CN109971769A - A kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expression - Google Patents
A kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expression Download PDFInfo
- Publication number
- CN109971769A CN109971769A CN201910315066.2A CN201910315066A CN109971769A CN 109971769 A CN109971769 A CN 109971769A CN 201910315066 A CN201910315066 A CN 201910315066A CN 109971769 A CN109971769 A CN 109971769A
- Authority
- CN
- China
- Prior art keywords
- sbjaz1
- gene
- sorghum
- expression
- responses
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of its nucleotide sequences of sorghum responses of drought stress gene SbJAZ1 as shown in SEQ ID NO.1.Invention additionally discloses a kind of protein of sorghum responses of drought stress gene SbJAZ1 coding, and amino acid sequence is as shown in SEQ ID NO.2.The invention also discloses recombinant vectors and expression comprising above-mentioned sorghum responses of drought stress gene SbJAZ1.The present invention passes through the protein sequence of rice JAZ1 gene, sorghum homologous gene SbJAZ1 is obtained from sorghum genome database, full length gene 606bp, and according to the gene constructed prokaryotic expression carrier, the condition of the gene solubility expression is optimized, it is purified using protein purification system simultaneously, as a result further research albumin crystal structure and biological characteristics lay the foundation, and then provides foundation for the drought resistance for improving sorghum by gene editing method.
Description
Technical field
The present invention relates to a kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expressions, belong to biological skill
Art field.
Background technique
Sorghum (Sorghum bicolor (L.) Moench) also known as reed broomcorn millet, sorgo are a kind of important cereal crops,
With stronger degeneration-resistant border ability and feed, wine brewing, the important source material for producing bio-fuel, papermaking and industrial starch, together
When be also a kind of herding forage crops widely used in recent years.Cultivation history of the sorghum in China is long, before foundation
Not large-scale planting, until 1970s, with the development of economy and society, China just gradually payes attention to and scale is planted
Train sorghum.Sorghum belongs to short-day C4 plant, and compared to other energy crops, sorghum has more obvious photosynthetic efficiency
And therefore higher yield heterosis is known as " high energy crop ".In recent years, as global environmental problem and the energy are endangered
Machine is got worse, and people constantly seek a kind of safe and pollution-free, efficient biomass energy again.Wherein sorghum is as one
The good energy-source plant of kind causes the attention and research of scientific circles.In order to more further investigate sorghum, U.S. Department of Energy biology and
Environmental Research Center was smoothly sequenced and was assembled to sorghum genome in 2009, this indicate the research work to sorghum into
Enter gene level, while also providing convenience for the clone of sorghum important gene and functional analysis.
JAZ albumen plays an important role in jasmonate acid signal transmitting.JAZ be one can directly hinder JA response transcription because
The negative regulatory factor of the JA response of son starting.JAZ can directly control MYC2's (the important transcription factor of clause jasmonic response)
Transcription.The transcription of JAZ and MYC2 removes inhibition dependent on MYC2 transcription factor, and obstruction is exactly exactly JAZ albumen sheet
Body.This forms a feedback loop, has reacted negative regulation effect to entire jasmonic.JAZ albumen is used as transcription repression to inhibit incessantly
The factor participates in the regulation of jasmonate acid signal reaction, also can be by participating in wider hormone tune with some other protein-interacting
Network is controlled, and then influences many aspects of multi-signal reaction path and plant growth and metabolic processes.At present in quasi- south
Discovery has JAZ albumen in mustard, corn, grape, Para rubber tree etc., but so far, both at home and abroad there is not yet JAZ albumen exists
Report is studied in sorghum.
Summary of the invention
In view of the deficiencies of the prior art, the object of the present invention is to provide a kind of sorghum responses of drought stress gene SbJAZ1 and its again
Group carrier and expression.
The technical scheme is that a kind of sorghum responses of drought stress gene SbJAZ1, nucleotide sequence such as SEQ ID
Shown in NO.1.
The present invention also provides the protein of sorghum responses of drought stress gene SbJAZ1 coding, amino acid sequence such as SEQ
Shown in ID NO.2.
Correspondingly, the present invention provides recombinant vector and expression comprising above-mentioned sorghum responses of drought stress gene SbJAZ1.
Specifically, the recombinant vector the preparation method is as follows: extracting sorghum RNA, and reverse transcription goes out cDNA；It is with cDNA
Template amplification SbJAZ1 gene；By SbJAZ1 amplified production after EcoRI and HindIII double digestion, it is inserted by DNA ligase
Into the pET-28a expression vector through same double digestion, recombinant plasmid pET-28a-SbJAZ1 is obtained.
Preferably, using cDNA as template, using following primer amplification SbJAZ1 gene, primer sequence is as follows:
Upstream primer: SbJAZ1-F:GCGAATTCATGGCCGCCGAGCAG underscore is EcoRI restriction enzyme site；
Downstream primer: SbJAZ1-R:CGAAGCTTTCAGCTGAGGCTGAGCGC underscore is HindIII restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
Specifically, the method for sorghum responses of drought stress gene SbJAZ1 is expressed, comprising the following steps:
(1) Bacillus coli cells are converted with the recombinant vector, obtains the recombined pronucleus expression bacterial strain of expression SbJAZ1；
(2) it by recombined pronucleus expression strain inoculated to kanamycins or kanamycins+chloramphenicol fluid nutrient medium, stays overnight
Cultivate activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to kanamycins or kanamycins+chloramphenicol fluid nutrient medium
In, the expression of IPTG induction recombination SbJAZ1 is added after shake culture；
(4) it after the completion of inducing, recycles and purifies expressed SbJAZ1 recombinant protein.
Preferably, when earthquake culture is to OD600=0.5 in step (3), the IPTG of final concentration of 0.8mM is added, 25
DEG C Fiber differentiation.
Kanamycins is 50ug/mL in the kanamycins fluid nutrient medium.
Kanamycins is 50ug/mL, chloramphenicol 50ug/mL in the kanamycins+chloramphenicol fluid nutrient medium.
The beneficial effects of the present invention are: especially JAZ1 is without correlation for fewer to the gene studies in sorghum at present
Report, the present invention pass through the protein sequence of rice JAZ1 gene (Os10g0392400), obtain from sorghum genome database
Sorghum homologous gene SbJAZ1, gene C DS overall length 606bp, the amino acid sequence derived according to the gene is in NCBI data
The JAZ1 gene in other species is downloaded in library, unrooted chadogram is constructed with adjacent method, the results showed that its amino acid sequence and jade
It is one that rice JAZ1, which gathers, and affiliation is closer, illustrates that SbJAZ1 gene is the JAZ1 gene in sorghum.
The prokaryotic expression of gene is one of the common technology for studying gene function, but in prokaryotic expression, albumen usually with
The form of inclusion body is present in precipitating, and how to allow albumen is face in prokaryotic expression with soluble form expression in cell conditioned medium
The technical problem faced.The present invention is to obtain SbJAZ1 soluble protein, constructs the prokaryotic expression carrier of SbJAZ1 gene, and
A series of optimization is carried out for protein expression condition, discovery SbJAZ1 can be in BL21 (DE3), JM109 (DE3), Rosetta
(DE3), it is expressed in this 5 bacterial strains of BL21 (DE3) pLysS, Tuner (DE3), wherein expression quantity is most in Rosetta (DE3)
It is more；When inducing temperature is 25 DEG C, expression quantity is best；With the increase of IPTG concentration, expressing quantity is gradually increased, most preferably
Induced concentration is 0.8mM；At 25 DEG C, when IPTG concentration is 0.8, inducing expression 10h, expression quantity is best.Through SDS-PAGE electricity
Swimming detection, obtains the purpose band that molecular weight is about 26kDa, and for the expected size of SbJAZ1 albumen, it is solvable to finally obtain SbJAZ1
Property albumen.Meanwhile the present invention purifies it with protein purification system, as a result further research albumin crystal structure and
Biological characteristics lay the foundation, and then provide foundation for the resistance for improving sorghum by gene editing method.
Detailed description of the invention
Fig. 1 is the systematic evolution tree of sorghum SbJAZ1 gene；
Fig. 2 is digestion result schematic diagram, and 1 is the Plasmid DNA of digestion, and 2 be EcoRI and HindIII digestion as a result, 3 be DNA
Marker；
Fig. 3 is the albumen peak figure that SbJAZ1 albumen is obtained by the purifying of AKTA protein purification system and desalination；
Fig. 4 is the electrophoresis result figure after SbJAZ1 protein purification；
Fig. 5 is the result figure that SDS-PAGE electrophoresis tests optimum expression bacterial strain；
Fig. 6 is the result figure that SDS-PAGE electrophoresis tests best IPTG induced concentration；
Fig. 7 is the result figure that SDS-PAGE electrophoresis tests best inducing temperature；
Fig. 8 is western blot detection figure.
Specific embodiment
With reference to the accompanying drawing and invention is described further in specific embodiment:
Embodiment 1: the acquisition and analysis of sorghum responses of drought stress gene SbJAZ1
According to the protein sequence of reported rice JAZ1 gene, blastP searches for sorghum genome database
(https: //phytozome) finds sorghum homologous gene SbJAZ1, and (gene number is Sb08g005080, and nucleotide sequence is such as
Shown in SEQ ID NO.1).Ncbi database is searched for SbJAZ1 albumen (its amino acid sequence is as shown in SEQ ID NO.2), under
The JAZ1 gene in other species is carried, with 7.0 software of MEGA, with adjacent method (Neighbor-Joining, NJ) (bootstrap
=1000) unrooted chadogram is constructed, as seen from Figure 1, it is one that SbJAZ1 and corn JAZ1, which gathers, and affiliation is nearest, can
Know that SbJAZ1 gene is sorghum responses of drought stress gene.
Embodiment 2: the building and identification of sorghum responses of drought stress gene SbJAZ1 recombinant vector
1, sorghum RNA is extracted, and reverse transcription goes out cDNA
Sorghum BTx623 material is taken, extracts seedling using RNA extracts kit (TIANGEN Biotech (Beijing) Co., Ltd.)
Phase total serum IgE obtains cDNA with reverse transcription reagent box (Promega) reverse transcription.
2, using cDNA as template amplification SbJAZ1 gene；
Design primer expands SbJAZ1 gene using cDNA as template.
Primer is as follows:
Upstream primer: SbJAZ1-F:GCGAATTCATGGCCGCCGAGCAG underscore is EcoRI restriction enzyme site；
Downstream primer: SbJAZ1-R:CGAAGCTTTCAGCTGAGGCTGAGCGC underscore is HindIII restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
PCR amplification system used in gene magnification for vector construction is as follows: 5 × buffer 10 μ L, FastPfu
4 μ L, cDNA template of Fly DNA Polymerase 1 μ L (Quan Shijin), 2.5mmol dNTPs, 0.5 μ L, 10 μm of ol upstream and downstream are drawn
Object each 1 μ L, ddH2O32.5μL。
The following are PCR amplification conditions: 95 DEG C of 2min, 35 circulation (95 DEG C of 20s, 58 DEG C of 20s, 72 DEG C of 30s-1min, 72 DEG C
5min。
3, SbJAZ1 gene recombined vector is constructed
After PCR product is purified, it is connected to pET-28a carrier.PCR product is detected using 1% agarose.PCR
Product is recycled with reference to Nanjing Vazyme Biotechnology Co., Ltd.'s Ago-Gel QIAquick Gel Extraction Kit specification.It is after the recovery
Product is inserted into the pET-28a expression vector through same double digestion by DNA ligase after EcoRI and HindIII double digestion
In, 16 DEG C connect 16 hours, construct pET-28a-SbJAZ1 recombinant plasmid.
By recombinant plasmid transformed to coli strain DH5a, trained on 50ug/mL kanamycins solid plate in 37 DEG C
It supports, picking individual colonies hold up the limited public affairs of section's biotechnology after digestion identification is correct (digestion result is as shown in Figure 2), then through Beijing
Take charge of its correct sequence of sequence verification.Sequencing result shows that SbJAZ1 coding sequence obtained fulfills the expectation, and says
Bright construction of recombinant plasmid success is simultaneously named as pET-28a-SbJAZ1, i.e. recombinant vector.
The inducing expression of embodiment 3:SbJAZ1 albumen
1, the recombined pronucleus expression bacterial strain of SbJAZ1 is obtained
It selects and successful monoclonal is sequenced in embodiment 2 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-
SbJAZ1 recombinant expression carrier extracts, take recombinant expression carrier plasmid conversion E. coli expression strains BL21 (DE3),
JM109 (DE3), BL21 (DE3) pLysS, Tuner (DE3), Rosetta (DE3) detect the expression of SbJAZ1 albumen.
2, activated strains are incubated overnight
It is incubated overnight and activates above-mentioned recombined pronucleus expression bacterial strain.For example, by BL21 (DE3), JM109 (DE3), Tuner
(DE3) bacterial strain is transferred in 50ug/mL kanamycins fluid nutrient medium, by Rosetta (DE3), BL21 (DE3) pLysS bacterial strain
Be transferred in 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.
3, inducing expression
The recombined pronucleus expression bacterial strain of activation is transferred in the fluid nutrient medium containing corresponding antibiotic, for example, will activation
BL21 (DE3), JM109 (DE3), Tuner (DE3) bacterial strain be transferred in 50ug/mL kanamycins fluid nutrient medium, will
Rosetta (DE3), BL21 (DE3) pLysS bacterial strain are transferred to 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium
In, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 0.8mM is added, 25 DEG C Fiber differentiation 10 hours, obtain
Obtain the recombinant protein of SbJAZ1.
4, the purifying of SbJAZ1 recombinant protein
After the completion of induction, expressed SbJAZ1 recombinant protein is recycled and purified, is carried out using AKTA protein purification system
Purifying and desalination, it is preferable that protein purification is carried out using AKTA purifier10 fast protein purification system, steps are as follows:
Since pET28a has 6 His coded sequences before terminator, so pET28a-SbJAZ1 recombinant expression carrier
The albumen of acquisition can use Ni-NTA and carry out affinitive layer purification.Affinity chromatography is with protein or large biological molecule and combination
Based on special affinity between aglucon on medium, because being connected to one in the matrix of chromatography gel used in His-tags
NTA [(nitrilotriacetic acid) nitrilotriacetic acid], can be with Ni ions binding, and the 6 of Ni ion and fusion protein
Attraction is generated between × His amino acid, thus by the fusion protein for having His-tags histidine tag and other protein regions
It separates, five yuan of imidazole rings of histidine residues are the key that albumen and Ni ionization, therefore when we use the miaow of high concentration
Azoles (Imidazole) solution elution when marquis (such as 400mM), imidazoles be convenient for protein His-tags imidazole ring competitive binding,
Finally fusion protein is eluted from gel.
Concrete operations: taking out the thallus of -80 DEG C of preservations, and Lysis buffer is added and is resuspended, the bacterium solution after resuspension is in ice bath
Middle carry out ultrasonic disruption, power 350W, duty ratio 50%, each circulation 30s, total time 35min.It is broken even
Slurry, 4 DEG C, 1,2000rpm centrifugation 30min.Supernatant is adsorbed on Ni-NTA adsorption column with peristaltic pump, 5mL/min, repeats one
It is secondary, retain 20 μ L by the sample of adsorption column and carries out protein adhesive electrophoresis；Ni-NTA adsorption column is connected to fast protein purifying system
On system, eluted；Albumen is collected according to UV absorption curve, and samples and carries out protein adhesive electrophoresis detection.
Fig. 3 is AKTA protein purification system purifying protein peak figure.SbJAZ1 albumen is purified by AKTA protein purification system
Obtained albumen peak figure.
Fig. 4 is the electrophoretogram after SbJAZ1 protein purification.It is the expression and purification at 25 DEG C, IPTG concentration 0.8mM
SbJAZ1 albumen result.1 is empty vector control；2 albumen after Ni column is affine after purification；3 is on after cell ultrasonications
Final proof product；M is albumen marker；Arrow meaning is shown as SbJAZ1 albumen.Fig. 4 shows that SbJAZ1 albumen often has under this condition
In supernatant, the SbJAZ1 purity of protein obtained after purification by AKTA protein purification system reaches requirement, after can be used for
Continuous experiment.
The verifying of the protein induced expression condition of embodiment 4:SbJAZ1
1, the recombinant strains of SbJAZ1 are obtained
It selects and successful monoclonal is sequenced in embodiment 2 is inoculated into 50ug/mL kanamycins fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, according to Nanjing Vazyme Biotechnology Co., Ltd.'s small amount plasmid extraction kit by pET-28a-
SbJAZ1 recombinant expression carrier extracts, and recombinant expression carrier is taken to convert e. coli bl21 (DE3), JM109 respectively
(DE3), Rosetta (DE3), BL21 (DE3) pLysS, Tuner (DE3) bacterial strain, is coated on the plate of kanamycins containing 50ug/mL
It is incubated overnight on (Rosetta (DE3), BL21 (DE3) pLysS need to add chloramphenicol) in 37 DEG C, the inoculation of picking single colonie
Into 50ug/mL kanamycins (Rosetta (DE3), BL21 (DE3) pLysS need to add chloramphenicol) fluid nutrient medium, 37 DEG C,
200rpm is incubated overnight, and 50% glycerol of sterilizing is added in bacterium solution, is frozen after mixing in -80 DEG C of refrigerators, obtains expression SbJAZ1
Prokaryotic expression bacterial strain.
2, the determination of SbJAZ1 Primary structure optimum strain
BL21 (DE3), JM109 (DE3), Tuner (DE3) bacterial strain are transferred to 50ug/mL kanamycins fluid nutrient medium
In, Rosetta (DE3), BL21 (DE3) pLysS bacterial strain are transferred to the training of 50ug/mL kanamycins+50ug/mL chloramphenicol liquid
Support base in, 37 DEG C, 200rpm be incubated overnight activated strains.
The BL21 (DE3) of activation, JM109 (DE3), Tuner (DE3) bacterial strain are transferred to 50ug/mL kanamycins liquid
In culture medium, Rosetta (DE3), BL21 (DE3) pLysS bacterial strain are transferred to 50ug/mL kanamycins+50ug/mL chloramphenicol
In fluid nutrient medium, when 37 DEG C of shake cultures are to OD600=0.5, the IPTG of final concentration of 1mM is added, in 25 DEG C of Fiber differentiations
12 hours (pET-28a bacterium is taken to make negative control).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min collects thallus, and bacterium is heavy
It forms sediment and negative control 2mL is pre-chilled PBS buffer (with preceding addition 1mM PMSF) and suspends, it is broken to carry out cell with Ultrasonic Cell Disruptor
It is broken, each 10sec, totally 10 times, every minor tick 30sec；1,2000rpm centrifugation 10min, takes supernatant, SDS-PAGE electrophoresis detection,
Test optimum expression bacterial strain, as a result as shown in figure 5, SbJAZ1 can at BL21 (DE3), JM109 (DE3), Rosetta (DE3),
It is expressed in this 5 bacterial strains of BL21 (DE3) pLysS, Tuner (DE3), wherein expression quantity is most in Rosetta (DE3).
3, the determination of the best IPTG concentration of SbJAZ1 Primary structure
Above-mentioned recombined pronucleus expression bacterial strain Rosetta (DE3) is inoculated with to 50ug/mL kanamycins+50ug/mL chloramphenicol
In fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to 50ug/
In mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, when 37 DEG C of shake cultures are to OD600=0.5, it is separately added into dense eventually
Degree is the IPTG of 0.2,0.4,0.6,0.8,1.0mM, 25 DEG C Fiber differentiation 10 hours (bacterium not induced is taken to make negative control).
4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min collects thallus, bacterial precipitation and negative control with 2mL and PBS is pre-chilled
Buffer (with preceding addition 1mM PMSF) suspends, and carries out clasmatosis with Ultrasonic Cell Disruptor, each 10sec, and totally 10 times, between each
Every 30sec；1,2000rpm centrifugation 10min, takes supernatant, SDS-PAGE electrophoresis detection tests best IPTG induced concentration, as a result
As shown in fig. 6, SbJAZ1 expression is most when IPTG concentration is 0.8mM.
4, the determination of SbJAZ1 Primary structure optimum temperature
Above-mentioned recombined pronucleus expression bacterial strain Rosetta (DE3) is inoculated with to 50ug/mL kanamycins+50ug/mL chloramphenicol
In fluid nutrient medium, 37 DEG C, 200rpm be incubated overnight activated strains.The recombined pronucleus expression bacterial strain of activation is transferred to again
In 50ug/mL kanamycins+50ug/mL chloramphenicol fluid nutrient medium, when 37 DEG C of shake cultures are to OD600=0.5, it is added dense eventually
Degree is the IPTG of 0.8mM, (takes pET-28a bacterium to make negative right within Fiber differentiation 8-16 hours at 16,20,25,30 and 37 DEG C respectively
According to).4 DEG C after the completion of induction, 1,2000rpm centrifugation 2min collects thallus, bacterial precipitation and negative control with 2mL and PBS is pre-chilled
Buffer (with preceding addition 1mM PMSF) suspends, and carries out clasmatosis with Ultrasonic Cell Disruptor, each 10sec, and totally 10 times, between each
Every 30sec；1,2000rpm centrifugation 10min, takes supernatant, and SDS-PAGE electrophoresis detection tests best inducing temperature, as a result such as Fig. 7
Shown, in 25 DEG C of Fiber differentiations, SbJAZ1 expression quantity is most.
The western blot of embodiment 5:SbJAZ1 recombinant protein is detected
(1) it extracts by SbJAZ1 albumen after purification:
1. cultivating the E. coli expression strains containing pET-28a-SbJAZ1 plasmid, IPTG inducing expression；
2. protein lysate is added, and (50mM Tris pH8.0,120mM NaCl, 1mM DTT, 0.5%NP-40 are added with preceding
Enter 1mM PMSF, 1mM DTT), after ultrasonic disruption cell, supernatant is collected by centrifugation, places 20min on ice；
3. 15,000g, 4 DEG C of centrifugation 5min abandon precipitating；
4. taking 200 μ L supernatants that 5 × Loading Buffer is added, concussion is mixed, and -80 DEG C of remaining sample freeze；
5. boiling water boiling 5min, ice bath, 12,000rpm centrifugation 5min draw 15 μ L of supernatant and carry out protein electrophoresis, remaining sample
- 20 DEG C of product freeze；
6. preparing SDS-PAGE glue, electrophoresis 20min first is carried out with 90 V, when sample enters separation gel, with 150 V voltages
Electrophoresis is carried out, until bromophenol blue stops electrophoresis when running out of separation gel.
(2) transferring film
Cut with a paper cutter out the pvdf membrane more somewhat larger than glue (for pvdf membrane, first with methanol impregnate 30 seconds, then
ddH23-5min is impregnated in O, is then placed in transferring film buffer) rubber plate clamp is put into electrophoretic blotting groove.Transferring film buffer is poured into,
4 DEG C, 100V90min.
(3) it closes
After the completion of transferring film, pvdf membrane is taken out, is put in the PBST solution with 5% skimmed milk power, 2h is closed on shaking table.
(4) primary antibody is incubated for
Confining liquid is discarded, is added Anti His antibody (1:5000), shaking table is incubated for 12h.
(5) secondary antibody is incubated for
Primary antibody is outwelled, washs pvdf membrane 3 times with 1 × PBST, each 5min；Corresponding secondary antibody (sheep anti-Mouse) is added, shakes
Bed is incubated for 1h.
(6) ECL exposes
Secondary antibody is abandoned, washs pvdf membrane 3 times with 1 × PBST, each 5min；HRP chemiluminescent substrate is added on pvdf membrane
Liquid can detect protein expression signal (as shown in Figure 8) on 5200 chemiluminescence detectors in day, and succeed table as can be seen from the results
Up to SbJAZ1 albumen out.
Nucleotide series table:
SEQUENCE LISTING
Sequence table
<110>Guizhou University
<120>a kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expression
<160> 4
<210>1
<211>606
<212>DNA
<213>sorghum responses of drought stress gene SbJAZ1
<400>1
ATGGCCGCCG AGCAGCAGCA GCAGCCTGCC AAGGCCGCCG CGGCCGGCAG CAGGTTCGCG 60
GTGACGTGCG GCCTGCTGAG GCAGTACATG AAGGAGCAGG GCGGCAGCGG CGCCACCAGG 120
TGCCTCGCGC CGGCCGTCGC CATGGGCCTC ATGCCGGAAG CCGACGCTGC GGCGGCTGCG 180
ACCGAGGAGA GGACCACCGT GCTGGAGCTC TTCCCGCAGC AGGCTGGCAC GCTCAAAGAC 240
GAGCAGCAAA GGAAGAGGAA GGAGCCTGCG GACGGGAGAG CGCCGCTGAC CATCTTCTAC 300
GGCGGAAAGA TGGTGGTGTT CGACGACTTC CCCGCGGAGA AGGCCGAGGA GCTCATGCAG 360
CTCGCCGGCT CCGGCGGCAA CGCCGCGCCC GCCGCCGAGA ACGCGCTGGG ACAGCCCAGC 420
CTCACAGACA TGCCCCTCGC GAGGAAGGTG TCGCTCAAGA GGTTCCTCGA GAAGAGGAAG 480
AACAGGCTCA CCGCGGCGGA TCCATACCCG GCGGCGGCAA GTGAGTCGTC GACCAAGCAG 540
CCTCCTGCTG TTAAGGAGGA GGGCGCGCCG TGGCTCGGCG TGAGCTCCGC GCTCAGCCTC 600
AGCTGA 606
<210>2
<211>201
<212>PRT
<213>sorghum responses of drought stress gene SbJAZ1
<400>2
MAAEQQQQPA KAAAAGSRFA VTCGLLRQYM KEQGGSGATR CLAPAVAMGL MPEADAAAAA 60
TEERTTVLEL FPQQAGTLKD EQQRKRKEPA DGRAPLTIFY GGKMVVFDDF PAEKAEELMQ 120
LAGSGGNAAP AAENALGQPS LTDMPLARKV SLKRFLEKRK NRLTAADPYP AAASESSTKQ 180
PPAVKEEGAP WLGVSSALSL S 201
<210>3
<211>23
<212>DNA
<213>artificial sequence
<400>3
GCGAATTCAT GGCCGCCGAG CAG 23
<210>4
<211>26
<212>DNA
<213>artificial sequence
<400>4
CGAAGCTTTC AGCTGAGGCT GAGCGC 26
Claims (9)
1. a kind of sorghum responses of drought stress gene SbJAZ1, which is characterized in that its nucleotide sequence is as shown in SEQ ID NO.1.
2. the protein of responses of drought stress gene SbJAZ1 coding as described in claim 1, amino acid sequence such as SEQ ID NO.2
It is shown.
3. the recombinant vector comprising gene described in claim 1.
4. recombinant vector according to claim 3, which is characterized in that the recombinant vector the preparation method is as follows: extract
Sorghum RNA, and reverse transcription goes out cDNA；Using cDNA as template amplification SbJAZ1 gene；By SbJAZ1 amplified production through EcoRI and
It after HindIII double digestion, is inserted into the pET-28a expression vector through same double digestion by DNA ligase, obtains recombination matter
Grain pET-28a-SbJAZ1.
5. recombinant vector according to claim 4, which is characterized in that using cDNA as template, utilize following primer amplification
SbJAZ1 gene, primer sequence are as follows:
Upstream primer: SbJAZ1-F:GCGAATTCATGGCCGCCGAGCAG underscore is EcoRI restriction enzyme site；
Downstream primer: SbJAZ1-R:CGAAGCTTTCAGCTGAGGCTGAGCGC underscore is HindIII restriction enzyme site；
Upstream and downstream primer is respectively as shown in SEQ ID NO.3,4.
6. a kind of method for expressing sorghum responses of drought stress gene SbJAZ1, which comprises the following steps:
(1) recombinant vector described in claim 3 or 4 converts Bacillus coli cells, obtains the recombination protokaryon of expression SbJAZ1
Express bacterial strain；
(2) it by recombined pronucleus expression strain inoculated to kanamycins or kanamycins+chloramphenicol fluid nutrient medium, is incubated overnight
Activated strains；
(3) the recombined pronucleus expression bacterial strain of activation is transferred to again in kanamycins or kanamycins+chloramphenicol fluid nutrient medium,
The expression of IPTG induction recombination SbJAZ1 is added after shake culture；
(4) it after the completion of inducing, recycles and purifies expressed SbJAZ1 recombinant protein.
7. the method for expression sorghum responses of drought stress gene SbJAZ1 according to claim 6, which is characterized in that step (3)
When middle earthquake culture is to OD600=0.5, the IPTG of final concentration of 0.8mM is added, in 25 DEG C of Fiber differentiations.
8. the method for expression sorghum responses of drought stress gene SbJAZ1 according to claim 6, which is characterized in that described to block that
Kanamycins is 50ug/mL in mycin fluid nutrient medium.
9. the method for expression sorghum responses of drought stress gene SbJAZ1 according to claim 6, which is characterized in that described to block that
Kanamycins is 50ug/mL, chloramphenicol 50ug/mL in mycin+chloramphenicol fluid nutrient medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910315066.2A CN109971769A (en) | 2019-04-18 | 2019-04-18 | A kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910315066.2A CN109971769A (en) | 2019-04-18 | 2019-04-18 | A kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expression |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109971769A true CN109971769A (en) | 2019-07-05 |
Family
ID=67085280
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910315066.2A Pending CN109971769A (en) | 2019-04-18 | 2019-04-18 | A kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109971769A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102630982B1 (en) * | 2023-05-10 | 2024-01-31 | 중앙대학교 산학협력단 | Pepper transcription factor CaJAZ1-03 gene and method for improving the resistance to the drought stress using CaJAZ1-03 in plants |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130305411A1 (en) * | 2010-10-07 | 2013-11-14 | Mayekawa Mfg. Co., Ltd. | Method for conferring disease resistance to plant |
| CN105874070A (en) * | 2013-09-13 | 2016-08-17 | 不来梅大学 | Transgenic plants for nitrogen fixation |
| WO2017000074A1 (en) * | 2015-07-02 | 2017-01-05 | Medicago Inc. | Jasmonic acid pathway activator |
| US20170218389A1 (en) * | 2016-01-14 | 2017-08-03 | The Samuel Roberts Noble Foundation, Inc. | Methods and compositions for stomata regulation, plant immunity, and drought tolerance |
| WO2017197322A1 (en) * | 2016-05-12 | 2017-11-16 | University Of Florida Research Foundation, Inc. | Drought tolerant plants |
| CN108546670A (en) * | 2018-04-19 | 2018-09-18 | 贵州大学 | A kind of method for transformation of the preparation method of Sorghum Protoplast and the protoplast of preparation |
| CN109575112A (en) * | 2019-01-22 | 2019-04-05 | 福建农林大学 | Application of the moso bamboo PhJAZ1 gene in the pest-resistant difference of the biennial bearing leaf of bamboo |
-
2019
- 2019-04-18 CN CN201910315066.2A patent/CN109971769A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130305411A1 (en) * | 2010-10-07 | 2013-11-14 | Mayekawa Mfg. Co., Ltd. | Method for conferring disease resistance to plant |
| CN105874070A (en) * | 2013-09-13 | 2016-08-17 | 不来梅大学 | Transgenic plants for nitrogen fixation |
| WO2017000074A1 (en) * | 2015-07-02 | 2017-01-05 | Medicago Inc. | Jasmonic acid pathway activator |
| US20170218389A1 (en) * | 2016-01-14 | 2017-08-03 | The Samuel Roberts Noble Foundation, Inc. | Methods and compositions for stomata regulation, plant immunity, and drought tolerance |
| WO2017197322A1 (en) * | 2016-05-12 | 2017-11-16 | University Of Florida Research Foundation, Inc. | Drought tolerant plants |
| CN108546670A (en) * | 2018-04-19 | 2018-09-18 | 贵州大学 | A kind of method for transformation of the preparation method of Sorghum Protoplast and the protoplast of preparation |
| CN109575112A (en) * | 2019-01-22 | 2019-04-05 | 福建农林大学 | Application of the moso bamboo PhJAZ1 gene in the pest-resistant difference of the biennial bearing leaf of bamboo |
Non-Patent Citations (6)
| Title |
|---|
| FU YONGQI等: "Changes of expression of JA signaling genes in lodicules before floret opening in sorghum", 《ACTA AGRICULTURAE UNIVERSITATIS JIANGXIENSIS》 * |
| NCBI: "PREDICTED: Sorghum bicolor uncharacterized LOC8059787 (LOC8059787), misc_RNA", 《GENBANK DATABASE》 * |
| PATERSON,A.H.等: "hypothetical protein SORBI_3001G482700 [Sorghum bicolor]", 《GENBANK DATABASE》 * |
| 段龙飞等: "茉莉酸信号途径中转录抑制因子JAZ蛋白家族的分子进化分析", 《植物学报》 * |
| 田生礼主编: "《分子生物学实验指导》", 30 April 2014, 华南理工大学出版社 * |
| 蒋君梅等: "高粱SbJAZ1基因克隆与表达分析", 《核农学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102630982B1 (en) * | 2023-05-10 | 2024-01-31 | 중앙대학교 산학협력단 | Pepper transcription factor CaJAZ1-03 gene and method for improving the resistance to the drought stress using CaJAZ1-03 in plants |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104087560A (en) | Bacterial laccase mutant protein, recombinant expression plasmid thereof, transformed engineering strain and fermentation preparation method thereof | |
| CN108315288A (en) | A kind of recombination bacillus coli and its construction method and the application of expression formamidase and phosphorous acid dehydrogenase fusion proteins | |
| WO2021100642A1 (en) | Modified cyanobacterium, modified cyanobacterium production method, and protein production method | |
| US10519203B2 (en) | Gene for biosynthesis of core structure of ophiobolin | |
| CN102586286B (en) | Expression system of bacillus thur ingiens (Bt) insecticidal protein Cry1Ac-a | |
| CN108642073A (en) | A kind of vivoexpression of pears PbrRALF2 protein and its preparation method of polyclonal antibody | |
| CN109913478A (en) | A kind of sorghum E3 ubiquitin ligase SbBAG4 gene and its recombinant vector and expression | |
| CN102465134B (en) | Method for preparing recombinant anthropogenic Cu/Zn superoxide dismutase | |
| CN103467584A (en) | Method for obtaining and fermenting prokaryotic genetic-engineered hybrid cationic antimicrobial peptide CC | |
| CN109971769A (en) | A kind of sorghum responses of drought stress gene SbJAZ1 and its recombinant vector and expression | |
| CN109810987A (en) | A kind of disease-resistant SbSGT1 gene of sorghum and its recombinant vector and expression | |
| CN109971770A (en) | A kind of sorghum C2H2 zinc finger protein gene SbZFP36 and its recombinant vector and expression | |
| CN109912705A (en) | A kind of sorghum 14-3-3 Protein G F14c gene and its recombinant vector and expression | |
| CN109943574A (en) | A kind of sorghum 14-3-3 Protein G F14b gene and its recombinant vector and expression | |
| CN109971767A (en) | A kind of sorghum transcription factor SbWRKY45 gene and its recombinant vector and expression | |
| CN109913471A (en) | A kind of sorghum transcription factor SbGRF4 gene and its recombinant vector and expression | |
| CN109810986A (en) | A kind of sorghum 14-3-3 Protein G F14a gene and its recombinant vector and expression | |
| CN109971768A (en) | A kind of sorghum transcription factor SbSBP5 gene and its recombinant vector and expression | |
| CN111139208B (en) | High-yield engineering bacterium for producing ivermectin and preparation method and application thereof | |
| CN109913472A (en) | A kind of sorghum transcription factor SbTCP14 gene and its recombinant vector and expression | |
| CN110055262A (en) | A kind of sorghum transcription factor SbKNOX1 gene and its recombinant vector and expression | |
| CN102199202B (en) | Gene of recombinant fungal immunomodulatory protein between ganodermas, protein coded thereby, and application thereof | |
| CN110117607A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein Pit2 gene | |
| CN111139207B (en) | Brevibacillus brevis gene recombinant strain and preparation method and application thereof | |
| CN110423770A (en) | A kind of recombinant vector and expression of ustilago zeae effect protein CMU1 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190705 |