CN103719137A - Pest control method - Google Patents

Abstract

The invention relates to a method for controlling prodenia litura pests. The method comprises the step that the prodenia litura pests are contacted with Cry1F protein. According to the invention, the prodenia litura pests are controlled by Cry1F protein which is generated in plants and can kill prodenia litura; and compared with an agricultural control method, a chemical control method and a physical control method used in the prior art, the pest control method can be used for protecting whole plants at the whole growth periods so as to prevent and control attack of the prodenia litura pests, and is further free of pollution and residue, stable and thorough in effect, simple, convenient and economical.

Description

The method of Control pests

Technical field

The present invention relates to a kind of method of Control pests, particularly relate to a kind of Cry1F albumen of expressing in plant that is used in and control the cause harm method of plant of prodenia litura.

Background technology

Prodenia litura (Prodenia litura) belongs to Lepidoptera Noctuidae, for omnivorousness and gluttony insect, the host of causing harm is quite extensive, except corn and soybean, also can endanger and comprise melon, eggplant, beans, green onion, leek, spinach and brassicaceous vegetable, grain, economic crops Deng Jin 100 sections, 300 various plants; The worldwide distribution of spodoptera, there is generation domestic various places, mainly occur in the Yangtze river basin and the Huanghe valley.The prodenia litura blade back of trooping while mainly causing harm complete stool, younger ones in an age group with larva is gnawed; Disperse after 3 ages to cause harm blade, tender stem, mature larvae can be eaten into food fruit.

Corn and soybean are the important cereal crops of China, and the grain loss causing because of prodenia litura is every year huge, have influence on what is more the survival state of local population.In order to prevent and treat prodenia litura, the main method of preventing and treating that people adopt conventionally has: cultural control, chemical control and physical control.

Cultural control is that regulation and control crop, insect, environmental factor, one of creation are conducive to plant growth and are unfavorable for the farmland ecological environment that prodenia litura occurs the multifactorial comprehensive coordination management of whole field ecosystem.As weed a garden, after results, turn over and shine soil or pour water, to destroy or to worsen its place of pupating, contribute to reduce worm source; Or in conjunction with management, extract conveniently pieces of an egg and the newly hatched larvae of the harm of trooping, to reduce worm source.Because cultural control is mostly preventive measure, application has certain limitation, can not, as emergency measure, when prodenia litura is broken out, just seem helpless.

Chemical control is pesticide control, to utilize chemical insecticide to carry out kill pests, it is the important component part of the prodenia litura comprehensive regulation, it has fast, the feature of convenient, easy and high economic benefit, particularly in the situation of the large generation of prodenia litura, the emergency measure that is absolutely necessary, it can be by its elimination before prodenia litura works the mischief.Chemical prevention and control method is mainly that medicament sprays at present.But chemical control also has its limitation, as tending to cause crops generation poisoning, insect, improper use develops immunity to drugs, and killed natural enemies, contaminated environment, make field ecosystem suffer to destroy and residue of pesticide to adverse consequencess such as the safety of people, animal constitute a threat to.

The mainly reaction to various physical factors in environmental condition according to insect of physical control, utilizes various physical factors as optical, electrical, look, temp. and humidity etc. and the method such as plant equipment is trapped and killed, steriliation by irradiation is carried out pest control.At present application more widely method mainly contain attract moths with lamps, syrupacetiacid bait trap and withy dip in and spill 500 times of chlorophos trapping moths; Although said method has control efficiency in various degree, in operation, there is certain difficulty.

In order to solve cultural control, chemical control and physical control limitation in actual applications, scientists is found the anti insect gene of encoding insecticidal proteins to proceed in plant through research, can obtain some insect-resistant transgenic plants with control insect pest of the plant.Cry1F insecticidal proteins is a kind of in numerous insecticidal proteins, is the insoluble sexual partner's spore crystalline protein being produced by bacillus thuringiensis.

Cry1F albumen is taken in and is entered middle intestines by insect, and toxalbumin parent toxin is dissolved under the alkaline pH environment of insect midgut.Albumen N-and C-end, by basic protein enzymic digestion, are transformed into active fragment by parent toxin; Receptors bind on active fragment and insect midgut epithelial cell membrane upper surface, insertion goldbeater's skin, causes cell membrane to occur perforation focus, destroys the inside and outside osmotic pressure variation of cell membrane and pH balance etc., upsets the digestion process of insect, finally causes its death.

Proved that the plant that turns Cry1F gene can resist the infringement of the Lepidopteras such as black cutworm (Lepidoptera) insect, yet, there is no so far about express the transfer-gen plant of Cry1F albumen by generation and control the report that prodenia litura is caused harm to plant.

Summary of the invention

A kind of method that the object of this invention is to provide Control pests, provide first the transfer-gen plant of expressing Cry1F albumen by generation to control the method that prodenia litura is caused harm to plant, and effectively overcome the technological deficiencies such as prior art cultural control, chemical control and physical control.

For achieving the above object, the invention provides a kind of method of controlling prodenia litura insect, comprise prodenia litura insect is contacted with Cry1F albumen.

Preferably, described Cry1F albumen is Cry1Fa albumen.

Further, described Cry1Fa albumen is present in the plant cell that produces described Cry1Fa albumen, and described prodenia litura insect contacts with described Cry1Fa albumen by the described plant cell of ingesting.

Further, described Cry1Fa albumen is present in the genetically modified plants that produce described Cry1Fa albumen, described prodenia litura insect contacts with described Cry1Fa albumen by the tissue of the described genetically modified plants that ingest, after contact, the growth of described prodenia litura insect is suppressed and finally causes death, to realize the cause harm control of plant of prodenia litura.

Described genetically modified plants can be in any breeding time.

The tissue of described genetically modified plants can be blade, stem stalk, tassel, female fringe, flower pesticide, filigree or fruit.

Described to prodenia litura cause harm plant control because of plantation place change do not change.

Described prodenia litura is caused harm to the control of plant not because the change of implantation time changes.

Described plant can be from corn, soybean, cotton, sweet potato, taro, lotus, sesbania, tobacco, beet, Chinese cabbage or eggplant.

Step before described contact procedure is for planting the plant of the polynucleotides that contain the described Cry1Fa albumen of encoding.

Preferably, the amino acid sequence of described Cry1Fa albumen has the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2.The nucleotide sequence of described Cry1Fa albumen has the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

On the basis of technique scheme, described plant can also produce at least one the second nucleotide that is different from described Cry1Fa albumen.

Further, can encode Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, agglutinin, α-amylase or peroxidase of described the second nucleotide.

Preferably, can encode Cry1Ab albumen, Cry1Ac albumen, Cry1Ba albumen or Vip3A albumen of described the second nucleotide.

Further, described the second nucleotide comprises the nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6.

Selectively, described the second nucleotide is for suppressing the dsRNA of important gene in targeted insect insect.

For achieving the above object, the present invention also provides a kind of Cry1F protein to control the purposes of prodenia litura insect.

In the present invention, the expression of Cry1F albumen in a kind of genetically modified plants can be accompanied by the expression of one or more Cry class insect-killing proteins and/or Vip class insect-killing protein.Thisly surpass a kind of Pesticidal toxins co expression in same strain genetically modified plants and can plant be comprised and express required gene and realize by genetic engineering.In addition, a Plants (the 1st parent) can be expressed Cry1F protein by genetic engineering procedure, and the second plant (the 2nd parent) can be expressed Cry class insect-killing protein and/or Vip class insect-killing protein by genetic engineering procedure.By the 1st parent and the 2nd parent, hybridize and obtain the progeny plants of expressing all genes of introducing the 1st parent and the 2nd parent.

RNA disturbs (RNA interference, RNAi) to refer to the phenomenon of the efficient specificity degraded of high conservative, that brought out by double-stranded RNA (double-stranded RNA, dsRNA), homologous mRNA during evolution.Therefore can use in the present invention RNAi technology specific depletion or close the expression of specific gene in targeted insect insect.

Prodenia litura (Prodenia litura) belongs to Lepidoptera Noctuidae together with black cutworm (Agrotis ypsilon Rottemberg), is polyphagous pest-insect, all cause harm corn, soybean, cotton, sweet potato etc.However, prodenia litura and black cutworm be biologically clearly, distinct two species, at least there is the following main distinction:

1, distributed areas are different.The worldwide distribution of spodoptera, has generation all over China, mainly occurs in the province such as Henan, Hebei, Shandong of Jiangxi, Jiangsu, Hunan, Hubei, Zhejiang, Anhui and the Huanghe valley of the Yangtze river basin.And the greedy noctuid in meadow is mainly distributed in overseas, comprise Canada, Mexico, the U.S., Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, French Guiana, Guyana, Paraguay, Peru, Surinam, Uruguay, Venezuela and the whole Centro-American and Caribbean area in America.And black cutworm is global insect, in China various places, also all there is distribution, the Yangtze river basin and southeastern coast generating capacity especially abundant with rainfall, that weather is moistening are large, and mostly occur at east and southern humid region in the Northeast.

2, Damage habits is different.Prodenia litura is with the larva complete stool of causing harm, and the blade back of trooping during younger ones in an age group is gnawed lower epidermis and mesophyll, only stays epicuticle to be speculum; After 3 ages, disperse to cause harm blade, tender stem; Enter gluttony 4 ages later, stings food blade, only stays master pulse; Mature larvae can be eaten into food fruit; Its feeding habits are not only assorted but also endanger each organ, when aged, form gluttony, are the insects that a kind of harmfulness is very large.And black cutworm belongs to soil insect, 1-2 instar larvae all can be clustered in round the clock heart tender leaf place, seedling top and take food and cause harm; After 3 ages, disperse, larva Quick off the mark, have seemingly-dead habit, very responsive to light, be subject to agitation and crispatura agglomerating, hide daytime between the dry wet layer of table soil, be unearthed night and bite broken and pull soil pit into or sting the seed that food is not unearthed from ground by seedling plant, after the sclerosis of seedling stem, change food tender leaf and blade and growing point, when inanition or searching hibernacle, there is transport phenomena; It is high that high instar larvae is cut seedling rate, and food ingestion is large.

3, morphological feature is different.

1) avette state is different: the ovum of prodenia litura is flat hemispherical, primiparity yellow-white, after become lead, bulk is bonded together, and above covers yellowish-brown fine hair; And the ovum of black cutworm becomes steamed bun shape, tool is carina in length and breadth, primiparity milky, and gradual change is yellow, ovum one top tool stain before hatching.

2) Larva Morpho. Logy is different: the long 33-50 millimeter of Spodoptera litura larvae body, and head pitchy, chest is changeable, from khaki to blackish green, has, the scattered small particles of body surface, the Winter Solstice has subtriangular first quarter moon blackspot a pair of, larva general 6 ages; And black cutworm larvae cylindrical shape, the long 37-50mm of mature larva body, head brown, the irregular reticulate pattern of tool pitchy, body ash is brown to crineous, the particle that body surface is coarse, cloth is not of uniform size and separated from one another, lineback, sub-lineback and the equal pitchy of spiracular line, pronotary crineous, the vertical band of two obvious dark browns of tool on yellowish-brown podical plate, pereiopoda and abdominal foot yellowish-brown.

3) pupa form is different: the long 15-20mm of pupa of prodenia litura, and cylindrical shape, bronzing, afterbody has a pair of short thorn; And the long 18-24mm of the pupa of black cutworm, russet have light, mouthpart is mutually neat with wing bud end, all stretch and reach the 4th uromere trailing edge, belly 4-7 joint back side leading edge central authorities dark brown, and have thick punctum, the tiny punctum of both sides extends near valve, 5-7 ventrite leading edge also has tiny punctum, 1 pair of the short cremaster of abdomen end tool.

4) adult form is different: prodenia litura becomes the long 14-20mm of polypide left and right, wing expanse 35-46mm, body crineous, chest back side adularescent feathering, fore wing taupe, decorative pattern is many, interior horizontal line and outer horizontal line white, be wavy, centre and have the oblique wealthy band line of obvious white, so claim prodenia litura, and the long 17-23mm of Agrotis Ypsilon body, wing expanse 40-54mm, head, chest back side crineous, foot brown, front foot shin, digitus outer rim taupe, middle metapedes respectively saves end taupe ring grain, fore wing brown, costal field pitchy, outer rim is with interior many crineous, baseline is light brown, horizontal line two-wire in black waveform, in black ring grain, there is a circle greyness, kidney shape line black tool black surround, its outer middle part has the black line of a wedge shape to extend outer horizontal line, middle horizontal line crineous waveform, the outer horizontal line brown of two-wire waveform, the sub-border line grey of irregular zigzag, its inner rim has three pointed tooths between middle arteries and veins, between sub-border line and outer horizontal line, on each arteries and veins, there is pore, border line black, filbert between outer horizontal line and sub-border line, pitchy beyond sub-border line, hind wing canescence, longitudinal vein and edge line brown, belly back side grey.

4, habit of growth is different with pests occurrence rule.There are (North China)-9 generations in 4 generations (Guangdong) in 1 year in prodenia litura, generally with mature larva or pupa, in the weeds of base limit, field, survives the winter, and In Guangzhou Area is without the phenomenon of really surviving the winter; Area to the north of the Yangtze river basin, this worm is easily freezed to death winter, and winter issue is not yet come to a conclusion, and infers that local worm source may migrate over from south; The Yangtze river basin is many to be occurred greatly in the 7-8 month, and the Huanghe valley is many to be occurred greatly in the 8-9 month.Adult goes out activity night, and the power of circling in the air is stronger, and tool phototaxis and chemotaxis are particularly responsive to fermentation products such as sweet and sour wine.Every female moth 3-5 piece of laying eggs, every approximately has ovum position 100-200, and ovum fecund, in the vein crotch of blade back, is laid eggs with dense, dark green crop more, and heap produces, and pieces of an egg are often covered with palea and are easily found, and the hatching thermophilic of ovum is 24 ℃ of left and right; Larva, when 25 ℃ of temperature, is gone through 14-20 days, and newly hatched larvae has the harm of trooping habit, starts to disperse after 3 ages, and mature larvae has volt property and seemingly-dead property in daytime, hides daytime at soil seam place more, climbs out of at dusk and takes food, and meets frightened will landing and rolls up the death situation of playing tricks.When foodstuff is not enough or not at that time, near field harm larva can migrate in groups, therefore there be being again commonly called as of " armyworm "; The applicable soil moisture of pupating be soil moisture content in 20% left and right, be 11-18 days pupa time.Prodenia litura is the insect of rampant harm of a kind of thermophily and resistant to elevated temperatures intermittence, and the growth thermophilic of each worm state is 28-30 ℃, but at high temperature (33-40 ℃), the also normal of living; Cold hardiness is very weak, under the long-time low temperature of 0 ℃ of left and right, substantially can not survive in the winter time.Favourable its grown, bred general high temperature time and season, and low temperature easily causes the mortality of worm pupa.Though these worm feeding habits are assorted, foodstuff situation, comprises different hosts, even same host different developmental phases or organ, and the rich of foodstuff lack, and its fertility breeding is had to obvious impact.Between plant, cropping index is high or favourable its generation of the field of excessive close planting.Natural enemy has the braconid of parasitic larva and polyhedrosis virus etc.And 3-4 generation occurs black cutworm for 1 year, mature larva or pupa are survived the winter in soil; Early spring, early March adult started to occur, generally mid or late March and April early and middle ten days there will be two moth appearances to contain the phases; Adult inertia on daytime, contains most to the activity first half of the night at dusk, likes eating fermentation product and the various nectar of acid, sweet, vinosity, and having phototaxis, larva to be divided into for 6 ages, 1,2 instar larvaes are first hided volt in the lobus cardiacus of assorted leather or plant, take food round the clock, at this moment appetite is very little, causes harm also very not remarkable; After 3 ages, hide daytime under table soil, and out cause harm night; 5,6 instar larvae appetite increase, and every larva can bite dish seedling 4-5 strain broken one night, many reach l0 strain more than; Larva significantly increases the resistance of medicament after 3 ages; To mid-April, it is the serious period that 1st generation larva is caused harm by the end of March; Occur from April, 2 in October to the, all to see and occur and cause harm from generation to generation; The Northwest two is to three generations, to the north of Great Wall general year two to three generations, year three generations to the north of the Yellow River on the south Great Wall, the Yellow River to be to reach Nian Sidai along the Yangtze River in the south, year four to five generations on the south the Changjiang river, six to seven generations of South Subtropical Area of China year; No matter year generation is how many, on producing, causes the first brood of larvae that is of seriously causing harm; The south winter generation adult February occurs, the national most areas emergence Sheng phase at late March to April, the middle ten days, Ningxia, the Inner Mongol are late April; How Agrotis Ypsilon 3 sprouted wings up at 10 o'clock in evening in the afternoon, hid daytime and located in foreign material and gap etc., started to circle in the air, look for food after dusk, mating after 3-4 days, laid eggs; Ovum is loose to be originated on short leaf close weeds and seedling, minority originates in dead leaf, in soil seam, the place near the ground ovum that falls is maximum, every female 800-1000 grain of laying eggs, nearly 2000; About approximately 5 days ovum phases, 6 ages of larva, indivedual 7-8 age, larval phase, differs greatly in various places, but the first generation is about 30-40 days; After larva is aging, in dark about 5cm soil chamber, pupate, pupa time about 9-19 days; High temperature is to the growth of black cutworm and disadvantage of reproduction, thereby negligible amounts occurs summer, and suitable existence temperature is 15 ℃-25 ℃; Winter temperature is too low, and the lethality of black cutworm larvae increases; All physical features low humidities, the place that rainfall is abundant, occurs more; The first year autumn rain many, soil moisture is large, weedy to be conducive to Adult worms producting eggs and larval feeding movable, is the omen of the large generation of Second Year; But precipitation is too much, humidity is excessive, is unfavorable for larvae development, very easily dead after first instar larvae waterflooding; Adult worms producting eggs Sheng phase soil moisture content causes harm heavier in the area of 15-20%; Sandy loam, easily permeable, draining is rapid, is suitable for black cutworm breeding, heavy clay and sandy soil occur lighter.

Comprehensively above-mentioned, can determine that prodenia litura and black cutworm are two kinds of insects, and affiliation is far away, cannot mating produce offspring.

The genome of the plant described in the present invention, plant tissue or plant cell, refers to any genetic material in plant, plant tissue or plant cell, and comprises cell nucleus and plastid and mitochondrial genomes.

" contact " described in the present invention, refer to insect and/or insect touching, stop and/or feeding plant, plant organ, plant tissue or plant cell, described plant, plant organ, plant tissue or plant cell can be both its expression in vivo insecticidal proteins, can also be that the surface of described plant, plant organ, plant tissue or plant cell has insecticidal proteins and/or has the microorganism that produces insecticidal proteins.

Polynucleotides described in the present invention and/or nucleotide form complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, polynucleotides of the present invention and/or nucleotide can be placed under object host's regulating and controlling sequence control.

Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand that has produced DNA in plant.Like this, the present invention includes the use to the polynucleotides of example in sequence table and complementary strand thereof.Normal " coding strand " using in this area refers to the chain of being combined with antisense strand.For marking protein in vivo, typical case is transcribed into a chain of DNA the complementary strand of a mRNA, and it translates protein as template.MRNA is actually from " antisense " chain of DNA and transcribes." have justice " or " coding " chain has a series of codons (codon is three nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form destination protein matter or peptide.The present invention also comprises that the DNA with example has RNA and the PNA(peptide nucleic acid of suitable function).

Amplifying nucleic acid molecule of the present invention or its fragment under stringent condition with Cry1Fa gene recombination of the present invention.The nucleic acid hybridization of any routine or amplification method may be used to identify the existence of Cry1Fa gene of the present invention.Nucleic acid molecules or its fragment can be carried out specific hybrid with other nucleic acid molecules under a stable condition.In the present invention, if two nucleic acid molecules can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecules can carry out specific hybrid to each other.If two nucleic acid molecules demonstrate complementarity completely, claim that one of them nucleic acid molecules is another nucleic acid molecules " complement ".In the present invention, when each nucleotide of a nucleic acid molecules and the corresponding nucleotide complementation of another nucleic acid molecules, claim these two nucleic acid molecules to demonstrate " complete complementary ".If thereby two nucleic acid molecules can make with enough stability phase mutual crosses them anneal and be bonded to each other under at least conventional " low strict " condition, claim these two nucleic acid molecules for " minimum level is complementary ".Similarly, if thereby two nucleic acid molecules can make with enough stability phase mutual crosses them under " highly strict " condition of routine, anneal and be bonded to each other, and claim these two nucleic acid molecules to there is " complementarity ".From complete complementary, depart from and can allow, as long as this, depart from two molecules of incomplete prevention and form duplex structure.In order to make a nucleic acid molecules as primer or probe, only need to guarantee that it has sufficient complementarity in sequence, so that can form stable duplex structure under adopted specific solvent and salinity.

In the present invention, the sequence of basic homology is one section of nucleic acid molecules, this nucleic acid molecules under height stringent condition can with the complementary strand generation specific hybrid of another section of nucleic acid molecules matching.Promote the applicable stringent condition of DNA hybridization, for example, process greatly under 45 ℃ of conditions by 6.0 * sodium chloride/sodium citrate (SSC), then under 50 ℃ of conditions, with 2.0 * SSC, wash, these conditions are known to those skilled in the art.For example, the salinity in washing step can be selected from the approximately 2.0 * SSC, 50 ℃ of low stringent condition to the approximately 0.2 * SSC of height stringent condition, 50 ℃.In addition, the temperature condition in washing step can, from approximately 22 ℃ of the room temperatures of low stringent condition, be elevated to approximately 65 ℃ of height stringent condition.Temperature condition and salinity can all change, and also can one of them remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 * SSC, 0.5%SDS solution, at 65 ℃, with SEQ ID NO:3 or SEQ ID NO:4, specific hybrid occurs, and then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.

Therefore, there is anti-insect activity and comprise in the present invention with the sequence of SEQ ID NO:3 of the present invention and/or SEQ ID NO:4 hybridization under stringent condition.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence homology.

Gene described in the present invention and protein not only comprise specific exemplary sequence, also comprise the part and/fragment (comprise with full length protein and comparing and/or terminal deletion), variant, mutant, substituent (having the amino acid whose protein of substituting), chimera and fusion of the insecticidal activity feature of the protein of having preserved described particular example.Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the albumen of equal value of insecticidal activity.Described " albumen of equal value " refers to the bioactive albumen with the albumen of claim with identical or essentially identical anti-prodenia litura insect.

" fragment " of the DNA molecular described in the present invention or protein sequence or " brachymemma " refer to a part or its artificial reconstructed form (sequence that is for example applicable to expression of plants) of the original DNA that relates to or protein sequence (nucleotide or amino acid), can there is variation in the length of aforementioned sequence, but length sufficient to guarantee (coding) protein is insect toxins.

Use standard technique can modifier gene and the easy gene variant that builds.For example, the technology of well known manufacturing place sudden change.For example U.S. Patent number 5605793 has been described the method for using DNA to reassembly other molecular diversity of generation after random fracture again.Can use commercialization endonuclease to manufacture the fragment of full-length gene, and can use exonuclease according to standardization program.For example, can use enzyme such as Bal31 or direct mutagenesis from the end system of these genes excise nucleotide.Can also use multiple restriction enzyme to obtain the gene of coding active fragment.Can use protease directly to obtain the active fragment of these toxin.

The present invention can derive from B.t. separator and/or DNA library the gene of albumen of equal value and/or these albumen of equal value of encoding.There is several different methods to obtain insecticidal proteins of the present invention.For example, can use the antibody of the open and claimed insecticidal proteins of the present invention to identify and separated other albumen from protein mixture.Especially, antibody may be that the most constant by albumen and the most different from other B.t. albumen protein parts causes.Then can by immunoprecipitation, enzyme linked immunosorbent assay (ELISA) (ELISA) or western trace method use these antibody single-minded identify the albumen of equal value of feature activity.Can use this area standardization program to be easy to the antibody of the fragment of disclosed albumen in preparation the present invention or albumen of equal value or this plastein.Then can from microorganism, obtain the gene of these albumen of coding.

Due to the Feng Yuxing of genetic codon, the multiple different DNA sequence dna identical amino acid sequence of can encoding.Produce the alternative DNA sequence dna of these encode identical or essentially identical albumen just in those skilled in the art's technical merit.These different DNA sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, disappearance, interpolation or insertion but does not affect in fact the sequence of insecticidal activity, also comprises the fragment that retains insecticidal activity.

In the present invention, the replacement of amino acid sequence, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, and the folding and/or active conserved amino acid that does not significantly affect albumen replaces; Little disappearance, common about 1-30 amino acid whose disappearance; Little amino or c-terminus extend, and for example aminoterminal extends a methionine residues; Little connection peptide, for example an about 20-25 residue is long.

The conservative example replacing is the replacement occurring in following amino acid group: basic amino acid (as arginine, lysine and histidine), acidic amino acid (as glutamic acid and aspartic acid), polar amino acid (as glutamine, asparagine), hydrophobic amino acid (as leucine, isoleucine and valine), ArAA (as phenyl alanine, tryptophan and tyrosine), and little molecule amino acid (as glycine, alanine, serine, threonine and methionine).Conventionally those 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors that do not change given activity are well-known in this area, and by, for example, N.Neurath and R.L.Hill are described in the < < Protein > > of new york academic publishing house (Academic Press) in 1979 publication.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.

For a person skilled in the art apparently, this replacement can occur outside the region that molecular function is played an important role, and still produces active peptides.For by polypeptide of the present invention, it is active essential and therefore select not substituted amino acid residue, can be according to methods known in the art, as direct mutagenesis or alanine scanning mutagenesis identify (as referring to, Cunningham and Wells, 1989, Science244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in molecule, detects the anti-insect activity of gained mutating molecule, thereby determines the amino acid residue that this molecular activity is overstated and wanted.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can be measured by the technology such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, as de Vos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc., 1992, FEBS Letters309:59-64).

In the present invention, Cry1F albumen includes but not limited to Cry1Fa2, Cry1Fa3, Cry1Fb3, Cry1Fb6 or Cry1Fb7 albumen, or has at least 70% autoploidy with the amino acid sequence of above-mentioned albumen and prodenia litura is had to desinsection fragment or the functional area of insecticidal activity.

Therefore the amino acid sequence that, has certain autoploidy with the amino acid sequence shown in sequence 1 and/or 2 is also included within the present invention.These sequences and sequence similarity/homogeny of the present invention are typically greater than 60%, are preferably greater than 75%, are preferredly greater than 80%, are even preferredly greater than 90%, and can be greater than 95%.Also can be according to more specific homogeny and/or similarity scope definition preferred polynucleotides of the present invention and protein.For example there are 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homogeny and/or similarity with the sequence of example of the present invention.

Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhancer, and targeting sequencing, intron and other are operably connected to the adjusting sequence of described Vip plastein and Cry plastein.

Described promotor is effable promotor in plant, and described " effable promotor in plant " refers to the promotor of guaranteeing that connected coded sequence is expressed in plant cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from 35S promoter, the ubi promoter of maize of cauliflower mosaic virus, the promotor of paddy rice GOS2 gene etc.Alternatively, in plant, effable promotor can be tissue-specific promotor, this promotor is in some tissues of plant as instructed the expression of coded sequence higher than its hetero-organization of plant (can be tested and be measured by conventional RNA), as PEP carboxylase promotor in chlorenchyma.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound causing, is significantly increased under the expression compared with normal growth conditions of the coded sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the promotor of the protease suppressor of potato and tomato (pin I and pin II) and zein enzyme suppressor (MPI).

Described transit peptides (claiming again secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specific organelle or cellular compartment, concerning receptor protein, described transit peptides can be allos, for example, utilize coding chloroplast transit peptide sequence target chloroplast, or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described targeting sequencing including but not limited to, picornavirus targeting sequencing, as EMCV targeting sequencing (encephalomyocarditis virus 5 ' noncoding region); Potyvirus group targeting sequencing, as the MDMV(corn mosaic virus that stunts) targeting sequencing; Human immunoglobulin matter heavy chain conjugated protein (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate targeting sequencing (AMV RNA4); Tobacco mosaic virus (TMV) targeting sequencing.

Described enhancer including but not limited to, cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) enhancer, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon application, described intron including but not limited to, corn hsp70 intron, corn ubiquitin intron, Adh introne 1, sucrose synthase intron or paddy rice Act1 intron.For dicotyledon application, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can be the applicable polyadenylation signal sequence working in plant, include but not limited to, derive from Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene polyadenylation signal sequence, derive from protease inhibitors II (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

Described in the present invention, " effectively connect " connection that represents nucleotide sequence, described connection makes a sequence that the function needing concerning the sequence that is connected can be provided.In the present invention, " effectively connect " and can, for promotor is connected with interested sequence, makes transcribing of this interested sequence be subject to this promotor and control and regulate and control.When interested sequential coding albumen and while going for the expression of this albumen " effectively connecting " represent: promotor is connected with described sequence, and connected mode is efficiently translated the transcript obtaining.If when promotor is the expression of transcript fusion and the albumen of wanting realization coding with being connected of coded sequence, manufacture such connection, in the transcript that makes to obtain, the first translation initiation codon is the initiation codon of coded sequence.Alternatively, when if promotor is the expression of translation fusion and the albumen of wanting realization coding with being connected of coded sequence, manufacture such connection, the first translation initiation codon and the promotor that in 5 ' non-translated sequence, contain are connected, and connected mode make the relation of the translation opening code-reading frame of the albumen that the translation product that obtains and coding want meet reading frame.The nucleotide sequence that can " effectively connect " includes but not limited to: it (is gene expression element that the sequence of gene expression function is provided, promotor for example, 5 ' untranslated region, intron, encoding histone region, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), it (is T-DNA border sequence that the sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, integrase recognition site), it (is antibiotic resistance markers that the sequence of selectivity function is provided, biosynthesis gene), the sequence of the label function of can scoring is provided, sequence external or the interior assistance of body series of operations (is polylinker sequence, locus specificity recombination sequence) and the sequence of copy function is provided (is the origin of replication of bacterium, autonomously replicating sequence, centromeric sequence).

It is poisonous that " desinsection " described in the present invention refers to crop pests.More specifically, targeted insect is prodenia litura insect.

In the present invention, Cry1F albumen has toxicity to prodenia litura insect.Plant in the present invention, particularly soybean and corn, in its genome, contain foreign DNA, the nucleotide sequence that described foreign DNA comprises coding Cry1F albumen, prodenia litura insect is organized with this albumen and is contacted by feeding plant, and after contact, prodenia litura insect growth is suppressed and finally causes death.Suppress to refer to lethal or sub-lethal.Meanwhile, plant should be normal in form, and can under conventional method, cultivate consumption and/or the generation for product.In addition, this plant can be eliminated substantially to the needs of chemistry or biological insecticides (described chemistry or biological insecticides are the insecticide of the prodenia litura insect for Cry1F albumen institute target).

The expression of insecticidal crystal protein in vegetable material (ICP) can detect by described several different methods in this area, for example by application special primer to organizing the mRNA of the coded insect-killing protein of interior generation to carry out quantitatively, or the direct amount of the insect-killing protein of specific detection generation.

Can apply the insecticidal effect of ICP in different test determination plants.In the present invention, targeted insect is mainly prodenia litura.

In the present invention, described Cry1F albumen can have the amino acid sequence shown in SEQ ID NO:1 in sequence table and/or SEQ ID NO:2.Except the code area that comprises Cry1F albumen, also can comprise other elements, for example the protein of codes selection mark.

In addition, the expression cassette of the nucleotide sequence that comprises code book invention Cry1F albumen can also be expressed with together with the protein of at least one herbicide resistance gene of encoding in plant, described herbicide resistance gene includes but not limited to, phosphine oxamate resistant gene is (as bar gene, pat gene), phenmedipham resistant gene (as pmph gene), glyphosate resistance gene (as EPSPS gene), Brominal (bromoxynil) resistant gene, sulfonylureas resistant gene, resistant gene to weed killer herbicide dalapon, resistant gene to the resistant gene of cyanamide or glutamine synthetase inhibitor (as PPT), thereby obtain, both there is high insecticidal activity, the genetically modified plants again with Herbicid resistant.

In the present invention, foreign DNA is imported to plant, as by the gene of the described Cry1F albumen of coding or expression cassette or recombinant vector importing plant cell, conventional method for transformation includes but not limited to, agriculture bacillus mediated conversion, micro-transmitting bombardment, the direct DNA importing of DNA being taken in to protoplast, electroporation or silicon whisker mediation.

A kind of method that the invention provides Control pests, has the following advantages:

1, internal cause control.Prior art is to be mainly that external cause is controlled causing harm of prodenia litura insect by external action, as cultural control, chemical control and physical control; And the present invention to be the Cry1F albumen can kill prodenia litura by producing in plant corpus control prodenia litura insect, by internal cause, prevent and treat.

2, pollution-free, noresidue.Although the chemical prevention and control method that prior art is used has played certain effect to controlling causing harm of prodenia litura insect, also people, animal and field ecosystem has been brought to pollution, destruction and residual simultaneously; Use the present invention to control the method for prodenia litura insect, can eliminate above-mentioned adverse consequences.

3, control in the time of infertility.The method of the control prodenia litura insect that prior art is used is all interim; and the present invention carries out the protection in the time of infertility to plant; genetically modified plants (Cry1F albumen) from germinateing, growth, until bloom, result, can avoid suffering the infringement of prodenia litura.

4, whole plant control.The method of the control prodenia litura insect that prior art is used is locality mostly, as foliage-spray; And the present invention protects whole plant, as the blade of genetically modified plants (Cry1F albumen), stem stalk, tassel, female fringe, flower pesticide, filigree, fruit etc. all can be resisted prodenia litura infringement.

5, effect stability.What prior art was used is that cultural control method or physical control method all need to utilize environmental condition to prevent and treat insect, and variable factor is more; The present invention expresses described Cry1F albumen in plant corpus, effectively avoided the unsettled defect of environmental condition, and the control efficiency of genetically modified plants of the present invention (Cry1F albumen) in different location, different time, different genetic background be all also stable and consistent.

6, simple, convenient, economical.The physical control method that prior art is used has certain difficulty in agricultural production operation; The present invention only need plant the genetically modified plants that can express Cry1F albumen, and does not need to adopt other measure, thereby has saved a large amount of human and material resources and financial resources.

7, effect is thorough.The method of the control prodenia litura insect that prior art is used, its effect is halfway, only plays and alleviates effect; And genetically modified plants of the present invention (Cry1F albumen) can be caused the mortality of just incubating Spodoptera litura larvae, and fraction survival larvae development progress is caused to great inhibition, after 3 days, larva is substantially still in just incubating state or between just incubate-negative control state, it is all obvious depauperation, and stasi, genetically modified plants are only subject to slight damage substantially.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is that the recombinant cloning vector DBN01-T that contains Cry1Fa-01 nucleotide sequence of the method for Control pests of the present invention builds flow chart;

Fig. 2 is that the recombinant expression carrier DBN100014 that contains Cry1Fa-01 nucleotide sequence of the method for Control pests of the present invention builds flow chart;

Fig. 3 is that the recombinant expression carrier DBN100015 that contains Cry1Fa-01 nucleotide sequence of the method for Control pests of the present invention builds flow chart;

Fig. 4 is the pest-resistant design sketch that the transgenic corn plant of the method for Control pests of the present invention is inoculated prodenia litura;

Fig. 5 is the pest-resistant design sketch that the Transgenic soybean plants of the method for Control pests of the present invention is inoculated prodenia litura.

Embodiment

Below by specific embodiment, further illustrate the technical scheme of the method for Control pests of the present invention.

The acquisition of the first embodiment, Cry1Fa gene and synthetic

1, obtain Cry1Fa nucleotide sequence

The amino acid sequence of Cry1Fa-01 insect-killing protein (605 amino acid), as shown in SEQ ID NO:1 in sequence table; Coding is corresponding to the Cry1Fa-01 nucleotide sequence (1818 nucleotide) of the amino acid sequence (605 amino acid) of described Cry1Fa-01 insect-killing protein, as shown in SEQ ID NO:3 in sequence table; The amino acid sequence of Cry1Fa-02 insect-killing protein (1148 amino acid), as shown in SEQ ID NO:2 in sequence table; Coding is corresponding to the Cry1Fa-02 nucleotide sequence (3447 nucleotide) of the amino acid sequence (1148 amino acid) of described Cry1Fa-02 insect-killing protein, as shown in SEQ ID NO:4 in sequence table.

2, obtain Cry1Ab and Vip3A nucleotide sequence

The Cry1Ab nucleotide sequence (2457 nucleotide) of the amino acid sequence (818 amino acid) of coding Cry1Ab insect-killing protein, as shown in SEQ ID NO:5 in sequence table; The Vip3A nucleotide sequence (2370 nucleotide) of the amino acid sequence (789 amino acid) of coding Vip3A insect-killing protein, as shown in SEQ ID NO:6 in sequence table.

3, synthetic above-mentioned nucleotide sequence

Described Cry1Fa-01 nucleotide sequence (as shown in SEQ ID NO:3 in sequence table), as described in Cry1Fa-02 nucleotide sequence (as shown in SEQ ID NO:4 in sequence table), as described in Cry1Ab nucleotide sequence (as shown in SEQ ID NO:5 in sequence table) and as described in Vip3A nucleotide sequence (as shown in SEQ ID NO:6 in sequence table) by Nanjing Genscript Biotechnology Co., Ltd., synthesized; 5 ' end of synthetic described Cry1Fa-01 nucleotide sequence (SEQ ID NO:3) is also connected with AscI restriction enzyme site, and 3 ' end of described Cry1Fa-01 nucleotide sequence (SEQ ID NO:3) is also connected with BamHI restriction enzyme site; 5 ' end of synthetic described Cry1Fa-02 nucleotide sequence (SEQ ID NO:4) is also connected with AscI restriction enzyme site, and 3 ' end of described Cry1Fa-02 nucleotide sequence (SEQ ID NO:4) is also connected with BamHI restriction enzyme site; 5 ' end of synthetic described Cry1Ab nucleotide sequence (SEQ ID NO:5) is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry1Ab nucleotide sequence (SEQ ID NO:5) is also connected with SpeI restriction enzyme site; 5 ' end of synthetic described Vip3A nucleotide sequence (SEQ ID NO:6) is also connected with ScaI restriction enzyme site, and 3 ' end of described Vip3A nucleotide sequence (SEQ ID NO:6) is also connected with SpeI restriction enzyme site.

The structure of the second embodiment, recombinant expression carrier and recombinant expression carrier transform Agrobacterium

1, build the recombinant cloning vector that contains Cry1F gene

Synthetic Cry1Fa-01 nucleotide sequence is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operating procedure is undertaken by the product pGEM-T of Promega company carrier specification, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the origin of replication of phage f1; LacZ is LacZ initiation codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; Cry1Fa-01 is Cry1Fa-01 nucleotide sequence (SEQ ID NO:3); MCS is multiple clone site).

Then recombinant cloning vector DBN01-T is transformed to Escherichia coli T1 competent cell (Transgen by heat shock method, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of shaken cultivation 1 hour (under 100rpm rotating speed, shaking table shakes), on surface, scribble IPTG(isopropylthio-β-D-galactoside) and the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside) dull and stereotyped (the tryptone 10g/L of LB of ampicillin (100 mg/litre), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, in LB liquid nutrient medium (NaCl10g/L, ampicillin 100mg/L, adjusts pH to 7.5 with NaOH for tryptone 10g/L, yeast extract 5g/L) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant, and the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetra-acetic acid) of 100 μ l ice precoolings for precipitation thalline, 50mM glucose, pH8.0) suspends; The solution II (0.2M NaOH, 1%SDS(lauryl sodium sulfate) that adds the new preparation of 150 μ l), pipe is put upside down 4 times, mixed, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M potassium acetate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume absolute ethyl alcohols in supernatant, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandons supernatant, after the ethanol washing that precipitation is 70% by concentration (V/V), dries; Add 30 μ l containing RNase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, pH8.0) dissolution precipitation; Water-bath 30min at 37 ℃ of temperature, digestion RNA; In temperature-20, ℃ save backup.

The plasmid extracting is cut after evaluation through AscI and BamHI enzyme, positive colony is carried out to sequence verification, result shows that the described Cry1Fa-01 nucleotides sequence inserting in recombinant cloning vector DBN01-T classifies the nucleotide sequence shown in SEQ ID NO:3 in sequence table as, and Cry1Fa-01 nucleotide sequence correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic described Cry1Fa-02 nucleotide sequence is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN02-T, wherein, Cry1Fa-02 is Cry1Fa-02 nucleotide sequence (SEQ ID NO:4).Enzyme is cut with Cry1Fa-02 nucleotide sequence described in sequence verification recombinant cloning vector DBN02-T and is correctly inserted.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic described Cry1Ab nucleotide sequence is connected into cloning vector pGEM-T upper, obtain recombinant cloning vector DBN03-T, wherein, Cry1Ab is Cry1Ab nucleotide sequence (SEQ ID NO:5).Enzyme is cut with Cry1Ab nucleotide sequence described in sequence verification recombinant cloning vector DBN03-T and is correctly inserted.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic described Vip3A nucleotide sequence is connected into cloning vector pGEM-T upper, obtain recombinant cloning vector DBN04-T, wherein, Vip3A is Vip3A nucleotide sequence (SEQ ID NO:6).Enzyme is cut with Vip3A nucleotide sequence described in sequence verification recombinant cloning vector DBN04-T and is correctly inserted.

2, build the recombinant expression carrier that contains Cry1F gene

With restriction enzyme A scI and BamHI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), the Cry1Fa-01 nucleotide sequence fragment cutting is inserted between the AscI and BamHI site of expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, be built into recombinant expression carrier DBN100014, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:7); Cry1Fa-01:Cry1Fa-01 nucleotide sequence (SEQ ID NO:3); Nos: the terminator of rouge alkali synthetase gene (SEQ ID NO:8); PMI: Phophomannose isomerase gene (SEQ ID NO:9); LB: left margin).

Recombinant expression carrier DBN100014 is transformed to Escherichia coli T1 competent cell by heat shock method, and its hot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant expression carrier DBN100014), 42 ℃ of water-baths 30 seconds; 37 ℃ of shaken cultivation 1 hour (under 100rpm rotating speed, shaking table shakes); Then at LB solid plate (the tryptone 10g/L containing 50mg/L kanamycin (Kanamycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, kanamycin 50mg/L, adjusts pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme A scI and BamHI enzyme, and by the positive colony evaluation of checking order, result show the nucleotides sequence of recombinant expression carrier DBN100014 between AscI and BamHI site classify sequence table as in nucleotide sequence, i.e. Cry1Fa-01 nucleotide sequence shown in SEQ ID NO:3.

According to the method for above-mentioned structure recombinant expression carrier DBN100014, AscI and BamHI enzyme are cut to the described Cry1Fa-02 nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN02-T cuts, obtain recombinant expression carrier DBN100013.Enzyme cut with sequence verification recombinant expression carrier DBN100013 in nucleotide sequence containing nucleotide sequence shown in SEQ ID NO:4 in promising sequence table, be Cry1Fa-02 nucleotide sequence, described Cry1Fa-02 nucleotide sequence can connect described Ubi promotor and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100014, by AscI and BamHI, NcoI and SpeI respectively enzyme cut described Cry1Fa-01 nucleotide sequence and the Cry1Ab nucleotide sequence that recombinant cloning vector DBN01-T and DBN03-T cut and insert expression vector DBNBC-01, obtain recombinant expression carrier DBN100075.Enzyme cut with sequence verification recombinant expression carrier DBN100075 in nucleotide sequence containing nucleotide sequence shown in SEQ ID NO:3 in promising sequence table and SEQ ID NO:5, be Cry1Fa-01 nucleotide sequence and Cry1Ab nucleotide sequence, described Cry1Fa-01 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Cry1Ab nucleotide sequence.

According to the method for above-mentioned structure recombinant expression carrier DBN100014, by AscI and BamHI, ScaI and SpeI respectively enzyme cut described Cry1Fa-01 nucleotide sequence and the Vip3A nucleotide sequence that recombinant cloning vector DBN01-T and DBN04-T cut and insert expression vector DBNBC-01, obtain recombinant expression carrier DBN100276.Enzyme cut with sequence verification recombinant expression carrier DBN100276 in nucleotide sequence containing nucleotide sequence shown in SEQ ID NO:3 in promising sequence table and SEQ ID NO:6, be Cry1Fa-01 nucleotide sequence and Vip3A nucleotide sequence, described Cry1Fa-01 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Vip3A nucleotide sequence.

According to the method for above-mentioned structure recombinant expression carrier DBN100014, with restriction enzyme A scI and BamHI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-02(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), the Cry1Fa-01 nucleotide sequence fragment cutting is inserted between the AscI and BamHI site of expression vector DBNBC-02, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, be built into recombinant expression carrier DBN100015, it builds flow process (Kan: kanamycin gene as shown in Figure 3, RB: right margin, Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:7), Cry1Fa-01:Cry1Fa-01 nucleotide sequence (SEQ ID NO:3), Nos: the terminator of rouge alkali synthetase gene (SEQ ID NO:8), PAT: careless fourth phosphinothricin acetyl transferase gene (SEQ ID NO:22), LB: left margin).

According to the method for above-mentioned structure recombinant expression carrier DBN100015, AscI and BamHI enzyme are cut to the described Cry1Fa-02 nucleotide sequence insertion expression vector DBNBC-02 that recombinant cloning vector DBN02-T cuts, obtain recombinant expression carrier DBN100030.Enzyme cut with sequence verification recombinant expression carrier DBN100030 in nucleotide sequence containing nucleotide sequence shown in SEQ ID NO:4 in promising sequence table, be Cry1Fa-02 nucleotide sequence, described Cry1Fa-02 nucleotide sequence can connect described Ubi promotor and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100015, by AscI and BamHI, NcoI and SpeI respectively enzyme cut described Cry1Fa-01 nucleotide sequence and the Cry1Ab nucleotide sequence that recombinant cloning vector DBN01-T and DBN03-T cut and insert expression vector DBNBC-02, obtain recombinant expression carrier DBN100012.Enzyme cut with sequence verification recombinant expression carrier DBN100012 in nucleotide sequence containing nucleotide sequence shown in SEQ ID NO:3 in promising sequence table and SEQ ID NO:5, be Cry1Fa-01 nucleotide sequence and Cry1Ab nucleotide sequence, described Cry1Fa-01 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Cry1Ab nucleotide sequence.

According to the method for above-mentioned structure recombinant expression carrier DBN100015, by AscI and BamHI, ScaI and SpeI respectively enzyme cut described Cry1Fa-01 nucleotide sequence and the Vip3A nucleotide sequence that recombinant cloning vector DBN01-T and DBN04-T cut and insert expression vector DBNBC-01, obtain recombinant expression carrier DBN100031.Enzyme cut with sequence verification recombinant expression carrier DBN100031 in nucleotide sequence containing nucleotide sequence shown in SEQ ID NO:3 in promising sequence table and SEQ ID NO:6, be Cry1Fa-01 nucleotide sequence and Vip3A nucleotide sequence, described Cry1Fa-01 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Vip3A nucleotide sequence.

3, recombinant expression carrier transforms Agrobacterium

To building correct recombinant expression carrier DBN100014, DBN100013, DBN100075, DBN100276, DBN100015, DBN100030, DBN100012 and DBN100031, by liquid nitrogen method, be transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression carrier), be placed in liquid nitrogen 10 minutes, 37 ℃ of tepidarium 10 minutes, Agrobacterium LBA4404 after transforming is inoculated in LB test tube in 28 ℃ of temperature, rotating speed is under 200rpm condition, to cultivate 2 hours, be applied on the LB flat board that contains the rifampin (Rifampicin) of 50mg/L and the kanamycin (Kanamycin) of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking monoclonal, with restriction enzyme A hdI and XhoI to recombinant expression carrier DBN100014, DBN100013, DBN100012, DBN100075, DBN100015 and DBN100030 carry out enzyme and cut checking, with restriction enzyme A hdI and EcoRV, recombinant expression carrier DBN100031 and DBN100276 are carried out to enzyme and cut checking, result shows recombinant expression carrier DBN100014, DBN100013, DBN100075, DBN100276, DBN100015, DBN100030, DBN100012 and DBN100031 structure are entirely true.

The 3rd embodiment, proceed to acquisition and the checking of the milpa of Cry1F gene

1, obtain the milpa that proceeds to Cry1F gene

The Agrobacterium infestation method adopting according to routine, the corn variety of aseptic culture is combined to 31(Z31) rataria and the second embodiment in Agrobacterium described in 3 cultivate altogether, with by the 2 recombinant expression carrier DBN100014 that build in the second embodiment, DBN100013, T-DNA(in DBN100075 and DBN100276 comprises the promoter sequence of corn Ubiquitin gene, Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Ab nucleotide sequence, Vip3A nucleotide sequence, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, obtained the milpa that proceeds to Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, proceed to the milpa and the milpa that proceeds to Cry1Fa-01-Vip3A nucleotide sequence of Cry1Fa-01-Cry1Ab nucleotide sequence, in contrast with wild type milpa simultaneously.

For agriculture bacillus mediated corn, transform, briefly, separated immature rataria from corn, with agrobacterium suspension, contact rataria, wherein Agrobacterium can be passed to Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Fa-01-Cry1Ab nucleotide sequence and/or Cry1Fa-01-Vip3A nucleotide sequence at least one cell (step 1: infect step) of one of rataria, in this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in, to start, inoculate.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: be total to incubation step) altogether.Preferably, rataria after infecting step at solid culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) is upper to be cultivated.After this common cultivation stage, can there is optionally " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in, at least there is the antibiotic (cephalosporin) of a kind of known inhibition Agrobacterium growth, the selective agent (step 3: recovering step) of not adding vegetable transformant.Preferably, rataria is cultivated on the solid culture medium of selective agent having antibiotic but do not have, and take and eliminates Agrobacterium and provide convalescence as infected cell.Then, the rataria of inoculation is containing the transformed calli (step 4: select step) of cultivating and selecting growing on the medium of selective agent (mannose).Preferably, rataria is having the screening solid culture medium of selective agent (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 5g/L, mannose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, above cultivate with aftergrowth at solid culture medium (MS differential medium and MS root media) at the callus containing growing on the medium of selective agent.

The resistant calli that screening obtains is transferred to described MS differential medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, agar 8g/L, pH5.8) upper, cultivate differentiation at 25 ℃.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, at 25 ℃, be cultured to about 10cm high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day at 28 ℃, then at 20 ℃, cultivate 8 hours.

2, with TaqMan checking, proceed to the milpa of Cry1F gene

Get respectively and proceed to the milpa of Cry1Fa-01 nucleotide sequence, the milpa that proceeds to Cry1Fa-02 nucleotide sequence, the about 100mg of blade of milpa that proceeds to the milpa of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence as sample, with the DNeasy Plant Maxi Kit of Qiagen, extract its genomic DNA, by Taqman fluorescence probe quantitative PCR method, detect the copy number of Cry1F gene, Cry1Ab gene and Vip3A gene.In contrast with wild type milpa, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.

The concrete grammar that detects Cry1F gene, Cry1Ab gene and Vip3A gene copy number is as follows:

Step 11, get each 100mg of blade that proceeds to the milpa of Cry1Fa-01 nucleotide sequence, the milpa that proceeds to Cry1Fa-02 nucleotide sequence, the milpa that proceeds to Cry1Fa-01-Cry1Ab nucleotide sequence, the milpa that proceeds to Cry1Fa-01-Vip3A nucleotide sequence and wild type milpa respectively, in mortar, with liquid nitrogen, be ground into homogenate respectively, each sample is got 3 repetitions;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic DNA of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, use NanoDrop2000(Thermo Scientific) measure the genomic DNA concentration of above-mentioned sample;

Step 14, adjust above-mentioned sample genomic DNA concentration to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

Step 15, adopt Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, using through the sample of identifying known copy number as standard items, with the sample of wild type milpa in contrast, 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Cry1Fa-01 nucleotide sequence:

Primer 1(CF1): CAGTCAGGAACTACAGTTGTAAGAGGG is as shown in SEQ ID NO:10 in sequence table;

Primer 2 (CR1): ACGCGAATGGTCCTCCACTAG is as shown in SEQ ID NO:11 in sequence table;

Probe 1(CP1): CGTCGAAGAATGTCTCCTCCCGTGAAC is as shown in SEQ ID NO:12 in sequence table;

Following primer and probe are used for detecting Cry1Fa-02 nucleotide sequence:

Primer 3(CF2): CAGTCAGGAACTACAGTTGTAAGAGGG is as shown in SEQ ID NO:13 in sequence table;

Primer 4(CR2): ACGCGAATGGTCCTCCACTAG is as shown in SEQ ID NO:14 in sequence table;

Probe 2(CP2): CGTCGAAGAATGTCTCCTCCCGTGAAC is as shown in SEQ ID NO:15 in sequence table;

Following primer and probe are used for detecting Cry1Ab nucleotide sequence:

Primer 5(CF3): CGAACTACGACTCCCGCAC is as shown in SEQ ID NO:16 in sequence table;

Primer 6(CR3): GTAGATTTCGCGGGTCAGTTG is as shown in SEQ ID NO:17 in sequence table;

Probe 3(CP3): CTACCCGATCCGCACCGTGTCC is as shown in SEQ ID NO:18 in sequence table;

Following primer and probe are used for detecting Vip3A nucleotide sequence:

Primer 7(VF1): ATTCTCGAAATCTCCCCTAGCG is as shown in SEQ ID NO:19 in sequence table;

Primer 8(VR1): GCTGCCAGTGGATGTCCAG is as shown in SEQ ID NO:20 in sequence table;

Probe 4(VP1): CTCCTGAGCCCCGAGCTGATTAACACC is as shown in SEQ ID NO:21 in sequence table;

PCR reaction system is:

Each 45 μ l of every kind of primer that described 50 * primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l1 * TE buffer solution, and at 4 ℃, be housed in amber test tube.

PCR reaction condition is:

Utilize SDS2.3 software (Applied Biosystems) to analyze data.

Experimental result shows, Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Fa-01-Cry1Ab nucleotide sequence and Cry1Fa-01-Vip3A nucleotide sequence have all been incorporated in the chromosome set of detected milpa, and proceed to the milpa of Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, the milpa that proceeds to Cry1Fa-01-Cry1Ab nucleotide sequence has all obtained and has contained single copy Cry1F gene with the milpa that proceeds to Cry1Fa-01-Vip3A nucleotide sequence, the transgenic corn plant of Cry1Ab gene and/or Vip3A gene.

The pest-resistant effect detection of the 4th embodiment, transgenic corn plant

By proceeding to the milpa of Cry1Fa-01 nucleotide sequence, the milpa that proceeds to Cry1Fa-02 nucleotide sequence, the milpa that proceeds to Cry1Fa-01-Cry1Ab nucleotide sequence, the milpa that proceeds to Cry1Fa-01-Vip3A nucleotide sequence, wild type milpa and being accredited as not genetically modified milpa through Taqman, prodenia litura is carried out to pest-resistant effect detection.

Get respectively the milpa that proceeds to Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, proceed to the milpa of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to the milpa of Cry1Fa-01-Vip3A nucleotide sequence, wild type milpa and be accredited as the fresh blade (lobus cardiacus) of not genetically modified milpa (V3-V4 phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed to vein, be cut into the strip of about 1cm * 4cm simultaneously, getting 2 strip blades after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, in each culture dish, put the prodenia litura (newly hatched larvae) of 10 artificial feedings, worm examination culture dish is put into the square box that bottom is placed with wet gauze after adding a cover, at temperature 26-28 ℃, relative moisture 70%-80%, under the condition of photoperiod (light/dark) 16:8, place after 3 days, according to Spodoptera litura larvae development progress, three indexs of lethality and blade injury rate, obtain resistance total points: total points=100 * lethality+[100 * lethality+90 * (just incubate borer population/connect worm sum)+60 * (just incubate-negative control borer population/connect worm sum)+10 * (negative control borer population/connect worm sum)]+100 * (1-blade injury rate).Proceed to totally 3 strains (S1, S2 and S3) of Cry1Fa-01 nucleotide sequence, proceed to totally 3 strains (S4, S5 and S6) of Cry1Fa-02 nucleotide sequence, proceed to totally 3 strains (S7, S8 and S9) of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to totally 3 strains (S10, S11 and S12) of Cry1Fa-01-Vip3A nucleotide sequence, through Taqman, be accredited as not genetically modified (NGM1) totally 1 strain, (CK1) of wild type be totally 1 strain; From each strain, select 3 strains to test, every strain repeats 6 times.Result is as shown in table 1 and Fig. 4.

The pest-resistant experimental result of table 1, transgenic corn plant inoculation prodenia litura

The result of table 1 shows: proceed to the milpa of Cry1Fa-01 nucleotide sequence, the milpa that proceeds to Cry1Fa-02 nucleotide sequence, the raw total points of surveying of milpa that proceeds to the milpa of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence all in more than 250 minutes or left and right, partly can reach full marks 300 minutes; And the raw total points of surveying that is accredited as not genetically modified milpa and wild type milpa through Taqman is generally about 15 minutes.

The result of Fig. 4 shows: compare with wild type milpa, proceed to the milpa of Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, the milpa that proceeds to Cry1Fa-01-Cry1Ab nucleotide sequence can be caused the mortality of just incubating Spodoptera litura larvae with the milpa that proceeds to Cry1Fa-01-Vip3A nucleotide sequence in 3 days, and fraction survival larvae development progress is caused to great inhibition, after 3 days, larva substantially still incubates state in just, and proceed to the milpa of Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, the milpa that proceeds to Cry1Fa-01-Cry1Ab nucleotide sequence is only subject to slight damage substantially with the milpa that proceeds to Cry1Fa-01-Vip3A nucleotide sequence, its blade injury rate is all in 10% left and right or following.In addition when raw, survey duration arrival in the time of 5 days, larva is all dead.

Proof proceeds to the activity that the milpa of Cry1Fa-01 nucleotide sequence, the milpa that proceeds to Cry1Fa-02 nucleotide sequence, the milpa that proceeds to the milpa of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence all demonstrate high resistance prodenia litura thus, thereby this activity is enough to that the growth of prodenia litura is produced to ill effect, it is controlled.

The 5th embodiment, proceed to acquisition and the checking of the soybean plant strain of Cry1F gene

1, obtain the soybean plant strain that proceeds to Cry1F gene

The Agrobacterium infestation method adopting according to routine, Agrobacterium described in 3 in the cotyledonary node tissue of Huang 13 in the soybean varieties of aseptic culture and the second embodiment is cultivated altogether, with by the 2 recombinant expression carrier DBN100015 that build in the second embodiment, DBN100030, T-DNA(in DBN100012 and DBN100031 comprises the promoter sequence of corn Ubiquitin gene, Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Ab nucleotide sequence, Vip3A nucleotide sequence, pat gene and Nos terminator sequence) be transferred in soybean chromosome set, obtained the soybean plant strain that proceeds to Cry1Fa-01 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-02 nucleotide sequence, proceed to the soybean plant strain and the soybean plant strain that proceeds to Cry1Fa-01-Vip3A nucleotide sequence of Cry1Fa-01-Cry1Ab nucleotide sequence, in contrast with wild type soybean plant strain simultaneously.

For agriculture bacillus mediated transformation of soybean, briefly, by ripe soya seeds at soybean germination medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH5.6) in, sprout, seed is inoculated on germination medium, by following condition, cultivate: 25 ± 1 ℃ of temperature; Photoperiod (light/dark) is 16/8h.Sprout after 4-6 days and get the soybean aseptic seedling that expand at bud green cotyledonary node place, under cotyledonary node, 3-4 millimeter place cuts hypocotyl, longitudinally cuts cotyledon, removes terminal bud, lateral bud and seminal root.With the knife back of scalpel, at cotyledonary node place, carry out wound, the cotyledonary node tissue of crossing by agrobacterium suspension contact wound, wherein Agrobacterium can be passed to the construct of described mediated plant fertility cotyledonary node tissue (step 1: infect step) that wound crosses in this step, and cotyledonary node is organized and preferably immersed agrobacterium suspension (OD ₆₆₀=0.5-0.8, infects in medium (MS salt 2.15g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, MES (MES) 4g/L, zeatin (ZT) 2mg/L, pH5.3) to start inoculation.Cotyledonary node tissue and Agrobacterium are cultivated one period (3 days) (step 2: be total to incubation step) altogether.Preferably, cotyledonary node is above cultivated at solid culture medium (MS salt 4.3g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, MES (MES) 4g/L, zeatin 2mg/L, agar 8g/L, pH5.6) after being organized in and infecting step.After this common cultivation stage, can there is optionally " recovery " step.In " recovery " step, recovery media (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 2mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) in, at least there is the antibiotic (cephalosporin) of a kind of known inhibition Agrobacterium growth, the selective agent (step 3: recovering step) of not adding vegetable transformant.Preferably, the tissue block of cotyledon node regeneration is cultivated on the solid culture medium of selective agent having antibiotic but do not have, and take and eliminates Agrobacterium and provide convalescence as infected cell.Then, the tissue block of cotyledon node regeneration is containing the transformed calli (step 4: select step) of cultivating and selecting growing on the medium of selective agent (careless fourth phosphine).Preferably, the tissue block of cotyledon node regeneration is having the screening solid culture medium of selective agent (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, grass fourth phosphine 6mg/L, pH5.6) upper cultivation, cause the cell selective growth transforming.Then, the cytothesis of conversion becomes plant (step 5: regeneration step), preferably, above cultivate with aftergrowth at solid culture medium (B5 differential medium and B5 root media) at the tissue block of the cotyledon node regeneration containing growing on the medium of selective agent.

The resistance tissue block that screening obtains is transferred to described B5 differential medium (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, gibberellin 1mg/L, growth hormone 1mg/L, careless fourth phosphine 6mg/L, pH5.6) upper, cultivate differentiation at 25 ℃.Differentiation seedling is out transferred to described B5 root media (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, indole-3-butyric acid (IBA) 1mg/L), in culture of rootage, at 25 ℃, be cultured to about 10cm high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day at 26 ℃, then at 20 ℃, cultivate 8 hours.

2, with TaqMan checking, proceed to the soybean plant strain of Cry1F gene

Get respectively and proceed to the soybean plant strain of Cry1Fa-01 nucleotide sequence, the soybean plant strain that proceeds to Cry1Fa-02 nucleotide sequence, the about 100mg of blade of soybean plant strain that proceeds to the soybean plant strain of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence as sample, with the DNeasy Plant Maxi Kit of Qiagen, extract its genomic DNA, by Taqman fluorescence probe quantitative PCR method, detect the copy number of Cry1F gene, Cry1Ab gene and Vip3A gene.In contrast with wild type soybean plant strain, according to 2 use TaqMan in above-mentioned the 3rd embodiment, verify that the method for the milpa that proceeds to Cry1F gene detects analysis simultaneously.3 repetitions are established in experiment, average.

Experimental result shows, Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Fa-01-Cry1Ab nucleotide sequence and Cry1Fa-01-Vip3A nucleotide sequence have all been incorporated in the chromosome set of detected soybean plant strain, and proceed to the soybean plant strain of Cry1Fa-01 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-02 nucleotide sequence, the soybean plant strain that proceeds to Cry1Fa-01-Cry1Ab nucleotide sequence has all obtained and has contained single copy Cry1F gene with the soybean plant strain that proceeds to Cry1Fa-01-Vip3A nucleotide sequence, the Transgenic soybean plants of Cry1Ab gene and/or Vip3A gene.

The pest-resistant effect detection of the 6th embodiment, Transgenic soybean plants

By proceeding to the soybean plant strain of Cry1Fa-01 nucleotide sequence, the soybean plant strain that proceeds to Cry1Fa-02 nucleotide sequence, the soybean plant strain that proceeds to Cry1Fa-01-Cry1Ab nucleotide sequence, the soybean plant strain that proceeds to Cry1Fa-01-Vip3A nucleotide sequence, wild type soybean plant strain and being accredited as not genetically modified soybean plant strain through Taqman, prodenia litura is carried out to pest-resistant effect detection.

Get respectively the soybean plant strain that proceeds to Cry1Fa-01 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-02 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-01-Vip3A nucleotide sequence, wild type soybean plant strain and be accredited as the fresh blade of not genetically modified soybean plant strain (tri-leaf period) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, be cut into the square of about 2cm * 2cm simultaneously, getting 1 square blade after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, in each culture dish, put the prodenia litura (newly hatched larvae) of 10 artificial feedings, worm examination culture dish is put into the square box that bottom is placed with wet gauze after adding a cover, at temperature 26-28 ℃, relative moisture 70%-80%, under the condition of photoperiod (light/dark) 16:8, place after 3 days, according to Spodoptera litura larvae development progress, three indexs of lethality and blade injury rate, obtain resistance total points: total points=100 * lethality+[100 * lethality+90 * (just incubate borer population/connect worm sum)+60 * (just incubate-negative control borer population/connect worm sum)+10 * (negative control borer population/connect worm sum)]+100 * (1-blade injury rate).Proceed to totally 3 strains (S13, S14 and S15) of Cry1Fa-01 nucleotide sequence, proceed to totally 3 strains (S16, S17 and S18) of Cry1Fa-02 nucleotide sequence, proceed to totally 3 strains (S19, S20 and S21) of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to totally 3 strains (S22, S23 and S24) of Cry1Fa-01-Vip3A nucleotide sequence, through Taqman, be accredited as not genetically modified (NGM2) totally 1 strain, (CK2) of wild type be totally 1 strain; From each strain, select 3 strains to test, every strain repeats 6 times.Result is as shown in table 2 and Fig. 5.

The pest-resistant experimental result of table 2, Transgenic soybean plants inoculation prodenia litura

The result of table 2 shows: proceed to the soybean plant strain of Cry1Fa-01 nucleotide sequence, the soybean plant strain that proceeds to Cry1Fa-02 nucleotide sequence, the raw total points of surveying of soybean plant strain that proceeds to the soybean plant strain of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence all in more than 220 minutes or left and right, partly can reach full marks 300 minutes; And the raw total points of surveying that is accredited as not genetically modified soybean plant strain and wild type soybean plant strain through Taqman is generally about 40 minutes.

The result of Fig. 5 shows: compare with wild type soybean plant strain, the soybean plant strain that proceeds to Cry1Fa-01 nucleotide sequence can cause the mortality of just incubating Spodoptera litura larvae with the soybean plant strain that proceeds to Cry1Fa-02 nucleotide sequence, and fraction survival larvae development progress is caused to great inhibition, after 3 days, larva is substantially still in just incubate-negative control state, and its blade injury rate is in 20% left and right; The soybean plant strain that proceeds to Cry1Fa-01-Cry1Ab nucleotide sequence is almost absolutely the control efficiency of newly hatched larvae with the soybean plant strain that proceeds to Cry1Fa-01-Vip3A nucleotide sequence, the also stasi substantially of larva of surviving extremely is individually only minute quantity Pinhole-shaped slight damage on its blade.

Proof proceeds to the activity that the soybean plant strain of Cry1Fa-01 nucleotide sequence, the soybean plant strain that proceeds to Cry1Fa-02 nucleotide sequence, the soybean plant strain that proceeds to the soybean plant strain of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence all demonstrate anti-prodenia litura thus, thereby this activity is enough to that the growth of prodenia litura is produced to ill effect, it is controlled.

Above-mentioned experimental result also shows to proceed to the milpa of Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, proceed to the milpa of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to the milpa of Cry1Fa-01-Vip3A nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-01 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-02 nucleotide sequence, the soybean plant strain that proceeds to Cry1Fa-01-Cry1Ab nucleotide sequence is obviously because plant itself can produce Cry1F albumen to the control of prodenia litura with the soybean plant strain that proceeds to Cry1Fa-01-Vip3A nucleotide sequence, so, well known to those skilled in the art, identical toxic action according to Cry1F albumen to prodenia litura, can produce the transfer-gen plant that similarly can express Cry1F albumen and can be used in causing harm of control prodenia litura.In the present invention, Cry1F albumen includes but not limited to the Cry1F albumen of given amino acid sequence in embodiment, transfer-gen plant can also produce the second insect-killing protein that at least one is different from Cry1F albumen simultaneously, as Cry1Ab albumen, Cry1Ac albumen, Cry1Ba albumen or Vip3A albumen etc.

In sum, the Cry1F albumen that the method for Control pests of the present invention can be killed prodenia litura by generation in plant corpus is controlled prodenia litura insect; Compare with cultural control method, chemical prevention and control method and physical control method that prior art is used; the present invention carries out the protection of the time of infertility, whole plant with the infringement of control prodenia litura insect to plant; and pollution-free, noresidue, effect stability, thorough, simple, convenient, economical.

It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can modify or be equal to replacement technical scheme of the present invention, and not depart from the spirit and scope of technical solution of the present invention.

Claims (18)

1. a method of controlling prodenia litura insect, is characterized in that, comprises prodenia litura insect is contacted with Cry1F albumen.

2. the method for control prodenia litura insect according to claim 1, is characterized in that, described Cry1F albumen is Cry1Fa albumen.

3. the method for control according to claim 2 prodenia litura insect, it is characterized in that, described Cry1Fa albumen is present in the plant cell that produces described Cry1Fa albumen, and described prodenia litura insect contacts with described Cry1Fa albumen by the described plant cell of ingesting.

4. the method for control according to claim 3 prodenia litura insect, it is characterized in that, described Cry1Fa albumen is present in the genetically modified plants that produce described Cry1Fa albumen, described prodenia litura insect contacts with described Cry1Fa albumen by the tissue of the described genetically modified plants that ingest, after contact, the growth of described prodenia litura insect is suppressed and finally causes death, to realize the cause harm control of plant of prodenia litura.

5. the method for control prodenia litura insect according to claim 4, is characterized in that, described genetically modified plants can be in any breeding time.

6. the method for control prodenia litura insect according to claim 4, is characterized in that, the tissue of described genetically modified plants can be blade, stem stalk, tassel, female fringe, flower pesticide, filigree or fruit.

7. the method for control according to claim 4 prodenia litura insect, is characterized in that, described prodenia litura is caused harm to the control of plant because the change in plantation place does not change.

8. the method for control according to claim 4 prodenia litura insect, is characterized in that, described prodenia litura is caused harm to the control of plant not because the change of implantation time changes.

9. according to the method for the control prodenia litura insect described in claim 3 to 8 any one, it is characterized in that, described plant can be from corn, soybean, cotton, sweet potato, taro, lotus, sesbania, tobacco, beet, Chinese cabbage or eggplant.

10. according to the method for the control prodenia litura insect described in claim 2 to 9 any one, it is characterized in that, the step before described contact procedure is for planting the plant of the polynucleotides that contain the described Cry1Fa albumen of encoding.

11. according to the method for the control prodenia litura insect described in claim 2 to 10 any one, it is characterized in that, the amino acid sequence of described Cry1Fa albumen has the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2.

The method of 12. control prodenia litura insects according to claim 11, is characterized in that, the nucleotide sequence of described Cry1Fa albumen has the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

13. according to the method for the control prodenia litura insect described in claim 3 to 12 any one, it is characterized in that, described plant can also produce at least one the second nucleotide that is different from described Cry1Fa albumen.

The method of 14. control prodenia litura insects according to claim 13, it is characterized in that described the second nucleotide can encode Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, agglutinin, α-amylase or peroxidase.

The methods of 15. control according to claim 14 prodenia litura insects, is characterized in that, described the second nucleotide can encode Cry1Ab albumen, Cry1Ac albumen, Cry1Ba albumen or Vip3A albumen.

The method of 16. control prodenia litura insects according to claim 15, is characterized in that, described the second nucleotide comprises the nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6.

The method of 17. control prodenia litura insects according to claim 13, is characterized in that, described the second nucleotide is for suppressing the dsRNA of important gene in targeted insect insect.

18. 1 kinds of Cry1F protein are controlled the purposes of prodenia litura insect.

Images