reaction system of table
| Reagent | Volume |
| Fast HiFideLity PoLymerase | 1uL |
| 5×Fast HiFideLity PCR Buffer | 10uL |
| 20×Fast PCR Enhancer | 2.5uL |
| DEPC water | 33.5uL |
| Primers F | 1uL |
| Primer R | 1uL |
| 33701 bacterium solution of ATCC | 1uL |
| Total volume | 50uL |
Response procedures: 94 DEG C of initial denaturation 2min；(94 DEG C of denaturation 30s；55 DEG C of annealing 30s；68 DEG C of extension 30s) 30 are run altogether
A circulation, 68 DEG C extend 5min, last 4 DEG C of preservations, as a result such as Fig. 1 eventually.
Referring to Tiangeng biochemical technology Co., Ltd plain agar sugar gel DNA QIAquick Gel Extraction Kit (TIANgeL Midi
Purification Kit) operation instructions carry out PCR product recycling, purifying, the method is as follows:
(1) the EP pipe of 1.5mL is got out, by the product after PCR amplification with 1% Ago-Gel (containing 0.5 μ g/mL EB)
Electrophoresis is carried out, under ultraviolet light irradiation, the gel containing target gene (563bp) is cut, and be put into ready EP pipe, claims
Take weight.
(2) column equilibration step: (adsorption column is put into collecting pipe in adsorption column CA2 (have passed through pre-treatment on the day of adsorption column)
In) the equilibrium liquid BL of 500 μ L is added.12,000rpm is centrifuged 1min.The waste liquid in collecting pipe is outwelled, and again by adsorption column CA2
It puts back in collecting pipe.
(3) be added into blob of viscose equimultiple bulk solution PN (if gel weight is 0.1g, volume can be considered 100 μ L, then plus
Enter 100 μ L PN solution), it is placed in 50 DEG C of water-baths and incubates.Centrifuge tube is leniently constantly spun upside down therebetween, to ensure that blob of viscose is abundant
Dissolution, if can continue to place a few minutes or add some PN solution again there are also not molten blob of viscose, until blob of viscose is completely dissolved
If (volume of blob of viscose is excessive, blob of viscose can be cut into fragment in advance), blob of viscose be completely dissolved after by solution temperature be down to room temperature again on
Column.
(4) (adsorption column is put into collecting pipe in the adsorption column CA2 after step (3) acquired solution to be added to step (2) balance
In).After being placed at room temperature for 2min, 12,000rpm centrifugation 60s.The waste liquid in collecting pipe is outwelled, and adsorption column CA2 is put into receipts
In collector.Absorption column volume is 800 μ L, if sample volume is greater than 800 μ L and can be added portionwise.
(5) 600 μ L rinsing liquid PW (need first to check whether before use and dehydrated alcohol has been added) are added into adsorption column CA2,
Stand 2~5min.12,000rpm 30~60s of centrifugation, outwell the waste liquid in collecting pipe, and adsorption column CA2 is put into collecting pipe
In.
(6) repetitive operation step (5).
(7) adsorption column CA2 is put back in collecting pipe, 12000rpm is centrifuged 2min, and the rinsing liquid PW in collecting pipe is removed.
Adsorption column CA2 is placed in and is placed at room temperature for several minutes, is thoroughly dried, to prevent remaining rinsing liquid from influencing the experiment of next step.
(8) adsorption column CA2 is put into a clean centrifuge tube, 40uL is vacantly added dropwise to adsorbed film middle position
ddH2O is placed at room temperature for 2min.12,000rpm centrifugation 2min collect DNA solution, and the solution that centrifugation is obtained again adsorb by add-back
In column, it is placed at room temperature for 2min, DNA solution is collected into centrifuge tube by 12,000rpm centrifugation 2min.DNA product is stored in -20
DEG C, to prevent DNA degradation.
3.2.PCR the connection of product and pZeroBack/blunt carrier
Referring to zero background rapid ligation kit (ZeroBack Fast Ligation Kit) specification, reactant is connected
Be it is as follows: take pZeroBack/blunt carrier 0.3uL, T4 DNA Ligase 0.5uL, 2 × Reaction Buffer 5uL,
ddH2O 2.2uL, purpose PCR purified product 2uL are put into EP pipe and mix, and react 5min under the conditions of 22 DEG C, terminate postposition
In on ice, postorder transformation experiment is carried out.
3.3. the preparation of E. coli competent: using calcium chloride/glycerol method preparation, the specific steps are as follows:
(1) the Escherichia coli single colonie that LB plate picking newly activates, is inoculated in 3~5mL LB liquid medium, and 37 DEG C
Lower shaken cultivation is stayed overnight, then is inoculated in 100mL LB liquid medium, 37 DEG C of shaken cultivations to OD with 1:100600For 0.4~
0.6。
(2) culture solution is dispensed to 50mL sterile centrifugation tube, places l0min, 4 DEG C, 3,000g centrifugation 10min on ice.
(3) supernatant is abandoned, the 0.05M CaCl of pre-cooling is added2L0mL, gently suspension cell place 15~30min on ice, and 4
DEG C, 3,000g be centrifuged 5min.
(4) supernatant is abandoned, pre-cooling is added to contain the 0.05M CaCl of 15% glycerol22mL, gently suspension cell, be distributed into 100 or
The aliquot of person 200uL is stored in -80 DEG C of refrigerators.
3.4. connection product converts DH5 α competent cell: the connection product that this research is obtained using heat shock by 3.2
It is transferred in Bacillus coli cells, comprising the following steps:
(1) an aliquot competent cell suspension is taken from -80 DEG C of refrigerators, is immediately placed in and thaws on ice.
(2) appropriate purpose plasmid or connection product is added, mixes gently, places 30min on ice.
(3) 42 DEG C of water-bath thermal shock 60s, are immediately placed in 3~5min of cooled on ice.
(4) 1mL LB liquid medium, 37 DEG C of shaken cultivation 60min after mixing is added；
(5) after 3000rpm is centrifuged 5min, after removing supernatant to only residue 100uL, thallus is resuspended, is coated on and is contained
In the screening flat board of corresponding antibiotic, faces up and be placed in 37 DEG C of constant incubators after bacterium solution is cultured base absorption completely
It is inverted plate, cultivates 12~16h.
With the suspicious bacterium colony of 10uL pipette tips picking of sterilizing in LB liquid medium with ampicillin, shaken in 37 DEG C
12~16h is cultivated, appropriate bacterium solution is taken to make PCR identification, PCR amplification system such as table 2.
2 PCR amplification system of table
| Reagent | Volume |
| 2×Taq PCR star Mix | 10uL |
| Primers F | 1uL |
| Primer R | 1uL |
| DEPC water | 7uL |
| Bacterium solution | 1uL |
PCR response procedures: 94 DEG C of initial denaturation 5min；(94 DEG C of denaturation 1min；55 DEG C of annealing 1min；72 DEG C of extension 1min) altogether
30 circulations are run, 70 DEG C extend 10min, last 4 DEG C of preservations eventually.
3.5. positive bacterium solution saves the extraction with plasmid
PCR, which is accredited as positive bacterium solution, send Guangzhou Hua Da Genetic Biotechnologies Co., Ltd to carry out sequencing, passes through
Internet NCBI gene pool downloads pathogenic Rhodococcus equi VapA genetic fragment, using lasergene MegAlign software to survey
Sequence result carries out sequence alignment.
The correct positive bacterium solution part of sequencing is added to final concentration of 30% sterile glycerol, is put into -80 DEG C of preservations；Part
It expands culture, referring to the small extraction reagent kit of Tiangeng biochemical technology Co., Ltd rapid plasmid (TIANprep Rapid Mini
Plasmid Kit) operation instructions carry out plasmid extraction, the specific steps are as follows:
(1) bacterium solution for taking 1~4mL to be incubated overnight is added in centrifuge tube, 1min is centrifuged under 12,000rpm, is absorbed as far as possible
Bacterial sediment (can be collected into a centrifuge tube) by supernatant when bacterium solution is more by being repeatedly centrifuged.
(2) 150uL solution P1 is added into the centrifuge tube there are bacterial sediment (please first to check whether and RNase A has been added
And TIANRed), it is precipitated using pipettor or the thorough suspended bacterial of turbula shaker.
(3) 150 μ L solution P2 are added into centrifuge tube, leniently spinning upside down 6~8 times cracks thallus sufficiently.At this time
Bacterium solution becomes limpid sticky, may be excessive due to thallus if not becoming limpid, and cracking is not thorough, and should reduce biomass.
(4) 350 μ L solution P5 are added into centrifuge tube, rapidly turns upside down mixing 12~20 times, mixes well immediately,
To occur flocculent deposit at this time；12,000rpm is centrifuged 2min.
(5) supernatant that previous step is collected is transferred in adsorption column CP3 (adsorption column is put into collecting pipe) with pipettor,
Pay attention to trying not that precipitating is sucked out.Adsorption column CP3 is centrifuged 30s at 12,000rpm, outwells the waste liquid in collecting pipe, will adsorb
Column CP3 is put into collecting pipe.
(6) it is added 300 μ L rinsing liquid PWT (check whether and dehydrated alcohol has been added) into adsorption column CP3,12,000rpm
It is centrifuged 30s, the waste liquid in collecting pipe is outwelled, adsorption column CP3 is put into collecting pipe.
(7) adsorption column CP3 is put into collecting pipe, 12,000rpm centrifugation 1min, it is therefore an objective to by drift remaining in adsorption column
Washing lotion removal.
(8) adsorption column CP3 is placed in a clean centrifuge tube, 50~100uL is added dropwise to the intermediate position of adsorbed film
Plasmid solution is collected into centrifuge tube by elution buffer TB, 12000rpm centrifugation 30s.
(9) double digestion identification (such as Fig. 2) is carried out to the plasmid extracted using restriction enzyme EcoR I and Notl I,
The band of 3.2kb or so and the band of a 560bp or so are obtained, shows that VapA gene has been successfully connected to
In pZeroBack/blunt carrier.The plasmid is named as pZeroBack-VapA.
4, the building and identification of prokaryotic expression recombinant plasmid PMAL-VapA
By prokaryotic expression carrier PMAL-c5x and correct positive recombinant plasmid pZeroBack-VapA difference has been sequenced
Double digestion processing, digestion system such as table 3 are carried out with restriction enzyme EcoRI, Not I.
3 endonuclease reaction system of table
After mixing the digestion system in table 3, it is placed in 37 DEG C of 2~4h of water-bath.By carrier PMAL-C5x and recombinant plasmid
The digestion products of pZeroBack-VapA recycle purpose band, specific recycling step reference through 1% agarose gel electrophoresis
3.1。
PMAL-c5x the and VapA gene of recycling is connected in 16 DEG C of connection instrument overnight using T4DNA ligase, and
PMAL-VapA is transferred to prokaryotic expression bacterium BL21, is identified through bacterium solution PCR and sequencing, as a result such as Fig. 3.Sequencing result and reference
VapA gene order is completely the same, and contains correct EcoRI and NotI restriction enzyme site.The prokaryotic expression recombinant plasmid is named
For PMAL-VapA.
The expression of 2 soluble M BP-VapA recombinant protein of embodiment and the determination of optimum inductive condition
The BL21 bacterium solution for converting PMAL-VapA plasmid positive is inoculated in (the 50 μ g/ containing ampicillin in 1:100 ratio
Ml) in LB liquid medium, the 200r/min shaken cultivation in 37 DEG C of shaking tables.To bacterium solution OD600When value is 0.6 or so, by following
The Optimal Expression of method progress MBP-VapA recombinant protein.
1. the determination of inducing expression temperature
The IPTG that concentration is 1mM, and the shake culture under conditions of 10 DEG C, 15 DEG C, 20 DEG C, 28 DEG C and 37 DEG C is added
It is sampled to appropriate induction time.Sample is centrifuged 10min in 4000r/min, abandons supernatant, takes precipitating, and by precipitating original volume
1/10 deionized water is resuspended, and carries out SDS-PAGE, the expression of detection fusion albumen according to a conventional method.With BandScan (5.0
Version) software analysis swimming lane in protein content, with the best inducing expression temperature of determination.The result shows that (such as Fig. 4), with temperature by
The expression quantity of 10 DEG C of increase, VapA (59kDa) gradually increases, and reaches maximum in 15 DEG C and 20 DEG C inductions, then reduces.
BandScan analysis shows that, under conditions of 10 DEG C, 15 DEG C, 20 DEG C, 28 DEG C and 37 DEG C induce VapA albumen expression account for respectively
9.1%, 15.3%, 16.6%, 7.2%, the 2.7% of total swimming lane protein content shows that the amount of 20 DEG C of inducing expression VapA is maximum.
The determination of 2.IPTG induction time
Induction experiments are repeated, as transformed bacteria solution OD600When value is up to 0.6 or so, the IPTG that concentration is 1mM, 20 DEG C of inductions are added
Expression, samples in 0h, 2h, 4h, 8h, 12h, 16h, 20h and for 24 hours afterwards respectively.Sample is centrifuged 10min through 4000r/min, in abandoning
Clearly, and by the deionized water of precipitating original volume 1/10 it is resuspended, carries out SDS-PAGE detection, and analyze through BandScan, determine
The best induction time of IPTG.As a result (such as Fig. 5) is shown, is gradually increased with the extension VapA expression quantity of induction time, and in induction
Reach maximum expression quantity when 8h.Its BandScan analysis shows that, IPTG induces 0h, 2h, 4h, 8h, 12h, 16h, 20h and for 24 hours
VapA expressing quantity account for respectively total swimming lane protein content 0%, 14.3%, 21.3%, 31.4%, 31.5%, 26.5%,
21.2% and 12.3%.The result shows that the best induction time of IPTG is 8h.
The determination of 3.IPTG induced concentration
By above-mentioned best abductive approach, as transformed bacteria solution OD600When value is up to 0.6 or so, respectively with final concentration of 0mM,
The IPTG of 0.1mM, 0.3mM, 0.5mM, 0.7mM, 1.0mM and 1.4mM are sampled after 20 DEG C of inducing expression 8h.Sample is with 4000r/
Min is centrifuged 10min, abandons supernatant.It collects bacterial sediment and is resuspended with the deionized water of original volume 1/10, carry out SDS-PAGE detection
And analyzed through BandScan, determine the best induced concentration of IPTG.As a result (such as Fig. 6) is shown, visually observes the expression of VapA albumen
Do not change with the variation of IPTG induced concentration.But BandScan is analysis shows that VapA expressing quantity divides in IPTG concentration
Not Wei 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM, 1.0mM and 1.4mM when, account for respectively total swimming lane protein content 0%,
26.9%, 31.3%, 30.3%, 32.4%, 27.9% and 24.8%.It is shown as increasing with the increase of IPTG induced concentration
Add, then declines until 0.7mM reaches highest.The optium concentration for indicating IPTG induction VapA expression is 0.7mM.
4. the identification of the VapA albumen state of recombinant expression
Applicants experimentally found that when the expression of IPTG induction VapA recombinant protein, what different temperature expressed it
The state tool of VapA albumen has a certain impact.Using best IPTG concentration and induction time respectively at 20 DEG C, 28 DEG C and 37 DEG C
The VapA albumen of expression is detected under the conditions of temperature.It samples bacterium solution sample and is centrifuged 10min in 4000r/min, abandon supernatant, take
Precipitating.Precipitating is resuspended with 1/10 sample-loading buffer of original volume, and with ultrasonic smudge cells under conditions of ice bath
10min.It is centrifuged through 4 DEG C, 12000r/min 20min.SDS-PAGE is carried out according to a conventional method, and detection supernatant (contains solubility expression
Albumen) and precipitating (containing inclusion body expression albumen) in albumen expression.
Test result (such as Fig. 8) display, before induction, the ultrasonication supernatant of 20 DEG C of inducing expression products precipitating, 28 DEG C
The ultrasonication supernatant of inducing expression product precipitates and 37 DEG C of inducing expression product ultrasonication supernatants precipitate interior VapA
Expressing quantity accounts for 0%, 8.9%, 10.1%, 2.4%, 5.3%, 0% and the 5.6% of total swimming lane protein content respectively.It lures above
It leads expression product to detect through ultraviolet spectrometry degree meter, concentration is respectively as follows: 3.0,8.3,1.5,5.3,3.2,6.5,2.7mg/mL.Table
Bright, the expression quantity of destination protein is maximum under the conditions of 20 DEG C of inducing expressions and the overwhelming majority is solubility expression.Meanwhile it most preferably luring
Under the conditions of leading, inducing expression is repeatedly carried out, the supernatant of product ultrasonic treatment bacterium and precipitating are subjected to SDS-PAGE electrophoresis mirror
Surely show that the recombinant protein overwhelming majority has (Fig. 7) in soluble form.
5. the non denatured purifying of solubility recombination VapA albumen
BL21 bacterium solution containing positive plasmid (PMAL-VapA) is inoculated in the training of 200ml LB liquid in the ratio of 1:100
It supports in base (the 50 μ g/ml containing ampicillin), in 37 DEG C of shaken cultivations to OD600When about 0.6 or so, addition concentration is 0.7mM
IPTG, 20 DEG C of induction 8h, using NEB company Amylose Resin product (E8021) to expression albumen purify.Reference
Specification carries out, and concrete operations are as follows:
(1) albumen slightly mentions
Bacterium solution after inducible protein is expressed, 4000g are centrifuged 10min, collect thallus.(column is resuspended with pillar buffer 20mL
Sub- buffer dosage is the 1/10 of original bacteria liquid volume), it is stored in -20 DEG C.When purifying protein, places it in cold water and thaw, and
In ice-water bath, with the broken of 4s, the interval of 5s carries out sonicated cells.The broken albumen until being discharged of continual ultrasonic
Matter reaches maximum, until bacteria suspension becomes clarification.
Broken rear bacterium solution is centrifuged 20min at 4 DEG C, under the conditions of 12000rpm, the supernatant of acquisition is protein crude extract administration.
(2) affinity chromatography
A. the preparation of pillar: by 1mL amylose media filler in the pillar that specification is 1.0x10cm.With 5 times of pillars
The pillar buffer of volume rinses pillar.
B. upper prop: the amount of medium determines the amount of fused protein, and every milliliter of bed volume is in combination with 6~8mg fusion protein
Matter estimates loading volume according to the expression quantity of destination protein.Control maximum linear flow velocity is 24cm/h, i.e. 0.3mL/min.Flow velocity
Calculation are as follows: linear flow rate (cm/h) × π r=volume flow rate (mL/h).
C. it elutes: washing pillar with the pillar buffer of 10 times of medium volumes, then eluted with the pillar of 10 times of medium volumes
Liquid elutes destination protein, collects 10 components with every component 1mL, measures every component destination protein using micro-spectrophotometer
Amount, 1-6 collection liquid are respectively as follows: 2.3,1.7,1.5,1.2,0.7 and 0.3mg/ml, and 7-10 collection liquid protein concentration is 0.
Protein liquid is detected with SDS-PAGE after purification, carries out analysis recombination to SDS-PAGE picture using Bandscan software
The purity of VapA albumen is 83.7%.
6. recombinating the antigenicity analysis of VapA albumen
It is detected with antigenicity of the Western blot to the recombination VapA albumen of purifying, the specific steps are as follows:
(1) being placed in the SDS-PAGE of VapA albumen in transfer plate, cuts a size as PAGE gel
6 3mm filter paper and 1 nitrocellulose filter, be soaked in transfering buffering liquid about 15min or so, with drive away stay in filter membrane
On bubble.
(2) upward, cathode is respectively 3 filter paper up and down in bottom to anode, and PAGE gel is had on NC film by filter paper
Package, and guarantee bubble-free.
(3) electrotransfer is installed, 30min is shifted with constant current 150mA.
(4) plus 10ml confining liquid (TBS containing 8%~10% skimmed milk power), 4 DEG C of closings are stayed overnight.
(5) confining liquid then is sopped up, is washed three times with TBST, each 5min.
(6) with horse positive serum (the Gluck Equine Research of the diluted anti-Rhodococcus equi VapA albumen of 1:100
Center present) it is used as primary antibody, 37 DEG C of effect 2h
(7) reaction liquid is abandoned, washes 15min, each 5min altogether with TBST.
(8) last again with 1h is acted under the conditions of 37 DEG C of goat-anti horse IgG Fab'2-HRP ELIAS secondary antibody (LSBio company), together
Sample is washed 3 times, preservation of finally taking pictures again.Western-blot testing result (such as Fig. 9) display, the recombinant protein (59kDa) of purifying
It can show that the recombinant protein has good immunogen by the horse positive serum specific recognition of anti-Rhodococcus equi VapA albumen
Property.
Because expression quantity of the VapA albumen in Rhodococcus equi be not high, with the purification VapA albumen directly from Rhodococcus equi
(Julien Cauchard, 2004) is compared, and the present invention is more safe and efficient as expression bacterium tool production using non-pathogenic bacteria
Feature；It is compared, the method for the invention table secondly, synthesizing VapA albumen (Julien Cauchard, 2006) with artificial amino acid
The VapA amino acid sequence reached can complete normal folding, processing and modification, shape by natural bacteria Protein processing factory
At the natural structure form closer to Rhodococcus equi VapA albumen.Finally, the expression phase with the VapA albumen reported
Than the albumen that this method gives expression to is soluble protein, rather than inclusion body protein.The soluble VapA egg of the method for the present invention expression
It is white that there is better protein active and immunogenicity, moreover, the VapA activity with higher that WB verifying is expressed.Though in addition,
The recombinant protein amount so expressed in the form of inclusion body protein is usually larger, but because its working process process is cumbersome and need to be through denaturation side
Formula purifying, is not particularly suited for industrial application.In contrast, the present invention is purified using non-deformed method and recombinates egg to VapA
White activity influence is smaller and process is simple, easy to operate, is more suitable for commercialization and produces in enormous quantities.
SEQUENCE LISTING
<110>Agricultural University Of South China
<120>a kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen
<130>
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 44
<212> DNA
<213>primers F
<400> 1
aaggaaaaaa gcggccgcat gaagaccctg cacaagacgg tctc 44
<210> 2
<211> 34
<212> DNA
<213>primer R
<400> 2
ccggaattcc taagcgttgt gccaactacc cgag 34
Claims (3)
1. a kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen, which is characterized in that amplification VapA gene, and
It is cloned on pMAL-c5x carrier, pMAL-VapA is converted to prokaryotic expression bacterium, passed through by construction of expression vector pMAL-VapA
IPTG is induced at 20 DEG C obtains solubility VapA albumen；Specifically includes the following steps:
S1. the building of recombinant plasmid pMAL-VapA: the primer amplification VapA base described in SEQ ID NO:1 and SEQ ID NO:2
Cause, amplified production is connected with pZeroBack/blunt carrier building plasmid pZeroBack-VapA；Finally by pMAL-c5x and
Correct pZeroBack-VapA is sequenced and carries out construction of expression vector pMAL-VapA after double digestion；
S2. pMAL-VapA is transformed into BL21 bacterium, sequencing is accredited as after the positive, and bacterium solution is inoculated in culture medium, is trained
It supports to OD600After value is 0.5~0.7, after IPTG induction is added, thallus is resuspended in centrifugation, is crushed thallus, collects supernatant, is obtained solvable
Property VapA albumen；
The sequence of the VapA gene is shown in GenBank JN990991.1.
2. the method according to claim 1, wherein the concentration of IPTG induction is 0.3~0.7mM, induction time
For 8~12h.
3. according to the method described in claim 2, it is characterized in that, the concentration of IPTG induction is 0.7mM, induction time 8h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510273219.3A CN104862331B (en) | 2015-05-26 | 2015-05-26 | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510273219.3A CN104862331B (en) | 2015-05-26 | 2015-05-26 | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104862331A CN104862331A (en) | 2015-08-26 |
| CN104862331B true CN104862331B (en) | 2019-01-11 |
Family
ID=53908507
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510273219.3A Active CN104862331B (en) | 2015-05-26 | 2015-05-26 | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104862331B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241127A (en) * | 2019-06-05 | 2019-09-17 | 开平牵牛生化制药有限公司 | The building and application of phospholipase A2 and its recombinant cell, recombinant cell after a kind of codon optimization |
| CN114591841B (en) * | 2022-03-02 | 2024-01-30 | 吉林大学 | Rhodococcus equi and application thereof in preparation of inactivated vaccine |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012009774A2 (en) * | 2010-07-22 | 2012-01-26 | Hanna Ebert Seixas | Recombinant microorganisms, methods for preparing vaccine strains, antigens, and vector vaccine compositions of same, uses thereof, and related antibodies, diagnostic kit, and treatment and/or prophylactic methods |
-
2015
- 2015-05-26 CN CN201510273219.3A patent/CN104862331B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012009774A2 (en) * | 2010-07-22 | 2012-01-26 | Hanna Ebert Seixas | Recombinant microorganisms, methods for preparing vaccine strains, antigens, and vector vaccine compositions of same, uses thereof, and related antibodies, diagnostic kit, and treatment and/or prophylactic methods |
Non-Patent Citations (3)
| Title |
|---|
| Immunity to Rhodococcus equi: antigen-specifc recall responses in the lungs of adult horses;Melissa T. Hines 等;《Veterinary Immunology and Immunopathology》;20011231;第103页最后1段 |
| JN990991.1;Aaid,R.K.等;《GENBANK》;20140131;1 |
| 马红球菌VapA蛋白的表达及其间接ELISA检测方法的建立;龚凤平 等;《中国预防兽医学报》;20160331;第38卷(第3期);235-239 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104862331A (en) | 2015-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104593346A (en) | Endolysin from vibrio parahaemolyticus phage and application of endolysin | |
| CN103694321B (en) | Streptococcus aureus mSEB mutant and its preparation method and application | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN106754981B (en) | Method for preparing gosling plague virus-like particles by using escherichia coli system | |
| CN109536522A (en) | A kind of preparation and application of the prokaryotic expression, polyclonal antibody of southern rice black-streaked dwarf virus P6 albumen | |
| CN106008678B (en) | Fusion protein for inhibiting clostridium perfringens infection and related biological material and application thereof | |
| CN103725697B (en) | The surface protein FnBPA genetic fragment of the staphylococcus aureus of chemosynthesis and expression, application | |
| CN102898511B (en) | Purification method in preparation of methicillin staphylococcus aureus-resistant recombinant genetic engineering vaccine candidate antigen I12C | |
| CN103059117A (en) | High throughput screening of important schistosoma japonicum antigens and application of antigens in schistosomiasis diagnosis | |
| CN105734001A (en) | O antigen carbohydrate chain elongation salmonella paratyphi A and use thereof | |
| CN104888208B (en) | The application of Rhodococcus equi Disease-causing gene VapA recombinant proteins | |
| CN104109704A (en) | Method for separating and purifying recombinant porcine circovirus capsid protein inclusion body | |
| CN105018510B (en) | A method of it improves immune soluble with fmd protein | |
| CN102993278A (en) | Purification method of methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen FnbA1 | |
| CN104789513B (en) | A kind of coli strain for preparing bioactive peptide | |
| CN104865380B (en) | A kind of test kit detecting Rhodococcus equi disease | |
| CN102898512A (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN1641034B (en) | Method for preparing tetanus toxin recombinant antigen and its use | |
| CN112409495A (en) | Streptococcus suis recombinant ZSD recombinant subunit vaccine, recombinant epitope prokaryotic plasmid, preparation and application | |
| CN102993300B (en) | Duck tembusu virus polyclonal antibody and preparation method thereof | |
| CN105999252B (en) | Fusion protein vaccine for inhibiting clostridium perfringens infection | |
| CN106008719B (en) | Preparation method of fusion protein for inhibiting clostridium perfringens infection | |
| CN106267179A (en) | A kind of preparation method of escherichia coli outer membrane protein vaccine | |
| CN103044531B (en) | Purification method of methicillin-resistant staphylococcus aureus (MREA)-resistant vaccine recombinant protein antigen HI2 | |
| CN104292310B (en) | Duck plague virus UL15 gene exonI recombinant proteins and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Shoujun Inventor after: Gong Fengping Inventor after: Sun Lingshuang Inventor after: Jia Kun Inventor before: Sun Lingshuang Inventor before: Gong Fengping Inventor before: Li Shoujun |
|
| COR | Change of bibliographic data | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |