CN104865380B - A kind of test kit detecting Rhodococcus equi disease - Google Patents

Abstract

The invention belongs to biological technical field, specifically disclose a kind of test kit detecting Rhodococcus equi disease, described test kit includes as immunogenic Rhodococcus equi Disease-causing gene VapA recombiant protein MBP VapA, its aminoacid sequence is as shown in SEQ ID NO:1, and used MBP VapA albumen is closer to the character of Rhodococcus equi Disease-causing gene VapA.Detecting with this test kit, highly sensitive, high specificity, repeatability and stability are all fine, have the clinical practice meaning of reality.

Description

A kind of test kit detecting Rhodococcus equi disease

Technical field

The present invention relates to biological technical field, detect, more particularly, to a kind of, the test kit that Rhodococcus equi is sick.

Background technology

Rhodococcus equi belongs to Rhod, is the conditionality pathogenic bacterium of a kind of infecting both domestic animals and human.This pathogen is prevalent in certainly So in ambient soil, investigation shows, 50～95% farm soil in there is this bacterium.Rhodococcus equi can infect people, causes breathing Road infection symptoms.This disease is also one of children's modal disease of colt in age, and sickness rate is up to 80%.The colt that catches an illness is typically chronic Or subacute bronchopneumonia symptom, occur together cecocolon and mesenteric lymph node ulcer sometimes.

All the time about the mechanism of causing a disease of Rhodococcus equi unclear, study discovery as of late, cause this cytotoxin It is crucial that whether it contains a pathogenic related plasmids.This plasmid contains the genetic coding DNA of 85～90kb, codified The toxicity lipoprotein of multiple high immunogenicities.Wherein, toxicity associated protein A (VapA) is its main expressing protein.In a large number Research shows, the toxicity of Rhodococcus equi is closely related with Vap A.At present, though there being the report of part restructuring VapA protein expression Road, but its albumen expressed is many presented in inclusion body, it is more difficult to it is applied to medical diagnosis and the exploitation for the treatment of product of reality And application.

Summary of the invention

The technical problem to be solved is the defect overcoming prior art to exist, it is provided that Rhodococcus equi Disease-causing gene The test kit of VapA albumen and application.

It is an object of the invention to be achieved by the following technical programs:

A kind of ELISA kit detecting Rhodococcus equi disease, described test kit includes as immunogenic Rhodococcus equi Disease-causing gene VapA recombiant protein MBP-VapA, its aminoacid sequence is as shown in SEQIDNO:1.

Preferably, described test kit also includes that being suitable to MBP-VapA occurs with anti-Rhodococcus equi Disease-causing gene VapA antibody The detectable of antigen antibody reaction.

Specifically, described test kit can also include being coated with the solid phase carrier of MBP-VapA, enzyme labelled antibody.

It addition, test kit of the present invention also includes that confining liquid, cleaning mixture, nitrite ion, stop buffer, the positive and feminine gender are right According to.

Wherein, described negative control is tire horse serum, and positive control is the adult horse blood of Rhodococcus equi inactivated vaccine immunity Clearly, enzyme labelled antibody is goat-anti horse IgGFab'2-HRP.

The present invention passes through optimization experiment, it is thus achieved that the concentration that is coated of the parameter of optimal ELISA kit: MBP-VapA is 0.125ug/mL, negative control and positive control serum dilution factor are 1:400, and goat-anti horse IgGFab'2-HRP dilution factor is 1:20000, confining liquid is 0.5%PVA.

The present invention also provides for a kind of preparation method detecting the sick ELISA kit of Rhodococcus equi, comprises the following steps:

The most immunogenic prepare as follows: amplification VapA gene, and be cloned on PMAL-C5x carrier, construction of expression vector PMAL-VapA, converts PMAL-VapA to prokaryotic expression bacterium, is induced by IPTG, obtained after purification at 20 DEG C Recombiant protein MBP-VapA；

Preparation enzyme labelled antibody goat-anti horse IgG Fab'2-HRP, negative control tire horse serum, the inactivation of positive control Rhodococcus equi the most respectively The mature horses serum of vaccine immunity and confining liquid PVA obtain ELISA kit.

Rhodococcus equi Disease-causing gene VapA albumen is important toxic protein, less about the research of this albumen in prior art. The Rhodococcus equi Disease-causing gene VapA albumen being typically purified into is many presented in inclusion body, thus limit its actual should With.Applicant is by a large amount of exploration discoveries: be connected with PMAL-C5x carrier by VapA gene, and coordinates the induction of 20 DEG C Temperature can give expression to the VapA albumen that great amount of soluble is expressed.

The present invention uses PMAL-C5x carrier, and it can promote the solubility expression of recombinant expression protein, experimentation table Bright, inclusion bodies expression recombiant protein affects its amino acids fold and forms three grades of normal protein, the shape of level Four topological structure Become, and then affect antigenicity and the biological activity of recombinant expression protein.This research uses PMAL-C5x to be carrier first, right The Disease-causing gene VapA of Rhodococcus equi is recombinated, it is thus achieved that recombiant plasmid PMAL-VapA.

It addition, inventor is found through experiments, only use PMAL-C5x carrier, the solubility table to VapA albumen Although reaching and having facilitation, but act on and inconspicuous, it is necessary to low temperature induction to be coordinated, VapA albumen can be made in a large number may be used Dissolubility is expressed.Inventor have studied multiple inducing temperature to be affected the expression of VapA albumen, and result shows, only when 20 DEG C The VapA albumen of substantial amounts of solubility can be obtained.

The present invention obtains, by said method, the VapA albumen that great amount of soluble is expressed and activity is good, and this albumen has well Immunogenicity, the MBP-VapA obtained by the present invention is closer to the character of Rhodococcus equi Disease-causing gene VapA.

Preferably, in the preparation method of MBP-VapA, described prokaryotic expression bacterium is being cultivated to OD₆₀₀Value is 0.5～0.7 After, add IPTG and induce；It is furthermore preferred that prokaryotic expression bacterium is being cultivated to OD₆₀₀Value is to add IPTG after 0.6 to carry out Induction.

Preferably, the concentration of IPTG of the present invention induction is 0.3～0.7mM, and induction time is 8～12h.

It is highly preferred that it is found by the applicant that described prokaryotic expression bacterium is under 20 DEG C of cultivations, IPTG induced concentration is 0.7mM, and When induction time is 8h, the expression of VapA albumen is the highest, and mostly is solubility expression.

Preferably, in the preparation method of test kit of the present invention, the concentration that is coated of recombiant protein MBP-VapA is 0.125ug/mL, negative control and positive control serum dilution factor are 1:400, and goat-anti horse IgG Fab'2-HRP dilution factor is 1:20000, confining liquid is 0.5%PVA.

Specifically, the preparation method of recombiant protein MBP-VapA comprises the following steps:

S1. the structure of recombiant plasmid PMAL-VapA: primer amplification described in design SEQ ID NO:2 and SEQ ID NO:3 VapA gene, be connected with pZeroBack/blunt carrier structure plasmid pZeroBack-VapA by VapA gene；Finally will PMAL-c5x and the correct pZeroBack-VapA that checks order carries out construction of expression vector PMAL-VapA after double digestion；

S2. PMAL-VapA is transformed in BL21 bacterium, after order-checking is accredited as the positive, bacterium solution is inoculated in culture medium, training Support to OD₆₀₀Value is 0.5～0.7, after adding IPTG induction, and centrifugal resuspended thalline, broken thalline, collect supernatant, it is thus achieved that Solubility VapA albumen.

S3. supernatant carries out affinity chromatograph by amylose resin, it is thus achieved that albumen after purification.

Preferably, in S2, prokaryotic expression bacterium is being cultivated to OD₆₀₀Value is to add IPTG after 0.6 to induce.

Compared with prior art, beneficial effects of the present invention is as follows:

The invention provides a kind of test kit detecting Rhodococcus equi disease, described test kit includes causing as immunogenic Rhodococcus equi Ospc gene VapA recombiant protein MBP-VapA, its aminoacid sequence is as shown in SEQ ID NO:1.Carry out with this test kit Detection, highly sensitive, high specificity, repeatability and stability are all fine, detect clinical sample, and recall rate is for being often much higher than Rule detection, has the clinical practice meaning of reality.

Accompanying drawing explanation

Fig. 1 is the PCR amplification figure of VapA gene；Wherein, 1:VapA；2:ddH₂O compares；M:2000bp DNA molecular amount standard.

Fig. 2 is that the enzyme action of restructuring cloned plasmids pZeroBack-VapA is identified；Wherein, 1:pZeroBack-VapA restructuring EcoR I and the Not I double digestion product of plasmid；The DNA molecular amount standard of M:5000bp.

Fig. 3 is the order-checking qualification result of recombinant expression plasmid PMAL-VapA；Underscore position is respectively Not I and EcoR The restriction enzyme site sequence of I.

Fig. 4 is the different inducing temperature impacts on expressing quantity；Wherein, M: Protein Marker；1:IPTG lures The protein expression of leading；2-6: the protein expression of induction at a temperature of 10 DEG C, 15 DEG C, 20 DEG C, 28 DEG C and 37 DEG C respectively.

Fig. 5 is the different IPTG induction time impacts on expressing quantity；Wherein, M: Protein Marker；1-8 It is respectively the protein expression that IPTG induces 0,2,4,8,12,16,20 and 24 hours.

Fig. 6 is the different IPTG concentration impacts on induced protein expression；Wherein, M: Protein Marker；1- 7:IPTG concentration is respectively as follows: 0,0.1,0.3,0.5,0.7,1.0 and 1.4mM.

Fig. 7 is the albumen expressed after 0.7mM IPTG induction 8h at 20 DEG C；Wherein, M: Protein Marker； 1: the protein expression of BL21 antibacterial before induction；2: the protein expression of BL21 antibacterial after induction；3 convert empty expression vector Protein expression before the BL21 induction of PMAL-C5x；4: convert albumen after the BL21 induction of empty expression vector PMAL-C5x Express；5: convert protein expression before the L21 induction of null representation plasmid PMAL-VapA；6: convert expression plasmid PMAL- Protein expression after the BL21 induction of VapA；7: the VapA albumen after affinitive layer purification；8: abduction delivering VapA BL21 bacterium solution ultrasonication supernatant (containing soluble express protein) of albumen；9: the BL21 bacterium of abduction delivering VapA albumen Liquid ultrasonication precipitation (containing inclusion body expressing protein).

Fig. 8 is the state analysis of the VapA albumen of different temperatures abduction delivering；M: Protein Marker；1:IPTG The protein expression of BL21 (containing PMAL-VapA) is converted before induction；2 and 3 are respectively as follows: the ultrasonic of 20 DEG C of abduction delivering products Broken supernatant (containing soluble express protein) and precipitation (containing inclusion body expressing protein)；4 and 5 are respectively as follows: 28 DEG C of induction tables Reach cleer and peaceful precipitation in the ultrasonication of product；Cleer and peaceful precipitation in 6 and 7 ultrasonications being respectively as follows: 37 DEG C of abduction delivering products.

Fig. 9 is the Western-blot analysis result of VapA albumen after purification；Wherein, 1: the VapA albumen of purification； M: Protein Marker.

Figure 10 is the Dot elisa assay of MBP-VapA recombiant protein, and wherein, 1 to 3 hole is BSA, protein concentration It is respectively as follows: 0.1mg/mL, 0.025mg/mL, 0.00625mg/mL；4 holes are PBS control, and 5 holes are Rhodococcus equi (ATCC33701) lysate positive control；6 to 8 holes be VapA protein concentration be respectively 0.1mg/mL, 0.025mg/mL、0.00625mg/mL。

Figure 11 is antigen-antibody dilution factor figure.

Figure 12 is HRP ELIAS secondary antibody dilution factor optimum results figure.

Detailed description of the invention

Further illustrate present disclosure below in conjunction with Figure of description and specific embodiment, but should not be construed as this Bright restriction.Without departing from the spirit and substance of the case in the present invention, simply repaiied what the inventive method, step or condition made Change or replace, belonging to the scope of the present invention；If not specializing, technological means used in embodiment is people in the art Conventional means known to Yuan.

The structure of embodiment 1 prokaryotic expression recombiant plasmid PMAL-VapA and qualification

1, the recovery of Rhodococcus equi and cultivation: buying and be preserved in American Type Culture Collecti, preserving number is the horse of ATCC 33701 Rhodococcus fascians, according to the rules operating process recovery Rhodococcus equi.

2, design of primers: according to Rhodococcus equi Disease-causing gene VapA sequence (JN990991.1) in NCBI gene bank and PZeroBack/blunt and PMAL-C5x carrier restriction enzyme site, uses OLigo6.0 software, designs a pair band restriction enzyme site Primer (is synthesized by Shanghai Ying Weijieji Bioisystech Co., Ltd), and primer sequence is as follows:

F:AAGGAAAAAAGCGGCCGC(underscore is ATGAAGACCCTGCACAAGACGGTCTC NotI restriction enzyme site)

R:CCGGAATTCCTAAGCGTTGTGCCAACTACCCGAG (underscore is EcoR I restriction enzyme site)

3, the PCR of VapA gene expands and clone

3.1. with reference to Fast HiFideLity PCRKit explanation amplification VapA gene, reaction system such as table 1.

Table 1 PCR reaction system

Reagent	Volume
		Fast HiFideLity PoLymerase	1uL
5×Fast HiFideLity PCR Buffer	10uL
		20×Fast PCR Enhancer	2.5uL
DEPC water	33.5uL
		Primers F	1uL
Primer R	1uL
		ATCC 33701 bacterium solution	1uL
Cumulative volume	50uL

Response procedures: 94 DEG C of denaturations 2min；(94 DEG C of degeneration 30s；55 DEG C of annealing 30s；68 DEG C extend 30s) transport altogether Row 30 circulation, 68 DEG C extend 5min, last 4 DEG C of preservations, result such as Fig. 1 eventually.

Test kit (TIANgeL Midi is reclaimed with reference to Tian Gen biochemical technology company limited plain agar sugar gel DNA Purification Kit) operation instructions carry out the recovery of PCR primer, purification, method is as follows:

(1) the EP pipe of 1.5mL is got out, by the product after PCR amplification with 1% agarose gel (containing 0.5 μ g/mL EB) carry out electrophoresis, under ultraviolet irradiates, cut the gel containing genes of interest (563bp), and put into ready In EP pipe, weigh weight.

(2) column equilibration step: (adsorption column puts into collection in adsorption column CA2 (adsorption column have passed through pre-treatment the same day) In pipe) add the balance liquid BL of 500 μ L.12,000rpm is centrifuged 1min.Outwell the waste liquid in collecting pipe, and will absorption Post CA2 places back in collecting pipe.

(3) in blob of viscose add equimultiple bulk solution PN (if gel is heavily 0.1g, its volume can be considered 100 μ L, Then add 100 μ L PN solution), it is placed in 50 DEG C of water-bath incubations.Constantly leniently spin upside down centrifuge tube, to guarantee therebetween Blob of viscose fully dissolves, if also having the most molten blob of viscose, can continue place a few minutes or add some PN solution again, until blob of viscose Being completely dissolved (if the volume of blob of viscose is excessive, in advance blob of viscose can be cut into fragment), solution temperature is down to after being completely dissolved by blob of viscose Room temperature upper prop again.

(4) by the adsorption column CA2 after step (3) gained solution addition step (2) balance, (adsorption column is put into In collecting pipe).After room temperature places 2min, 12,000rpm are centrifuged 60s.Outwell the waste liquid in collecting pipe, and will absorption Post CA2 puts in collecting pipe.Adsorption column volume is 800 μ L, if sample volume can be dividedly in some parts more than 800 μ L.

(5) in adsorption column CA2, add 600 μ L rinsing liquid PW (need before use first to check whether and added nothing Water-ethanol), stand 2～5min.12,000rpm are centrifuged 30～60s, outwell the waste liquid in collecting pipe, and by adsorption column CA2 puts in collecting pipe.

(6) repetitive operation step (5).

(7) putting back in collecting pipe by adsorption column CA2,12000rpm is centrifuged 2min, by the rinsing liquid in collecting pipe PW removes.Adsorption column CA2 is placed in room temperature and places several minutes, dry up hill and dale, to prevent the rinsing liquid of residual from affecting next The experiment of step.

(8) adsorption column CA2 is put in a clean centrifuge tube, the unsettled dropping 40uL to adsorbed film centre position ddH₂O, room temperature places 2min.12,000rpm are centrifuged 2min collects DNA solution, is again added by the centrifugal solution obtained In resorption attached column, room temperature places 2min, and 12,000rpm are centrifuged 2min, are collected in centrifuge tube by DNA solution.DNA Product is saved in-20 DEG C, in case DNA degradation.

3.2.PCR product and the connection of pZeroBack/blunt carrier

With reference to zero background rapid ligation kit (ZeroBack Fast Ligation Kit) description, coupled reaction system is as follows: take PZeroBack/blunt carrier 0.3uL, T4DNA Ligase 0.5uL, 2 × Reaction Buffer 5uL, ddH₂O 2.2uL, purpose PCR purified product 2uL put in EP pipe and mix, and react 5min under the conditions of 22 DEG C, terminate to be placed on On ice, postorder transformation experiment is carried out.

3.3. the preparation of E. coli competent: use calcium chloride/glycerol method to prepare, specifically comprise the following steps that

(1) the escherichia coli list bacterium colony that LB flat board picking newly activates, is inoculated in 3～5mL LB fluid mediums, shakes at 37 DEG C Swing overnight incubation, then be inoculated in 100mL LB fluid medium with 1:100,37 DEG C of shaken cultivation to OD₆₀₀Be 0.4～ 0.6。

(2) by culture fluid subpackage to 50mL sterile centrifugation tube, placing l0min on ice, 4 DEG C, 3,000g is centrifuged 10 min。

(3) abandon supernatant, add the 0.05M CaCl of pre-cooling₂L0mL, gently suspension cell, on ice place 15～ 30min, 4 DEG C, 3,000g is centrifuged 5min.

(4) abandon supernatant, add the pre-cooling 0.05M CaCl containing 15% glycerol₂2mL, gently suspension cell, be distributed into 100 Or the aliquot of 200uL, is stored in-80 DEG C of refrigerators.

3.4. connect product and convert DH5 α competent cell: the connection that this research uses heat shock to obtain 3.2 is produced Thing proceeds to, in Bacillus coli cells, comprise the following steps:

(1) take an aliquot competent cell suspension from-80 DEG C of refrigerators, be immediately placed in and thaw on ice.

(2) add appropriate purpose plasmid or connect product, mixing gently, place 30min on ice.

(3) 42 DEG C of water-bath thermal shock 60s, are immediately placed in cooled on ice 3～5min.

(4) add 1mL LB fluid medium, mix rear 37 DEG C of shaken cultivation 60min；

(5), after 3000rpm is centrifuged 5min, supernatant is removed to after only remaining 100uL, resuspended thalline, coated and contained On the screening flat board of corresponding antibiotic, face up and be positioned in 37 DEG C of constant incubators after bacterium solution is cultured base absorption completely It is inverted flat board, cultivates 12～16h.

Suspicious bacterium colony is taken in the LB fluid medium containing ampicillin, in 37 DEG C with the 10uL rifle choicest of sterilizing Shaken cultivation 12～16h, takes appropriate bacterium solution and makees PCR qualification, PCR amplification system such as table 2.

Table 2 PCR amplification system

Reagent	Volume
		2×Taq PCR star Mix	10uL
Primers F	1uL
		Primer R	1uL
DEPC water	7uL
		Bacterium solution	1uL

PCR response procedures: 94 DEG C of denaturations 5min；(94 DEG C of degeneration 1min；55 DEG C of annealing 1min；72 DEG C extend 1 Min) running 30 circulations altogether, 70 DEG C extend 10min, last 4 DEG C of preservations eventually.

3.5. positive bacterium solution preserves and the extraction of plasmid

The bacterium solution that PCR is accredited as the positive send Guangzhou Hua Da Genetic Biotechnologies company limited to carry out sequencing, passes through the Internet NCBI gene bank downloads pathogenic Rhodococcus equi VapA genetic fragment, uses lasergene MegAlign software to order-checking knot Fruit carries out sequence alignment.

Positive bacterium solution part correct for order-checking is added the sterile glycerol of final concentration of 30%, puts into-80 DEG C of preservations；Part It is enlarged cultivating, with reference to the Tian Gen biochemical technology company limited little extraction reagent kit of rapid plasmid (TIANprep Rapid Mini Plasmid Kit) operation instructions carry out plasmid extraction, specifically comprise the following steps that

(1) taking the bacterium solution of 1～4mL incubated overnight, add in centrifuge tube, in 12, under 000rpm, centrifugal 1min, inhales as far as possible Except supernatant (bacterial sediment can be collected in a centrifuge tube by repeatedly centrifugal when bacterium solution is more).

(2) in the centrifuge tube leave bacterial sediment, add 150uL solution P1 (the most first to check whether and added RNase A and TIANRed), use pipettor or turbula shaker thorough suspended bacterial precipitation.

(3) in centrifuge tube, add 150 μ L solution P2, leniently spin upside down 6～8 times and make thalline fully split Solve.Now bacterium solution becomes limpid thickness, if not becoming limpid, is likely to be due to thalline too much, and cracking is not thorough, should reduce bacterium The scale of construction.

(4) in centrifuge tube, add 350 μ L solution P5, mixing 12～20 times of turning upside down the most rapidly, fill Divide mixing, now will appear from flocculent deposit；12,000rpm is centrifuged 2min.

(5) the supernatant pipettor that previous step is collected is transferred in adsorption column CP3 that (adsorption column puts into collecting pipe In), note sucking-off precipitation of trying not.Adsorption column CP3,12, is centrifuged 30s under 000rpm, outwell giving up in collecting pipe Liquid, puts into adsorption column CP3 in collecting pipe.

(6) in adsorption column CP3, add 300 μ L rinsing liquid PWT (check whether and add dehydrated alcohol), 12,000rpm are centrifuged 30s, outwell the waste liquid in collecting pipe, are put in collecting pipe by adsorption column CP3.

(7) putting in collecting pipe by adsorption column CP3,12,000rpm are centrifuged 1min, it is therefore an objective to by residual in adsorption column Remaining rinsing liquid is removed.

(8) adsorption column CP3 is placed in a clean centrifuge tube, to the middle part of adsorbed film dropping 50～ 100uL elution buffer TB, 12000rpm is centrifuged 30s and is collected in centrifuge tube by plasmid solution.

(9) utilize restricted enzyme EcoR I and Notl I that the plasmid extracted is carried out double digestion qualification (such as figure 2), it is thus achieved that the band of an about 3.2kb and the band of an about 560bp, show that VapA gene is successfully connected to In pZeroBack/blunt carrier.By named for this plasmid pZeroBack-VapA.

4, the structure of prokaryotic expression recombiant plasmid PMAL-VapA and qualification

By prokaryotic expression carrier PMAL-c5x and the correct positive recombiant plasmid pZeroBack-VapA that checked order respectively with limiting Property restriction endonuclease EcoRI, Not I carries out double digestion process, enzyme action system such as table 3.

Table 3 endonuclease reaction system

After enzyme action system in mixing table 3, it is placed in 37 DEG C of water-baths 2～4h.By carrier PMAL-C5x and recombiant plasmid The digestion products of pZeroBack-VapA, through the agarose gel electrophoresis of 1%, reclaims purpose band, concrete recycling step reference 3.1。

T4DNA ligase is utilized overnight to connect in 16 DEG C of connection instrument PMAL-c5x and the VapA gene of recovery Connect, and PMAL-VapA is proceeded to prokaryotic expression bacterium BL21, identify through bacterium solution PCR and order-checking, result such as Fig. 3.Survey Sequence result is completely the same with reference to VapA gene order, and containing correct EcoRI and NotI restriction enzyme site.By this protokaryon The named PMAL-VapA of recombinant expression.

The expression of embodiment 2 soluble M BP-VapA recombiant protein and the determination of optimal inductive condition

The BL21 bacterium solution converting PMAL-VapA plasmid positive is inoculated in (containing ampicillin 50 μ in 1:100 ratio G/ml) in LB fluid medium, 200r/min shaken cultivation in 37 DEG C of shaking tables.To bacterium solution OD₆₀₀Value is about 0.6 Time, carry out the optimization expression of MBP-VapA recombiant protein as follows.

1. the determination of abduction delivering temperature

Adding concentration is the IPTG of 1mM, and concussion is cultivated under conditions of 10 DEG C, 15 DEG C, 20 DEG C, 28 DEG C and 37 DEG C To appropriate induction time sampling.Sample is centrifuged 10min in 4000r/min, abandons supernatant, takes precipitation, and by precipitation substance The deionized water of long-pending 1/10 is resuspended, carries out SDS-PAGE, the expression of detection fusion albumen according to a conventional method.Use BandScan Protein content in (5.0 editions) software analysis swimming lane, to determine optimal abduction delivering temperature.Result shows (such as Fig. 4), with Temperature by the increase of 10 DEG C, the expression of VapA (59kDa) is gradually increased, and reaches when 15 DEG C and 20 DEG C inductions Maximum, reduces subsequently.BandScan analyzes display, induces under conditions of 10 DEG C, 15 DEG C, 20 DEG C, 28 DEG C and 37 DEG C The expression of VapA albumen accounts for 9.1%, 15.3%, 16.6%, 7.2%, the 2.7% of total swimming lane protein content respectively, shows that 20 DEG C lure Lead the amount maximum expressing VapA.

The determination of 2.IPTG induction time

Repeat Induction experiments, when converting bacterium solution OD₆₀₀When value reaches about 0.6, adding concentration is the IPTG of 1mM, 20 DEG C of induction tables Reach, sample after 0h, 2h, 4h, 8h, 12h, 16h, 20h and 24h respectively.Sample is centrifuged through 4000r/min 10min, abandons supernatant, and by resuspended for the deionized water of precipitation original volume 1/10, carries out SDS-PAGE detection, and warp BandScan analyzes, and determines the optimal induction time of IPTG.Result (such as Fig. 5) shows, with the prolongation VapA of induction time Expression is gradually increased, and reaches maximum expression in time inducing 8h.Its BandScan analyzes display, IPTG induction 0h, The VapA expressing quantity of 2h, 4h, 8h, 12h, 16h, 20h and 24h account for respectively total swimming lane protein content 0%, 14.3%, 21.3%, 31.4%, 31.5%, 26.5%, 21.2% and 12.3%.Result shows, the optimal induction time of IPTG It is 8h.

The determination of 3.IPTG induced concentration

By above-mentioned optimal abductive approach, when converting bacterium solution OD₆₀₀When value reaches about 0.6, respectively with final concentration of 0mM, The IPTG of 0.1mM, 0.3mM, 0.5mM, 0.7mM, 1.0mM and 1.4mM samples after 20 DEG C of abduction delivering 8h. Sample is centrifuged 10min with 4000r/min, abandons supernatant.Collect bacterial sediment and the deionized water with original volume 1/10 is resuspended, enter Row SDS-PAGE detection is also analyzed through BandScan, determines the optimal induced concentration of IPTG.Result (such as Fig. 6) shows, The expression of perusal VapA albumen does not changes with the change of IPTG induced concentration.But, BandScan analyzes display VapA expressing quantity IPTG concentration be respectively 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM, 1.0mM and During 1.4mM, account for 0%, 26.9%, 31.3%, 30.3%, 32.4%, 27.9% and the 24.8% of total swimming lane protein content respectively. It is shown as the increase along with IPTG induced concentration and increases, reach the highest to 0.7mM and then decline.Indicate that this IPTG induces The optium concentration that VapA expresses is 0.7mM.

The qualification of the most recombinant expressed VapA albumen state

Applicants experimentally found that, when IPTG induces the expression of VapA recombiant protein, the VapA that it is expressed by different temperature The state tool of albumen has a certain impact.Use optimal IPTG concentration and induction time respectively 20 DEG C, 28 DEG C and 37 DEG C of temperature Under the conditions of degree, the VapA albumen expressed is detected.Sampling bacterium solution sample is centrifuged 10min in 4000r/min, abandons supernatant, Take precipitation.Sample-loading buffer with the 1/10 of original volume will precipitate resuspended, and with ultrasonic smudge cells under conditions of ice bath 10min.It is centrifuged through 4 DEG C, 12000r/min 20min.Carrying out SDS-PAGE according to a conventional method, detection supernatant is (containing solubility The albumen expressed) and precipitate the expression of albumen in (albumen expressed containing inclusion body).

Result of the test (such as Fig. 8) shows, cleer and peaceful precipitation before induction, in the ultrasonication of 20 DEG C of abduction delivering products, In the ultrasonication of 28 DEG C of abduction delivering products in cleer and peaceful precipitation and 37 DEG C of abduction delivering product ultrasonications in cleer and peaceful precipitation VapA expressing quantity accounts for 0%, 8.9%, 10.1%, 2.4%, 5.3%, 0% and the 5.6% of total swimming lane protein content respectively.With Upper abduction delivering product detects through ultraviolet spectrometry degree meter, concentration is respectively as follows: 3.0,8.3,1.5,5.3,3.2,6.5, 2.7mg/mL.Showing, under the conditions of 20 DEG C of abduction deliverings, the expression of destination protein is maximum and the overwhelming majority is solubility expression. Meanwhile, under optimal inductive condition, repeatedly carry out abduction delivering, supernatant and the precipitation of product ultrasonic treatment antibacterial are carried out SDS-PAGE electroresis appraisal shows that the recombiant protein overwhelming majority is presented in solubility (Fig. 7).

5. the non denatured purification of solubility restructuring VapA albumen

BL21 bacterium solution containing positive plasmid (PMAL-VapA) is inoculated in the training of 200ml LB liquid in the ratio of 1:100 Support in base (containing ampicillin 50 μ g/ml), in 37 DEG C of shaken cultivation to OD₆₀₀When about about 0.6, add concentration For the IPTG of 0.7mM, 20 DEG C of induction 8h, use NEB company Amylose Resin product (E8021) to expressing protein It is purified.Carrying out with reference to description, concrete operations are as follows:

(1) albumen slightly carries

Bacterium solution after being expressed by induced protein, 4000g is centrifuged 10min, collects thalline.With the pillar resuspended (pillar of buffer 20mL Buffer consumption is the 1/10 of original bacteria liquid volume), it is stored in-20 DEG C.During purifying protein, it is placed in cold water and thaws, and In ice-water bath, crushing with 4s, the interval of 5s, carry out sonicated cells.Continual ultrasonic is broken until the egg discharged White matter reaches maximum, till bacteria suspension becomes clarification.

After crushing, bacterium solution is at 4 DEG C, and centrifugal 20min under the conditions of 12000rpm, the supernatant of acquisition is protein crude extract administration.

(2) affinity chromatograph

A. the preparation of pillar: by 1mL amylose Filled Dielectrics in the pillar that specification is 1.0x 10cm.With 5 times of pillar volumes Pillar wash buffer pillar.

B. upper prop: the amount of medium determines the amount of fused protein, and every milliliter of bed volume can be in conjunction with 6～8mg fusion protein Matter, estimates loading volume according to the expression of destination protein.Controlling maximum linear flow velocity is 24cm/h, i.e. 0.3mL/min.Stream Speed calculation is: linear flow rate (cm/h) × π r=volume flow rate (mL/h).

C. eluting: wash pillar with the pillar buffer of 10 times of medium volumes, then with the pillar eluent of 10 times of medium volumes Eluting destination protein, collects 10 components with every component 1mL, uses micro-spectrophotometer to measure every component destination protein Amount, collects liquid for No. 1-6 and is respectively as follows: 2.3,1.7,1.5,1.2,0.7 and 0.3mg/ml, and collecting liquid protein concentration for No. 7-10 is 0。

Protein liquid SDS-PAGE detects after purification, uses Bandscan software that SDS-PAGE picture is analyzed weight The purity of group VapA albumen, is 83.7%.

6. the antigenicity analysis of restructuring VapA albumen

Detect by Western blot purification the recombinated antigenicity of VapA albumen, specifically comprise the following steps that

(1) by the SDS-PAGE of VapA albumen being placed in transfer plate in, cut one of a size with PAGE gel 6 3mm filter paper and 1 nitrocellulose filter, be soaked in transfering buffering liquid about about 15min, stays in filter to drive away Bubble on film.

(2) anode is upward, and negative electrode, in bottom, is respectively 3 filter paper, and PAGE gel must be on NC film Wrapped up by filter paper, and ensure bubble-free.

(3) electrotransfer is installed, shifts 30min with constant current 150mA.

(4) add 10ml confining liquid (containing the TBS of 8%～10% defatted milk powder), close overnight for 4 DEG C.

(5) then sop up confining liquid, wash three times with TBST, each 5min.

(6) horse positive serum (the Gluck Equine Research of the anti-Rhodococcus equi VapA albumen diluted with 1:100 Center presents) resist as one, 37 DEG C of effect 2h

(7) abandon reaction liquid, wash 15min, each 5min with TBST altogether.

(8) under the conditions of goat-anti horse IgG Fab'2-HRP ELIAS secondary antibody (LSBio company) 37 DEG C, 1h is acted on the most again, Wash equally 3 times, preservation of taking pictures the most again.Western-blot testing result (such as Fig. 9) shows, the recombiant protein of purification (59kDa) can be shown by the horse positive serum specific recognition of anti-Rhodococcus equi VapA albumen, this recombiant protein has good Good immunogenicity.

Because VapA albumen expression in Rhodococcus equi is the highest, with directly purification VapA egg from Rhodococcus equi (Julien Cauchard, 2004) compares in vain, and the present invention uses non-pathogenic bacteria to produce more safe efficient as expressing bacterium tool Feature；Secondly, compare with artificial amino acid synthesis VapA albumen (Julien Cauchard, 2006), of the present invention The VapA aminoacid sequence that method is expressed can complete to fold normally, process and modified by natural bacteria Protein processing factory Journey, forms the natural structure form closer to Rhodococcus equi VapA albumen.Finally, with the table of the VapA albumen reported Reaching method to compare, the albumen that this method gives expression to is soluble protein, rather than inclusion body protein.It is solvable that the inventive method is expressed Property VapA albumen there is more preferable protein active and immunogenicity, and, WB checking expressed by VapA have higher Activity.It addition, although the recombiant protein amount with the expression of inclusion body protein form is the biggest, but because its processed process is loaded down with trivial details And industrial application need to be not particularly suited for through denaturation way purification.By contrast, the present invention uses non-deformed method purification And process less to VapA recombiant protein activity influence simply, easily operate, is more suitable for commercialization and produces in enormous quantities.

The Dot ELISA of embodiment 3 MBP-VapA recombiant protein

Dot ELISA uses the conventional method of this area, and one resists for Ma Yuankang Rhodococcus equi serum (20uL), and two resist for HRP Labelling rabbit anti-horse IgG (1:1000 dilution), result such as Figure 10.

The antibody of pathogenic Rhodococcus fascians disease is resisted for detecting horse.In Figure 10,1 to 3 hole is BSA, and protein concentration is respectively as follows: 0.1mg/mL、0.025mg/mL、0.00625mg/mL；4 holes are PBS control, and 5 holes are Rhodococcus equi (ATCC33701) lysate positive control；6 to 8 holes are VapA albumen, concentration be respectively 0.1mg/mL, 0.025mg/mL、0.00625mg/mL。

Test result indicate that: identical with R.equi normal bacterial, the MBP-VapA albumen of purification of the present invention can be known by specificity R.equi bacterial antibodies in other horse serum through ELIAS secondary antibody reaction solution；Secondly, compared with BSA comparison, purification The ability that MBP-VapA albumen is combined with specific antibody reduces along with the decline of protein concentration；Finally, because of to eluent pair According to hole without colour developing, the characteristic of these purifying protein specific recognition R.equi bacterial antibodies is unrelated with its solution.Therefore, this experiment The MBP-VapA of room purification can be used for the detection of R.equi specific antibody.

The indirect ELISA of embodiment 5 MBP-VapA recombiant protein

1, the foundation of Rhodococcus equi indirect ELISA method

The MBP-VapA albumen of purification is as antigen coated 96 orifice plates, and antigen is to be coated liquid (0.1M NaHCO₃PH9.6) dilute Releasing, 100uL/ hole is coated in 96 orifice plates, and 4 spend night (> 8h).Use PBST (PH7.2), every hole 200uL, washing Wash 4 times on trigger, each 3min；Add 200uL confining liquid (0.5%PVA), close 1h in room temperature；Washing 4 Secondary, method is described above；Serum PBS (PH7.2) to be checked being diluted, 100uL/ hole adds elisa plate, 37 DEG C of temperature baths 1h；Washing 4 times, method is described above；Add goat-anti horse IgG Fab'2-HRP ELIAS secondary antibody, 100uL/ hole, 37 DEG C of temperature baths 1h；Washing 4 times, method is described above；Add nitrite ion 100uL (TMB), room temperature 10min；Add stop buffer (2M H₂SO₄), 100uL；ELISA reads trigger in OD_450nmReading.

2, antigen coated concentration and the determination of serum optimum dilution degree

Use matrix titrimetry to determine the optium concentration of antigen-antibody, the MBP-VapA proteantigen of purification respectively with 0.1ug, The every hole of 0.05ug, 0.025ug, 0.0125ug, 0.00625ug is coated 96 orifice plates, and standard R.equi positive and negative serum is made respectively 100 times, 200 times, 400 times, 800 times of dilutions.With standard R.equi positive serum OD_450nmIt is worth about 1.0, and P/N value is maximum, determines the optimum dilution degree being most preferably coated concentration and serum of antigen for standard.

P/N=(positive serum OD_450nmValue-positive serum blank OD_450nmValue)/(negative serum OD_450nmValue-cloudy Property serum blank OD_450nmValue).

Serum background value can be reduced in view of relatively low serum diluting multiple, thus determine that the concentration that is most preferably coated of antigen is 0.125ug/mL, the optimum diluting multiple of serum is 400 times (see Figure 11, tables 4).

The different antigen-antibody dilution factor correspondence P/N value result of table 4

3, the determination of ELIAS secondary antibody best effort concentration

ELIAS secondary antibody dilutes with 1:1250,1:5000,1:20000,1:80000,1:320000 respectively, and use has optimized Antigen concentration is coated elisa plate, and uses optimal standard R.equi positive and negative serum diluting multiple, carries out ELISA behaviour Make, with standard R.equi positive serum OD_450nmValue is about 1.0, and P/N value is standard to the maximum and determines goat-anti horse IgG Fab'2-HRP optimum dilution degree.

Result shows: goat-anti horse IgG Fab'2-HRP optimum dilution degree is 20000 times of dilutions (see Figure 12, tables 5).

The different goat-anti horse IgG Fab ' 2-HRP extension rate dilution factor correspondence P/N value result of table 5

Two anti-extension rates	1250	5000	20000	80000	320000
						P/N value	1.933	3.786	6.617	7.068	8.510

4, the selection of confining liquid

Use 2%BSA, 1%BSA, 5% defatted milk powder, 1%PVA, 0.5%PVA to be ELISA and close respectively, select and optimize Antigen concentration be coated elisa plate, and use optimal standard R.equi positive and negative serum diluting multiple, and enzyme mark two Anti-extension rate, carries out ELISA operation, with standard R.equi positive serum OD_450nmValue is about 1.0, and P/N ratio Being standard to the maximum and determine optimal confining liquid, optimal confining liquid is 0.5%PVA as shown in Table 6.

Table 6 confining liquid optimum results

OD450nmValue	2%BSA	1%BSA	5% defatted milk powder	1%PVA	0.5%PVA
						Positive serum	2.79055	2.59105	1.66075	1.6187	1.44365
Positive serum blank	2.00515	2.0098	0.58565	0.2177	0.283
						Negative serum	0.2651	0.3196	0.33705	0.3358	0.27935
Negative serum blank	0.09295	0.1014	0.13165	0.08675	0.09495
						P/N value	4.562	2.664	5.234	5.625	6.294

5, the determination of ELISA yin and yang attribute marginal value

By above-mentioned built vertical ELISA detection method, detect to 1 part of standard female sample, without epidemic-stricken area horses blood serum sample 19 parts, Doing 1:400 dilution, every part of serum repeats 3 holes, carries out ELISA mensuration (the results are shown in Table 8).

It is computed the OD of each sample₄₅₀Meansigma methods X=0.210, standard deviation S D=0.054, marginal value X+3SD=0.370.In regulation Under experiment condition, serum sample is 1:400 dilution, its OD₄₅₀Value is more than marginal value, serum sample OD the most to be checked₄₅₀Value It is judged to the positive when 0.370, is otherwise judged to feminine gender, result such as table 7.

The determination of table 7 ELISA yin and yang attribute marginal value

Numbering	OD450nm	Numbering	OD450nm	Numbering	OD450nm	Numbering	OD450nm
								Negative control	0.219	B236	0.173	A142	0.186	2200	0.163
L304	0.231	B75	0.196	V108	0.201	E074	0.174
								M74	0.179	B116	0.147	P109	0.295	N197	0.239
B368	0.350	J330	0.180	M256	0.276	H051	0.127
								J184	0.165	L304	0.231	C105	0.216	V134	0.243

6, specific test

Choose non-R.equi epidemic-stricken area stud-farm H7N7 or the seropositive horses of H3N8 influenza virus, gather serum as H7N7 or H3N8 Antibody of Influenza positive serum, carries out Rhodococcus equi antibody indirect ELISA detection.Examine by optimal reaction system Surveying, with standard R.equi positive and negative serum control, every part of serum repeats 3 holes.As shown in table 8, with R.equi positive blood Clear comparison is compared, the feminine gender that this ELISA detection H7N9 or H3N8 positive serum and R.equi negative serum are (OD_450nm<0.370).Result shows, the ELISA method that this experiment is set up has R.equi in specific detection serum and resists The ability of body.

Table 8 specificity experiments result

SEQUENCE LISTING

<110>Agricultural University Of South China

<120>a kind of test kit detecting Rhodococcus equi disease

<130>

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 585

<212> PRT

<213> MBP-VapA

<400> 1

Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys

1 5 10 15

Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr

20 25 30

Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe

35 40 45

Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala

50 55 60

His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile

65 70 75 80

Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp

85 90 95

Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu

100 105 110

Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys

115 120 125

Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly

130 135 140

Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro

145 150 155 160

Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys

165 170 175

Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly

180 185 190

Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp

195 200 205

Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala

210 215 220

Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys

225 230 235 240

Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser

245 250 255

Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro

260 265 270

Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp

275 280 285

Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala

290 295 300

Leu Lys Ser Tyr Glu Glu Glu Leu Val Lys Asp Pro Arg Ile Ala Ala

305 310 315 320

Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln

325 330 335

Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala

340 345 350

Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn

355 360 365

Ser Ser Ser Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Gly Ile

370 375 380

Glu Gly Arg Ile Ser His Met Ser Met Gly Gly Arg Met Lys Thr Leu

385 390 395 400

His Lys Thr Val Ser Lys Ala Ile Ala Ala Thr Ala Val Ala Ala Ala

405 410 415

Ala Ala Met Ile Pro Ala Gly Val Ala Asn Ala Thr Val Leu Asp Ser

420 425 430

Gly Ser Ser Ser Ala Ile Leu Asn Ser Gly Ala Gly Ser Gly Ile Val

435 440 445

Gly Ser Gly Ser Tyr Asp Ser Ser Thr Thr Ser Leu Asn Leu Gln Lys

450 455 460

Asp Glu Pro Asn Gly Arg Ala Ser Asp Thr Ala Gly Gln Glu Gln Gln

465 470 475 480

Tyr Asp Val His Gly Asp Val Ile Ser Ala Val Val Tyr Gln Arg Phe

485 490 495

His Val Phe Gly Pro Glu Gly Lys Val Phe Asp Gly Asp Ala Gly Gly

500 505 510

Leu Thr Leu Pro Gly Ala Gly Ala Phe Trp Gly Thr Leu Phe Thr Asn

515 520 525

Asp Leu Gln Arg Leu Tyr Lys Asp Thr Val Ser Phe Gln Tyr Asn Ala

530 535 540

Val Gly Pro Tyr Leu Asn Ile Asn Phe Phe Asp Ser Ser Gly Ser Phe

545 550 555 560

Leu Gly His Ile Gln Ser Gly Gly Val Ser Thr Val Val Gly Val Gly

565 570 575

Gly Gly Ser Gly Ser Trp His Asn Ala

580 585

<210> 2

<211> 44

<212> DNA

<213>primers F

<400> 2

aaggaaaaaa gcggccgcat gaagaccctg cacaagacgg tctc 44

<210> 3

<211> 34

<212> DNA

<213>primer R

<400> 3

ccggaattcc taagcgttgt gccaactacc cgag 34

Claims (9)

1. the preparation method detecting the sick ELISA kit of Rhodococcus equi, it is characterised in that comprise the following steps:

The most immunogenic prepare as follows: amplification VapA gene, and be cloned on PMAL-C5x carrier, construction of expression vector PMAL-VapA, PMAL-VapA converted to prokaryotic expression bacterium, induce at 20 DEG C by IPTG, acquisition recombiant protein MBP-VapA after purification；

Preparation enzyme labelled antibody goat-anti horse IgG Fab'2-HRP, negative control tire horse serum, the mature horses serum of positive control Rhodococcus equi inactivated vaccine immunity and confining liquid PVA obtain ELISA kit the most respectively；

By the Rhodococcus equi Disease-causing gene VapA of SEQ ID NO:2 and primer amplification Serial No. JN990991.1 of SEQ ID NO:3；Described prokaryotic expression bacterium is BL21.

Preparation method the most according to claim 1, it is characterised in that described recombiant protein MBP-VapA be coated concentration be 0.125 μ g/mL, negative control and positive control serum dilution factor be 1:400, goat-anti horse IgG Fab'2-HRP dilution factor is 1:20000, and confining liquid is 0.5%PVA.

3. the ELISA kit of the detection Rhodococcus equi disease that preparation method described in any one of claim 1 or 2 obtains, it is characterized in that, described test kit includes that its aminoacid sequence is as shown in SEQ ID NO:1 as immunogenic Rhodococcus equi Disease-causing gene VapA recombiant protein MBP-VapA.

Test kit the most according to claim 3, it is characterised in that described test kit also includes the detectable being suitable to MBP-VapA with anti-Rhodococcus equi Disease-causing gene VapA protein antibodies generation antigen antibody reaction.

Test kit the most according to claim 4, it is characterised in that described test kit includes being coated with the solid phase carrier of MBP-VapA, enzyme labelled antibody.

Test kit the most according to claim 5, it is characterised in that described test kit also includes confining liquid, cleaning mixture, nitrite ion, stop buffer, the positive and negative control.

Test kit the most according to claim 6, it is characterised in that described negative control is tire horse serum, positive control is the mature horses serum of Rhodococcus equi inactivated vaccine immunity.

Test kit the most according to claim 7, it is characterised in that described enzyme labelled antibody is goat-anti horse IgG Fab'2-HRP.

Test kit the most according to claim 8, it is characterised in that described MBP-VapA be coated concentration be 0.125 μ g/mL, negative control and positive control serum dilution factor be 1:400, goat-anti horse IgG Fab'2-HRP dilution factor is 1:20000, and confining liquid is 0.5%PVA.