CN110074140B

CN110074140B - Biocontrol microbial inoculum for producing aspergillus flavus, preparation method and application thereof

Info

Publication number: CN110074140B
Application number: CN201910452636.2A
Authority: CN
Inventors: 孙杰; 于丽娜; 张建成; 张初署; 王明清; 毕洁; 杨伟强; 栾云霞
Original assignee: Shandong Peanut Research Institute
Current assignee: Shandong Peanut Research Institute
Priority date: 2019-05-28
Filing date: 2019-05-28
Publication date: 2020-06-09
Anticipated expiration: 2039-05-28
Also published as: CN110074140A

Abstract

The invention discloses a biocontrol microbial inoculum for producing aspergillus flavus, a preparation method and application thereof, belonging to the technical field of biocontrol microbial inoculants for harmful microorganisms. The biocontrol microbial inoculum for producing the aspergillus flavus comprises the effective components of aspergillus flavus PEAS-10 which does not produce the aflatoxin and aspergillus flavus PAF-1 which does not produce the aflatoxin; the aspergillus flavus strain in the biocontrol microbial inoculum can grow and propagate rapidly in the field, can efficiently inhibit the growth, propagation and toxin production of toxin-producing aspergillus flavus, can obviously reduce peanut diseases, and the harvested peanuts have low aflatoxin content and long storage period and have excellent effect compared with single microbial inoculum treatment.

Description

Biocontrol microbial inoculum for producing aspergillus flavus, preparation method and application thereof

Technical Field

The invention belongs to the technical field of harmful microorganism biocontrol microbial inoculum, and particularly relates to a biocontrol microbial inoculum for producing aspergillus flavus, a preparation method and application thereof.

Background

Aflatoxins are metabolites of aspergillus flavus and aspergillus parasiticus. A large amount of experimental data show that the aflatoxin can cause experimental liver cancer to be induced by human beings and various animals, is the strongest chemical carcinogen found at present, and has 75 times greater capability than that of the dimethyl nitrosamine to induce liver cancer. Aflatoxin is also a virulent agent, with 68 times of arsenic and 10 times of potassium cyanide, and can cause severe liver damage and death in a short period of time.

Peanuts are the crop most susceptible to Aspergillus flavus infection. The peanuts are likely to be infected with aspergillus flavus in the whole growth process, and particularly in the later growth period, the pollution of the aspergillus flavus is aggravated after the seed coats of the peanuts are damaged due to the change of temperature and humidity and the harm of sick rats and the like. After the peanuts are harvested, the influence of air temperature, air humidity and storage conditions can cause aspergillus flavus infection more easily. In the process of reproduction and metabolism of the aspergillus flavus, a large amount of toxins (mainly aflatoxin B1) are generated to pollute peanuts and products thereof. It has been found that this toxin is likely to be present in improperly preserved peanuts and peanut oil, peanut beverages, and peanut butter. Due to the pollution of aspergillus flavus, the growth of peanuts can be inhibited, so that the yield of the peanuts is reduced, and the yield is reduced by about 10 percent.

The aflatoxin pollution of the peanuts mainly comprises pollution before the peanuts are harvested and pollution after the peanuts are harvested. The peanuts are easy to be infected by aspergillus flavus before being harvested, and researches show that the soil is a main source of the aspergillus flavus of the peanuts, and the aspergillus flavus in the peanut pods is directly related to the aspergillus flavus in the soil, so that the researches on the field biological prevention and control of the peanut aspergillus flavus pollution are of great significance in order to effectively prevent and reduce the pollution of the peanut aflatoxin.

Biocontrol aflatoxin is a substance that utilizes beneficial (or at least harmless) organisms and metabolites thereof to change the layout of microorganisms, inhibit the growth of toxigenic strains or inhibit the synthesis of toxins thereof, thereby achieving the level of reducing aflatoxin of agricultural products; or the aflatoxin is adsorbed and degraded by the actions of biological adhesion, degradation and the like, so that the aim of removing the aflatoxin is fulfilled. Compared with other treatment methods, the biological prevention and control method has the advantages of simple operation, no damage to the original quality of agricultural products, safety, high efficiency, environmental friendliness and the like, and represents a new direction for green control of aflatoxin.

The field control of the peanut aspergillus flavus pollution is mainly characterized in that water supply is ensured during the peanut pod development period in the later growth period of the peanuts, the situation that the infection chances of the aspergillus flavus are increased due to the breakage of seed coats caused by drought before harvesting is avoided, the occurrence of other diseases, insect pests and mouse pests is avoided, and the pod damage caused by plowing is avoided in the pod bearing period and the pod development period. Sun-drying the legume in time after harvesting to make the water content less than 5%, and screening new peanut varieties with resistance. However, the aspergillus flavus has strong viability, and the produced spores can resist various severe natural conditions, so that the infection of the aspergillus flavus cannot be completely avoided.

At present, the aspergillus flavus which does not produce the toxin is separated from the soil, only the research of inhibiting the growth of the aspergillus flavus which produces the toxin in a laboratory is carried out, and the field experimental research is not carried out. At present, some biocontrol bacteria are not suitable for field growth, have no growth advantage in the field and cannot play a role in inhibiting the production of toxic aspergillus flavus. Moreover, the single microbial inoculum has the problems of poor adaptability and poor prevention and treatment effect.

Disclosure of Invention

Aiming at the problems in the prior art, the invention aims to provide a composite biocontrol microbial inoculum which can rapidly grow and propagate in the field, can efficiently inhibit the growth, propagation and toxin production of toxin-producing aspergillus flavus and has excellent effect compared with the treatment of a single microbial inoculum.

In order to achieve the purpose, the technical scheme of the invention is as follows:

the biocontrol microbial inoculum for producing the aspergillus flavus comprises the effective components of aspergillus flavus PEAS-10 which does not produce the aspergillus flavus toxin and aspergillus flavus PAF-1 which does not produce the aspergillus flavus toxin;

the aspergillus flavus PEAS-10 which does not produce toxin is preserved in the year 2018, on the 08 th month and on the 01 th day: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:15997 and the address of the CGMCC is as follows: west road No. 1, north west of chaoyang district, beijing, the requested preservation unit is peanut institute of shandong province;

the aspergillus flavus PAF-1 which does not produce toxin is preserved in the following period of 2018, 08 and 01 months: china general microbiological culture Collection center (CGMCC) with the collection number of CGMCC NO:15996 and the address of: west road No. 1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

On the basis of the scheme, the number of spores of Aspergillus flavus PEAS-10 which does not produce aflatoxin in the biocontrol microbial inoculum is more than or equal to 10⁸Per gram; the spore number of Aspergillus flavus PAF-1 without producing aflatoxin is more than or equal to 10⁸Per gram.

On the basis of the scheme, the preparation method of the biocontrol microbial inoculum for producing the toxic aspergillus flavus comprises the following steps:

(1) respectively inoculating the strains on an MEA culture medium, and culturing for 3-5 days at 30 ℃ until yellow-green spores are generated;

(2) respectively inoculating the activated non-toxigenic aspergillus strains to a sterilized microbial inoculum culture medium, culturing for 5-8 days at 30 ℃, and shaking once every day to ensure that the aspergillus flavus grows uniformly on the culture medium; after culturing, the number of aspergillus flavus spores is more than or equal to 10⁸Per gram of medium;

(3) and (3) mixing the culture medium containing the aspergillus flavus PEAS-10 and the aspergillus flavus PAF-1 cultured in the step (2) according to a certain proportion, and preserving at normal temperature, wherein the ratio of the number of spores of the last two strains is PEAS-10: PAF-1: 2-2: 7, so as to obtain the biocontrol microbial inoculum for producing the toxic aspergillus flavus.

On the basis of the scheme, the mixing ratio of spores of aspergillus flavus PEAS-10 and aspergillus flavus PAF-1 in the biocontrol agent for producing the toxic aspergillus flavus is 1: 3.

On the basis of the scheme, the microbial inoculum culture medium is prepared by the following method:

pulverizing peanut skin to about 0.5 × 0.5cm, mixing with distilled water at a weight ratio of 1: 1-2: 3, and adding 1-1.5 wt% CaCl₂And sterilizing at 121 ℃ for 20 min.

The biocontrol microbial inoculum for producing the toxic aspergillus flavus prepared by the method is used for inhibiting the growth and the toxicity production of the aspergillus flavus, reducing crop diseases, improving the utilization rate of organic fertilizers, improving the crop yield, reducing the content of aflatoxin in agricultural products during harvesting and prolonging the storage period of the agricultural products.

On the basis of the scheme, the crops are peanuts or corns.

A method for inhibiting growth and toxin production of aspergillus flavus is characterized in that after 1 month before crops are harvested, the toxin-producing aspergillus flavus biocontrol agent prepared by the method is scattered at the rhizosphere of the crops at a rate of 30 kg/mu.

A method for reducing crop diseases, improving the utilization rate of organic fertilizers or improving the crop yield is characterized in that the toxin-producing aspergillus flavus biocontrol microbial inoculum prepared by the method is scattered at the rhizosphere of crops at a rate of 30 kg/mu 1 month before the crops are harvested.

A method for reducing aflatoxin content in agricultural products during harvesting or prolonging storage period of the agricultural products comprises the steps of 1 month before harvesting, spraying the toxin-producing aspergillus flavus biocontrol agent prepared by the method at the rhizosphere of the crops by 30 kg/mu, harvesting in good time, airing and storing in dry and cool places.

The technical scheme of the invention has the advantages that:

the compound biocontrol microbial inoculum can rapidly grow and propagate aspergillus flavus strains which do not produce aflatoxin in fields, can efficiently inhibit the growth, propagation and toxin production of toxin-producing aspergillus flavus, has obvious effects of field prevention and control of aflatoxin pollution, and has obvious prevention effect on root rot and stem rot of flowers when the biocontrol microbial inoculum is used for treating peanuts; after the treated peanuts are harvested, the content of aflatoxin is low, and the storage period of the peanuts can be prolonged. Compared with single microbial inoculum treatment, the effect is excellent.

Drawings

FIG. 1 measurement of aflatoxin content in strain PAF-1 fermentation broth;

FIG. 2 measurement of aflatoxin content in the fermentation broth of strain PEAS-10.

Detailed Description

Terms used in the present invention have generally meanings as commonly understood by one of ordinary skill in the art, unless otherwise specified.

The present invention will be described in further detail with reference to the following data in conjunction with specific examples. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

The Aspergillus flavus which does not produce toxin is Aspergillus flavus (PEAS-10) which is preserved in 2018 in 08 and 01 months: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:15997 and the address of the CGMCC is as follows: west road No. 1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

The Aspergillus flavus which does not produce toxin is Aspergillus flavus (PAF-1), and is preserved in 2018 in 08 and 01 months in the following places: china general microbiological culture Collection center (CGMCC) with the collection number of CGMCC NO:15996 and the address of: west road No. 1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

EXAMPLE 1 acquisition of strains PEAS-10 and PAF-1

Separation, purification and identification of bacterial strain

1. Collecting samples: samples were collected from peanut growing areas (sampling time: 2018.05, sampling sites were collected from the dam village of the pond of the gate of the land of jialin, southern china, and the street office of the city of western, qing island, shandong, province), and 5 subsamples (2cm wide and 5cm deep soil) were taken from each sample (100g) within a range of 10 × 10m by the diagonal method and mixed to obtain one sample. Putting the collected sample into a plastic bag, pricking pin holes to facilitate gas exchange, transporting to a laboratory, storing at 4 ℃ for screening aspergillus flavus.

2. And (5) separating and purifying the strain.

(1) Preparation of soil sample bacterial suspension

10g of soil sample was added with 90mL of 0.1% peptone sterile water (w/v), and shaken at room temperature for 30min to prepare 10^-1Bacterial suspension; then 0.5mL of 10^-1The bacterial suspension was added with 4.5mL of 0.1% peptone sterile water to prepare 10^-2Diluting the bacterial suspension; preparation of 10 by the above method^-3A diluted bacterial suspension.

(2) Isolation and purification of the strains

0.1mL of the inoculum was taken for each dilution, spread on modified Bengal red medium, incubated at 30 ℃ in the dark for 5 days, and repeated 3 times for each dilution. And (3) selecting the aspergillus flavus with yellow-green spores to perform secondary streak separation on the improved Bangla red culture medium until a single colony is obtained. Aspergillus flavus of a single colony is picked up on an MEA slant test tube culture medium, cultured for 3d at 30 ℃ and stored at 4 ℃.

By the method, the strain PEAS-10 is separated from a soil sample of the soil gate village of the pond in the region of Jialing in Jiang city, Nanchong city, Sichuan province, and the strain PAF-1 is separated from a soil sample of the office of the city of Wangxi city, Qingdao city, Shandong province.

(3) Identification

① identification of Strain PEAS-10

Morphological identification

The isolated strains of the invention are on a modified Bengal Red Medium: producing white hypha and yellow-green spores by aspergillus flavus; yellow spores were produced on DG18 medium and a bright orange color reaction on AFPA medium; and the strain is cultured in a toxin-producing culture solution, and aflatoxin is not produced.

Molecular identification

The strain PEAS-10 was molecularly identified by ITS gene sequence.

Primers used for amplification of Aspergillus flavus genome ITS were:

ITS1：5’-TCCGTAGGTGAACCTGCGG-3’(SEQ ID No.1)；

ITS4：5’-TCCTCCGCTTATTGATATGC-3’(SEQ ID No.2)。

the PCR amplification conditions were: the PCR amplification reaction program is as follows: pre-denaturation at 94 ℃ for 5min for 1 cycle; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 90s for 30 cycles; final extension at 72 ℃ for 7 min. After amplification, the product was stored at 4 ℃. The product was sent to Shanghai Bioengineering, Inc. for sequencing, and the sequencing results were aligned on BLAST research (http:// www.ncbi.nlm.nih.gov /).

Sequencing shows that the ITS sequence of the bacterial strain PEAS-10 is as shown in SEQ ID No. 3:

ACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT

the ITS sequence comparison shows that the similarity of the ITS gene sequence of the strain PEAS-10 and the small subunit ribosomal RNA gene sequence of the aspergillus flavus strain LWU-31 is 100%.

The expression condition of the toxic gene of the strain PEAS-10 is detected by adopting a universal primer, and the result shows that seven toxic key genes of nor-1, afiR, omtA, ordA, ver-1, verA and verB in the genes on the toxic gene cluster of the strain PEAS-10 are not expressed, so that the strain does not produce toxicity.

The morphological identification and the molecular biology identification result show that the strain PEAS-10 is aspergillus flavus which does not produce aflatoxin; it was stored in 2018 on 08/01: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:15997 and the address of the CGMCC is as follows: west road No. 1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

② identification of Strain PAF-1

Morphological identification

Molecular identification

The strain PAF-1 is subjected to molecular identification through an ITS gene sequence.

Primers used for amplification of Aspergillus flavus genome ITS were:

ITS1：5’-TCCGTAGGTGAACCTGCGG-3’(SEQ ID No.1)；

ITS4：5’-TCCTCCGCTTATTGATATGC-3’(SEQ ID No.2)。

Sequencing shows that the ITS sequence of the strain PAF-1 is as follows SEQ ID No. 4:

GACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

the ITS sequence comparison shows that the similarity of the ITS gene sequence of the strain PAF-1 and the Aspergillus flavus strain CMXY26475 small subunit ribosomal RNA gene sequence is 100%.

The general primers are adopted to detect the expression condition of the toxin-producing gene of the strain PAF-1, and the result shows that four toxin-producing key genes including afiT, afiR, omtA and verA in the genes on the toxin-producing gene cluster of the strain PAF-1 are not expressed, so that the strain does not produce toxin.

The morphological identification and the molecular biology identification result show that the strain PAF-1 is aspergillus flavus which does not produce aflatoxin; it was stored in 2018 on 08/01: china general microbiological culture Collection center (CGMCC) with the collection number of CGMCC NO:15996 and the address of: west road No. 1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

Example 2 analysis of the toxicity production of Aspergillus flavus PEAS-10 and PAF-1

(1) Culture for producing toxin

Respectively inoculating Aspergillus flavus PEAS-10 and PAF-1 strains on an MEA slant test tube culture medium, and culturing at 28 ℃ for 3d to activate the strains; 4mL of sterile water is added to a slant tube culture medium and washed to respectively prepare Aspergillus flavus PEAS-10 suspension and Aspergillus flavus PAF-1 suspension. The number of spores was recorded under a microscope using a hemocytometer.

Adding 10mL of toxigenic culture solution into a 50mL centrifuge tube, and adding a certain amount of Aspergillus flavus PEAS-10 or PAF-1 bacterial suspension to make the final concentration of spores be 10⁵mL, 30 ℃, 200rpm, cultured for 7 days.

(2) Aflatoxins B in toxigenic culture solutions₁Measurement of (2)

Respectively detecting AFB in the fermentation broth by adopting methods of immunoaffinity chromatography purification, liquid chromatography separation and fluorescence detector detection₁. The specific operation is as follows: passing 2mL of fermentation liquid through an immunoaffinity chromatography column, eluting with 20mL of water for 2 times at a flow rate of 3mL per minute, discarding eluent, allowing air to enter the column, extruding water out of the column, eluting with 1.5mL of methanol for several times, collecting eluent, concentrating to 0.7mL, diluting with water to 1mL, shaking up, loading, separating by high performance liquid chromatography, and detecting by a fluorescence detector.

Chromatographic conditions are as follows: the chromatographic column is Venusil MP C18(5 μm, 4.6 mm. times.150 mm); the column temperature was 40 ℃; the mobile phase is methanol and water (V: V ═ 45: 55); the flow rate is 1.3 mL/min; post-column photochemical derivatization: 254nm for photochemical derivitizer; the fluorescence detector is used for detecting the fluorescence, the excitation wavelength is 360nm, the emission wavelength is 450nm, and the sample injection amount is 20 mu L. The results are shown in FIG. 1.

Aflatoxin is not detected in the aflatoxin-producing fermentation broth of both aspergillus flavus strain PEAS-10 and aspergillus flavus strain PAF-1, and the aspergillus flavus strain PEAS-10 and aspergillus flavus strain PAF-1 are further proved to be non-toxigenic strains.

Example 3

Biocontrol microbial inoculum for preventing and controlling aflatoxin pollution and preparation method thereof

(1) The microorganisms used were: aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1

(2) Activating strains: the strains are respectively inoculated on an MEA culture medium and cultured for 3-5 days at the temperature of 30 ℃ until yellow green spores are generated.

(3) Preparation of a microbial inoculum culture medium: pulverizing peanut skin to about 0.5 × 0.5cm, mixing with distilled water at a weight ratio of 1: 1-2: 3, and adding 1-1.5 wt% CaCl₂And sterilizing at 121 ℃ for 20 min.

(3) Respectively inoculating the activated non-toxigenic aspergillus strains to a sterilized microbial inoculum culture medium, culturing for 5-8 days at 30 ℃, and shaking once every day to ensure that the aspergillus flavus grows uniformly on the culture medium; after culturing for 5-8 days, the number of aspergillus flavus spores reaches 10⁸More than g of culture medium.

(4) Mixing the cultured culture medium containing Aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1 according to a certain proportion, and finally setting the spore number proportion (PEAS-10: PAF-1) of the two strains to be 1: 3 to prepare the microbial inoculum for preventing and controlling the aflatoxin pollution. Preserving at normal temperature.

First, the biocontrol microbial inoculum of the invention has the effect of inhibiting the aspergillus flavus from producing toxin

1. Inhibition test in laboratory

1) Test method

(1) Preparation of the culture Medium

Intact corn and peanut granules are selected, 10g of even size peanuts and corn are weighed separately and sterilized at 121 ℃ for 15 minutes.

(2) Preparation of the bacterial suspension

Inoculating Aspergillus flavus (Aspergillus flavus NRRL 3357 standard strain (Aspergillus flavus NRRL 3357 provided by professor Homoba Hayata of Zhongshan university) on MEA slant tube culture medium, culturing at 20 deg.C for 5 days, dipping spores on the culture medium with cotton swab in sterile water, shaking with vortex oscillator, and adjusting spore concentration to 2 × 10 with blood counting cell plate⁴Spores/ml for use.

Weighing 0.1g of microbial inoculum for preventing and controlling aflatoxin pollution in sterile water, uniformly oscillating by using a vortex oscillator, and then adjusting the spore concentration to 2 x 10 by using a blood counting chamber⁴Spores/ml for use.

(3) Test for inhibitory Effect

Adding the diluted 1ml biocontrol microbial inoculum and the toxigenic aspergillus flavus (10) into a triangular flask respectively⁴∶10⁴) Spore suspension was used as experimental group. Then 1ml of toxigenic bacteria (10) was added to the flask⁴) An isovolumetrically mixed spore suspension with sterile water was used as a positive control and the bottles were gently shaken to cover the spores onto peanuts and corn. Each was cultured in triplicate at 30 ℃ for 14 days in the dark.

(4) Determination of aflatoxin content

Placing the cultured corn and peanut samples into an autoclave, and sterilizing at 121 deg.C for 30min (to inactivate Aspergillus flavus); the sterilized sample is put into a high-speed universal pulverizer to be smashed, then 50ml of 80% methanol is added into a triangular flask, the mixture is vibrated for 30min at a high speed by an oscillator, and then the filtered extract is measured by HPLC by using sterilized filter paper.

2) Test results

TABLE 1 Effect of biocontrol agents on inhibiting toxigenic bacteria

As can be seen from the table 1, the anti-microbial agent has the inhibiting and toxin-producing rate of 86.86% on the toxin-producing bacteria in the peanuts and the inhibiting and toxin-producing rate of 87.22% on the toxin-producing bacteria in the corns, and can well inhibit the toxin-producing of the toxin-producing bacteria. While PEAS-10 alone inhibits the toxigenicity rate in peanuts by 74.02% and in corn by 81.19%; the single PAF-1 inhibits the toxigenicity of 78.02% in peanuts and 84.26% in corns, so that the compound biocontrol microbial inoculum of the invention has obviously improved toxigenicity inhibition compared with single bacteria.

2. In the field

1) Test method

And (3) after 1 month before the peanuts are harvested, scattering 30 kg/mu of an aspergillus flavus toxigenic bacteria biocontrol agent (prepared in example 3) at the rhizosphere of the peanuts, wherein a group without the application of the biocontrol agent is used as a blank control group, and other daily management test groups are the same as the blank control group.

And (3) taking

soil samples

10 and 20 days after the biocontrol microbial inoculum is applied and harvesting each time, detecting the quantity of thalli in the soil samples, separating and identifying aspergillus flavus, and comparing the quantity of the aspergillus flavus in the soil samples before and after the biocontrol microbial inoculum is applied and the proportion change condition of the aspergillus flavus producing toxin.

2) Analysis of reproductive capacity of non-toxigenic aspergillus flavus in soil

TABLE 2 changes in the amount and ratio of Aspergillus flavus in the soil after application of biocontrol agents

As can be seen from Table 2, in the control group (no biocontrol agent is applied), the number of aspergillus flavus colonies in the soil is 213.45cfu/g, the proportion of the toxigenic aspergillus flavus is 70.23%, and after the biocontrol agent is applied for 10 days, the number of the aspergillus flavus colonies in the soil is rapidly increased to 6221.12cfu/g of soil, the soil aspergillus flavus is rapidly increased, and the proportion of the toxigenic aspergillus flavus is rapidly reduced to 1.58%; after 20 days of applying the strain, the colony number of the aspergillus flavus in the soil reaches 9245.24cfu/g, and the proportion of the toxin-producing aspergillus flavus is reduced to 0.87%; when the strain is harvested, the colony number of the aspergillus flavus in the soil reaches 9532.45cfu/g, and the proportion of the aspergillus flavus producing toxin is reduced to 0.75 percent.

From the results, the bacteria which do not produce the toxic bacteria can grow and propagate rapidly in the soil after the biocontrol microbial inoculum is applied, the colony number of the aspergillus flavus in the soil can increase rapidly after 20 days of applying the bacteria, and then the growth tends to be slow, which indicates that the effect of applying the bacteria which do not produce the toxic bacteria is the best 20 days before the peanuts are harvested; meanwhile, after the non-toxigenic bacteria are applied, the non-toxigenic bacteria can rapidly grow and propagate in the peanut soil, the growth and propagation of the non-toxigenic aspergillus flavus can be competitively inhibited, the proportion of the toxigenic bacteria is reduced, experiments show that after the non-toxigenic bacteria are applied, the proportion of the toxigenic bacteria is reduced from 70.23% of a control group to 0.75% before harvest, and the proportion of the toxigenic bacteria is rapidly reduced, so that the proportion of the toxigenic bacteria infecting peanuts is reduced, and the pollution risk of the peanut aflatoxin is reduced.

3) Prevention and control of peanut root rot

When the peanuts are harvested, the morbidity of the peanut root rot of the control group and the peanuts applied with the biocontrol microbial inoculum is counted, the incidence rate of the root rot is determined by taking the root rot pathogenic strain/total peanut strains, and the result is shown in a table 3.

TABLE 3 peanut root rot onset after applying biocontrol microbial inoculum

Group of	Incidence of root rot (%)
		Control group	18.21
Biocontrol microbial inoculum group	2.57

As can be seen from Table 3, the incidence of the peanut root rot disease after the biocontrol agent is applied is reduced to 2.57% from 18.21% of the control group, and the analysis reason is that the biocontrol agent can inhibit the peanut root rot disease while inhibiting the aspergillus flavus which produces the toxin; and secondly, the peanut skin is contained in the biocontrol microbial inoculum, and the polyphenol compound in the peanut skin can inhibit the growth and the propagation of root rot bacteria.

4) Prevention and control of peanut stem rot

When the peanuts are harvested, the incidence of the stem rot of the peanuts in the control group and the peanuts applied with the bio-control fungicide is counted, the incidence of the stem rot is taken as the stem rot incidence strain/total peanut strain, and the results are shown in table 4.

TABLE 4 peanut root rot onset after applying biocontrol microbial inoculum

Group of	Incidence of Stem rot (%)
		Control group	9.78
Biocontrol microbial inoculum group	1.08

As can be seen from Table 4, the incidence of peanut root rot after the biocontrol agent is applied is reduced from 9.78% to 1.08% of the control group.

5) Peanut storage and toxin determination

After the peanuts are harvested, each seed sample is independently aired and weighed, and the seeds are respectively put into seed bags and stored in a dry and cool place. And (3) measuring the aflatoxin content of the peanuts stored for 0, 1, 2, 3, 4, 5, 6, 7 and 8 months, and calculating the capability of the aflatoxin which does not produce the toxin to inhibit the production of the aflatoxin in the peanuts compared with a control group.

TABLE 5 changes in aflatoxin content in peanuts during storage

As can be seen from Table 5, the control group is peanuts in a peanut field without the biocontrol microbial inoculum of the invention, aflatoxin can be detected during harvesting, and along with the prolonging of storage time, the aflatoxin content is 20.45 mug/kg when the peanuts are stored for five months, the aflatoxin content exceeds the national limit standard by 20 mug/kg, and the aflatoxin exceeds the standard and cannot be eaten. The content of aflatoxin in the peanut of the control group increases rapidly with the prolonging of the storage period, and reaches 100.45 mug/kg by the eighth month.

The test group can not detect aflatoxin within 7 months of storage time, which shows that the risk of aflatoxin infection in the peanut storage process can be obviously reduced by applying the biocontrol agent to the peanut planting field. The aflatoxin can be detected in the 6 th month of storage of peanuts treated by a single PEAS-10 microbial inoculum or a single PAF-1 microbial inoculum; the compound biocontrol microbial inoculum can effectively reduce the content of aflatoxin in peanuts and prolong the storage period of the peanuts.

Secondly, the influence of the culture method on the aspergillus flavus which does not produce toxin

1. Influence of microbial inoculum culture medium on growth and reproduction of aspergillus flavus not producing toxin

Test groups:

(3) Preparation of a microbial inoculum culture medium: pulverizing peanut skin to about 0.5 × 0.5cm, mixing with distilled water at a mass ratio of 1: 1, and adding 1% CaCl₂And sterilizing at 121 ℃ for 20 min.

(3) Respectively inoculating the activated non-toxigenic aspergillus strains to a sterilized microbial inoculum culture medium, culturing at 30 ℃, shaking once every day to ensure that the aspergillus flavus grows uniformly on the culture medium; after culturing for 5 days, detecting that the number of aspergillus flavus spores is more than or equal to 10⁸Per gram of medium.

Control group 1:

(3) Preparation of a microbial inoculum culture medium: pulverizing peanut skin to 0.5 × 0.5cm, and mixing with distilled water at a mass ratio of 1: 1.

(3) Respectively activating the non-toxigenic aspergillus strainsInoculating the strain to a sterilized microbial inoculum culture medium, culturing at 30 ℃, and shaking once a day to ensure that the aspergillus flavus grows uniformly on the culture medium; after 6 days of culture, the number of aspergillus flavus spores is detected to be more than or equal to 10⁸Per gram of medium.

Control group 2:

(1) the microorganisms used were: aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1;

Preparation of a microbial inoculum culture medium: mixing the wheat and the distilled water according to the mass ratio of 1: 1, and simultaneously adding 1 percent of CaCl by mass₂And sterilizing at 121 ℃ for 20 min.

(3) Respectively inoculating the activated non-toxigenic aspergillus strains to a sterilized microbial inoculum culture medium, culturing at 30 ℃, shaking once every day to ensure that the aspergillus flavus grows uniformly on the culture medium; after 8 days of culture, the number of aspergillus flavus spores is detected to be more than or equal to 10⁸Per gram of medium.

The results show that the culture method is beneficial to the growth and the propagation of the aspergillus flavus without producing the toxin, and the culture time for reaching the aspergillus flavus spores with effective concentration is short.

2. Influence of microbial inoculum culture medium on field viability of non-toxigenic aspergillus flavus

(1) Test group

And (3) after 1 month before the peanuts are harvested, scattering 30 kg/mu of the aspergillus flavus toxigenic bacteria biocontrol fungicide prepared by the test group at the peanut rhizosphere, taking a group without the biocontrol fungicide as a blank control group, and keeping the other daily management test groups as the same as the blank control group.

And (3) taking a soil sample 30 days after the biocontrol microbial inoculum is applied, detecting the quantity of thalli in the soil sample, separating and identifying aspergillus flavus, and comparing the quantity of the aspergillus flavus in the soil sample after the biocontrol microbial inoculum is applied and the proportion change condition of the aspergillus flavus producing toxin.

(2) Control group 1

And (3) after the peanuts are harvested for 1 month, scattering the aspergillus flavus toxigenic biocontrol microbial inoculum prepared by the control group 1 at the rhizosphere of the peanuts of 30 kg/mu, and performing other daily management in the same way as the step (1).

(3) Control group 2

And (3) after the peanuts are harvested for 1 month, scattering the aspergillus flavus toxigenic biocontrol microbial inoculum prepared by the control group 2 at the rhizosphere of the peanuts of 30 kg/mu, and performing other daily management in the same way as the step (1).

And (3) taking a soil sample once 30 days after the biocontrol microbial inoculum is applied, detecting the quantity of thalli in the soil sample, separating and identifying aspergillus flavus, and comparing the quantity of the aspergillus flavus in the soil sample after the biocontrol microbial inoculum is applied and the proportion change condition of the aspergillus flavus producing toxin.

The results are shown in Table 6.

TABLE 6 changes in the amount and ratio of Aspergillus flavus after applying biocontrol agents cultured by different culture methods

As can be seen from the results in Table 6, the cultured aspergillus flavus which does not produce toxic aspergillus flavus has strong field viability and good inhibition effect on the aspergillus flavus which does produce toxic aspergillus flavus compared with the control group.

Thirdly, the influence of the bio-control microbial inoculum prepared by the invention on the utilization rate of the organic fertilizer

Test groups:

(3) Respectively inoculating the activated non-toxigenic aspergillus strains to a sterilized microbial inoculum culture medium, culturing at 30 ℃, shaking once every day to ensure that the aspergillus flavus grows uniformly on the culture medium; after 5 days of culture, the number of aspergillus flavus spores reaches 10 by detection⁸Per gram of medium.

Blank control group: pulverizing peanut skin to about 0.5 × 0.5cm, mixing with distilled water at a mass ratio of 1: 1, and adding 1% CaCl₂And sterilizing at 121 ℃ for 20 min. Incubate at 30 ℃ for 5 days with shaking once a day.

And (3) after 1 month before peanut harvest, scattering the test group bio-control fungicide at the peanut rhizosphere at 30 kg/mu, and scattering the control group fungicide at the peanut rhizosphere at 30 kg/mu to serve as a blank control group, wherein other daily management test groups and the blank control group are the same. And immediately collecting the soil of the experimental group and the control group after applying the microbial inoculum, and measuring the content of organic matters.

The soil of the test group and the control group was collected at the time of harvesting the peanuts, the organic matter content in the soil was measured, and the results of calculating the organic matter utilization ratio (organic matter utilization ratio/% (organic matter content in soil at the time of harvesting/organic matter content in soil immediately after applying bacteria) × 100) of the test group and the control group are shown in table 7.

TABLE 7 utilization of soil organic matter after applying biocontrol microbial inoculum

Group of	Organic matter utilization (%)
		Control group	58
Biocontrol microbial inoculum group	81

As can be seen from Table 7, the utilization rate of organic matters in soil is increased after the biocontrol bacteria are applied, which shows that the biocontrol bacteria agent prepared by the invention not only can reduce the occurrence of peanut diseases, but also can increase the utilization rate of organic matters in soil.

The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.

Sequence listing

<110> institute for peanut research in Shandong province

<120> biocontrol microbial inoculum for producing aspergillus flavus, preparation method and application thereof

<130>2019

<141>2019-05-28

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>19

<212>DNA

<213> Artificial sequence (Aspergillus flavus)

<400>1

tccgtaggtg aacctgcgg 19

<210>2

<211>20

<212>DNA

<213> Artificial sequence (Aspergillus flavus)

<400>2

tcctccgctt attgatatgc 20

<210>3

<211>574

<212>DNA

<213>Aspergillus flavus PEAS-10

<400>3

acctgcggaa ggatcattac cgagtgtagg gttcctagcg agcccaacct cccacccgtg 60

tttactgtac cttagttgct tcggcgggcc cgccattcat ggccgccggg ggctctcagc 120

cccgggcccg cgcccgccgg agacaccacg aactctgtct gatctagtga agtctgagtt 180

gattgtatcg caatcagtta aaactttcaa caatggatct cttggttccg gcatcgatga 240

agaacgcagc gaaatgcgat aactagtgtg aattgcagaa ttccgtgaat catcgagtct 300

ttgaacgcac attgcgcccc ctggtattcc ggggggcatg cctgtccgag cgtcattgct 360

gcccatcaag cacggcttgt gtgttgggtc gtcgtcccct ctccgggggg gacgggcccc 420

aaaggcagcg gcggcaccgc gtccgatcct cgagcgtatg gggctttgtc acccgctctg 480

taggcccggc cggcgcttgc cgaacgcaaa tcaatctttt tccaggttga cctcggatca 540

ggtagggata cccgctgaac ttaagcatat caat 574

<210>4

<211>576

<212>DNA

<213>Aspergillus flavus PAF-1

<400>4

gacctgcgga aggatcatta ccgagtgtag ggttcctagc gagcccaacc tcccacccgt 60

gtttactgta ccttagttgc ttcggcgggc ccgccattca tggccgccgg gggctctcag 120

ccccgggccc gcgcccgccg gagacaccac gaactctgtc tgatctagtg aagtctgagt 180

tgattgtatc gcaatcagtt aaaactttca acaatggatc tcttggttcc ggcatcgatg 240

aagaacgcag cgaaatgcga taactagtgt gaattgcaga attccgtgaa tcatcgagtc 300

tttgaacgca cattgcgccc cctggtattc cggggggcat gcctgtccga gcgtcattgc 360

tgcccatcaa gcacggcttg tgtgttgggt cgtcgtcccc tctccggggg ggacgggccc 420

caaaggcagc ggcggcaccg cgtccgatcc tcgagcgtat ggggctttgt cacccgctct 480

gtaggcccgg ccggcgcttg ccgaacgcaa atcaatcttt ttccaggttg acctcggatc 540

aggtagggat acccgctgaa cttaagcata tcaata 576

Claims

1. A biocontrol microbial inoculum for producing the aspergillus flavus is characterized in that: the effective components of the aspergillus flavus strain are aspergillus flavus PEAS-10 which does not produce aflatoxin and aspergillus flavus strain PAF-1 which does not produce aflatoxin;

the aspergillus flavus PAF-1 which does not produce toxin is preserved in the following period of 2018, 08 and 01 months: china general microbiological culture Collection center (CGMCC) with the collection number of CGMCC NO:15996 and the address of: west road No. 1, north west of chaoyang district, beijing, the requested preservation unit is peanut institute of shandong province;

the spore number of the Aspergillus flavus PEAS-10 which does not produce the aflatoxin in the biocontrol microbial inoculum is more than or equal to 10⁸Per gram; the spore number of Aspergillus flavus PAF-1 without producing aflatoxin is more than or equal to 10⁸Per gram;

the preparation method of the biocontrol microbial inoculum for producing the toxic aspergillus flavus comprises the following steps:

2. The biocontrol microbial inoculum for producing aspergillus flavus of claim 1, which is characterized in that: the ratio of the number of spores of Aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1 in the biocontrol agent for producing the toxic Aspergillus flavus is 1: 3.

3. The biocontrol microbial inoculum for producing aspergillus flavus of claim 1, which is characterized in that: the microbial inoculum culture medium is prepared by the following method:

pulverizing peanut skin to 0.5 × 0.5cm, mixing with distilled water at a weight ratio of 1: 1-2: 3, and adding 1-1.5 wt% of CaCl₂And sterilizing at 121 ℃ for 20 min.

4. The application of the biocontrol microbial inoculum for producing the toxic aspergillus flavus as claimed in any one of claims 1 to 3, which is characterized in that the biocontrol microbial inoculum is used for inhibiting the growth and the toxicity production of the aspergillus flavus, reducing the peanut diseases, improving the utilization rate of organic fertilizers, improving the peanut yield, reducing the aflatoxin content in peanuts during harvesting and prolonging the storage period of the peanuts; the peanut diseases are root rot or stem rot.

5. A method for inhibiting growth and toxin production of aspergillus flavus is characterized by comprising the following steps: spraying the aspergillus flavus biocontrol microbial inoculum produced according to any one of claims 1-3 to the rhizosphere of peanuts at 30 kg/mu 1 month before the peanuts are harvested.

6. A method for reducing peanut diseases, improving the utilization rate of organic fertilizers or improving the yield of peanuts is characterized by comprising the following steps: scattering the aspergillus flavus biocontrol microbial inoculum produced by any one of claims 1-3 at 30 kg/mu of the peanut rhizosphere 1 month before the peanut is harvested; the peanut diseases are root rot or stem rot.

7. A method of reducing aflatoxin content in peanuts at harvest or extending the shelf life of peanuts, characterized by: spraying the aspergillus flavus biocontrol microbial inoculum produced according to any one of claims 1-3 to the rhizosphere of peanuts at 30 kg/mu 1 month before the peanuts are harvested, harvesting in time, airing and storing in a dry and cool place.