CN110157626B

CN110157626B - Aspergillus flavus PEASH-12 without producing aflatoxin and application thereof

Info

Publication number: CN110157626B
Application number: CN201910451843.6A
Authority: CN
Inventors: 孙杰; 张初署; 赵红军; 杨伟强; 毕洁; 石程仁; 于丽娜; 王明清; 谢宏峰
Original assignee: Shandong Peanut Research Institute
Current assignee: Shandong Peanut Research Institute
Priority date: 2019-05-28
Filing date: 2019-05-28
Publication date: 2020-06-23
Anticipated expiration: 2039-05-28
Also published as: CN110157626A

Abstract

The invention discloses aspergillus flavus PEASH-12 incapable of producing aflatoxin and application thereof, belonging to the technical field of microorganisms. The Aspergillus flavus which does not produce toxin is Aspergillus flavus (PEASH-12) which is preserved in 2018 in 08 and 01 months: china general microbiological culture Collection center (CGMCC) with the collection number of CGMCC NO:15998 and the address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province. The strain can rapidly grow and propagate in the field, can efficiently inhibit the growth, propagation and toxin production of toxin-producing aspergillus flavus, and has obvious effect of field prevention and control of aflatoxin pollution; the Aspergillus flavus PEASH-12 spore suspension without generating toxicity can reduce the occurrence of peanut diseases and increase the utilization rate of soil organic matters.

Description

Aspergillus flavus PEASH-12 without producing aflatoxin and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to aspergillus flavus PEASH-12 incapable of producing aflatoxin and application thereof.

Background

Aflatoxins are metabolites of aspergillus flavus and aspergillus parasiticus. A large amount of experimental data show that the aflatoxin can cause experimental liver cancer to be induced by human beings and various animals, is the strongest chemical carcinogen found at present, and has 75 times greater capability than that of the dimethyl nitrosamine to induce liver cancer. Aflatoxin is also a virulent agent, with 68 times of arsenic and 10 times of potassium cyanide, and can cause severe liver damage and death in a short period of time.

Peanuts are the crop most susceptible to Aspergillus flavus infection. The peanuts are likely to be infected with aspergillus flavus in the whole growth process, and particularly in the later growth period, the pollution of the aspergillus flavus is aggravated after the seed coats of the peanuts are damaged due to the change of temperature and humidity and the harm of sick rats and the like. After the peanuts are harvested, the influence of air temperature, air humidity and storage conditions can cause aspergillus flavus infection more easily. In the process of reproduction and metabolism of the aspergillus flavus, a large amount of toxins (mainly aflatoxin B1) are generated to pollute peanuts and products thereof. It has been found that this toxin is likely to be present in improperly preserved peanuts and peanut oil, peanut beverages, and peanut butter. Due to the pollution of aspergillus flavus, the growth of peanuts can be inhibited, so that the yield of the peanuts is reduced, and the yield is reduced by about 10 percent.

The aflatoxin pollution of the peanuts mainly comprises pollution before the peanuts are harvested and pollution after the peanuts are harvested. The peanuts are easy to be infected by aspergillus flavus before being harvested, and researches show that the soil is a main source of the aspergillus flavus of the peanuts, and the aspergillus flavus in the peanut pods is directly related to the aspergillus flavus in the soil, so that the researches on the field biological prevention and control of the peanut aspergillus flavus pollution are of great significance in order to effectively prevent and reduce the pollution of the peanut aflatoxin.

Biocontrol aflatoxin is a substance that utilizes beneficial (or at least harmless) organisms and metabolites thereof to change the layout of microorganisms, inhibit the growth of toxigenic strains or inhibit the synthesis of toxins thereof, thereby achieving the level of reducing aflatoxin of agricultural products; or the aflatoxin is adsorbed and degraded by the actions of biological adhesion, degradation and the like, so that the aim of removing the aflatoxin is fulfilled. Compared with other treatment methods, the biological prevention and control method has the advantages of simple operation, no damage to the original quality of agricultural products, safety, high efficiency, environmental friendliness and the like, and represents a new direction for green control of aflatoxin.

The field control of the peanut aspergillus flavus pollution is mainly characterized in that water supply is ensured during the peanut pod development period in the later growth period of the peanuts, the situation that the infection chances of the aspergillus flavus are increased due to the breakage of seed coats caused by drought before harvesting is avoided, the occurrence of other diseases, insect pests and mouse pests is avoided, and the pod damage caused by plowing is avoided in the pod bearing period and the pod development period. Sun-drying the legume in time after harvesting to make the water content less than 5%, and screening new peanut varieties with resistance. However, the aspergillus flavus has strong viability, and the produced spores can resist various severe natural conditions, so that the infection of the aspergillus flavus cannot be completely avoided.

Although the separation of the aspergillus flavus which does not produce the toxin from the soil is reported in China, only the report of inhibiting the growth of the aspergillus flavus which produces the toxin in a laboratory is carried out, and the field experimental research is not carried out. At present, some antagonistic bacteria are not suitable for field growth, have no growth advantage in the field and cannot play a role in inhibiting the production of toxic aspergillus flavus.

Disclosure of Invention

Aiming at the problems of poor field adaptability, low survival rate, poor field application effect and the like of the existing antagonistic bacteria for producing the toxic aspergillus flavus, the invention aims to provide a non-toxigenic strain for efficiently inhibiting the production of the toxic aspergillus flavus. The strain can rapidly grow and propagate in the field, can efficiently inhibit the growth and propagation of toxin-producing aspergillus flavus, and has obvious effect of preventing and controlling aflatoxin pollution in the field.

In order to achieve the purpose, the technical scheme of the invention is as follows:

aspergillus flavus producing no aflatoxin, said Aspergillus flavus producing no aflatoxin being Aspergillus flavus (Aspergillus flavus) PEASH-12, deposited at 08 months and 01 days 2018 in: china general microbiological culture Collection center (CGMCC) with the collection number of CGMCC NO:15998 and the address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

On the basis of the scheme, the aspergillus flavus which does not produce toxin is separated from the Hongqi branch of the improved variety breeding farm in Jiangxi province.

On the basis of the scheme, the colony morphology of the aspergillus flavus not producing toxin is as follows: on modified Bengal Red Medium: producing white hyphae and yellow-green spores; yellow-green spores were produced on modified Bengal red medium, yellow spores on DG18 medium, and bright orange color reaction on AFPA medium.

On the basis of the scheme, the non-toxigenic aspergillus flavus ITS sequence is shown as SEQ ID No. 1.

The application of the bacterial suspension, the whole culture solution, the whole culture, the spores, the crude extract or the extracellular metabolite of the aspergillus flavus which does not produce the aflatoxin is used for biological prevention and control of the toxigenic aspergillus flavus.

On the basis of the scheme, the bacterial suspension, the whole culture solution, the whole culture, the spores, the crude extract or the extracellular metabolite of the aspergillus flavus which does not produce the aflatoxin is applied to antagonize the growth of the toxin-producing aspergillus flavus or inhibit the biosynthesis of the aflatoxin or degrade the aflatoxin.

A biocontrol microbial inoculum for producing the aspergillus flavus is prepared by the following method:

activating non-toxigenic Aspergillus flavus strain PEASH-12 in MEA culture medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml of 5% peanut protein isolate solution, washing spores, diluting with 5% peanut protein isolate solution until the spore concentration of PEASH-12 is 3.9 × 10⁵And (5) obtaining the bacterial suspension per mL.

The application of the biocontrol microbial inoculum for producing the toxic aspergillus flavus is used for reducing crop diseases, improving the utilization rate of organic fertilizer, reducing the content of aflatoxin in agricultural products during harvesting and prolonging the storage period of the agricultural products.

A method for reducing crop diseases and improving the utilization rate of organic fertilizers is characterized in that the biocontrol microbial inoculum for producing the toxic aspergillus flavus is irrigated to the rhizosphere of crops at a rate of 300L/mu 1 month before the crops are harvested.

A method for reducing aflatoxin content in agricultural products during harvesting and prolonging the storage period of the agricultural products comprises the step of irrigating the biocontrol microbial inoculum for producing the aflatoxin aspergillus at the rhizosphere of crops by 300L/mu 1 month before the crops are harvested.

The technical scheme of the invention has the advantages that:

according to the invention, the aspergillus flavus strain incapable of producing aflatoxin is obtained through separation and purification, the strain can rapidly grow and propagate in the field, the growth, propagation and toxin production of toxin-producing aspergillus flavus can be efficiently inhibited, and the effect of field prevention and control of aflatoxin pollution is remarkable. The Aspergillus flavus PEASH-12 spore suspension without generating toxicity can reduce the occurrence of peanut diseases and increase the utilization rate of soil organic matters.

Drawings

FIG. 1 shows measurement of aflatoxin content in fermentation broth of strain PEASH-12.

Detailed Description

Terms used in the present invention have generally meanings as commonly understood by one of ordinary skill in the art, unless otherwise specified.

The present invention will be described in further detail with reference to the following data in conjunction with specific examples. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

The Aspergillus flavus which does not produce toxin is Aspergillus flavus (PEASH-12) which is preserved in 2018 in 08 and 01 months: china general microbiological culture Collection center (CGMCC) with the collection number of CGMCC NO:15998 and the address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

Example 1

Separation, purification and identification of bacterial strain

1. Collecting samples in a peanut planting field (2018.05 collected in a Hongqi branch field of an improved variety breeding farm in Jiangxi province), collecting 5 sub-samples (2cm wide and 5cm deep soil) in a range of 10 × 10m according to a diagonal method for each sample (100g), mixing the samples to form a sample, filling the collected sample into a plastic bag, pricking pin holes to facilitate gas exchange, transporting to a laboratory, storing at 4 ℃ for screening aspergillus flavus.

2. And (5) separating and purifying the strain.

(1) Preparation of soil sample bacterial suspension

10g of soil sample was added with 90mL of 0.1% peptone sterile water (w/v), and shaken at room temperature for 30min to prepare 10^-1Bacterial suspension; then 0.5mL of 10^-1The bacterial suspension was added with 4.5mL of 0.1% peptone sterile water to prepare 10^-2Diluting the bacterial suspension; preparation of 10 by the above method^-3A diluted bacterial suspension.

(2) Isolation and purification of the strains

0.1mL of the inoculum was taken for each dilution, spread on modified Bengal red medium, incubated at 30 ℃ in the dark for 5 days, and repeated 3 times for each dilution. And (3) selecting the aspergillus flavus with yellow-green spores to perform secondary streak separation on the improved Bangla red culture medium until a single colony is obtained. Aspergillus flavus of a single colony is picked up on an MEA slant test tube culture medium, cultured for 3d at 30 ℃ and stored at 4 ℃.

Through the method, the strain PEASH-12 is obtained through isolation.

(3) Identification of Strain PEASH-12

Morphological identification

The isolated strains of the invention are on a modified Bengal Red Medium: producing white hyphae and yellow-green spores; yellow-green spores were produced on modified Bengal red medium, yellow spores on DG18 medium, and bright orange color reaction on AFPA medium; the strain is cultured in a toxin-producing culture solution, and does not produce toxins.

Molecular identification

The strain PEASH-12 was molecularly characterized by ITS gene sequence.

Primers used for amplification of Aspergillus flavus genome ITS were:

ITS1：5’-TCCGTAGGTGAACCTGCGG-3’(SEQ ID No.2)；

ITS4：5’-TCCTCCGCTTATTGATATGC-3’(SEQ ID No.3)。

the PCR amplification conditions were: the PCR amplification reaction program is as follows: pre-denaturation at 94 ℃ for 5min for 1 cycle; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 90s for 30 cycles; final extension at 72 ℃ for 7 min. After amplification, the product was stored at 4 ℃. The product was sent to Shanghai Bioengineering, Inc. for sequencing, and the sequencing results were aligned on BLAST research (http:// www.ncbi.nlm.nih.gov /).

Sequencing shows that the ITS sequence of the bacterial strain PEASH-12 is as follows SEQ ID No. 1:

GACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCAC CCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTC TCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTC TGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCAT CGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCAT CGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCG TCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGG ACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGT CACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTT GACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAT

the ITS sequence comparison shows that the coverage rate of the ITS gene sequence of the strain PEASH-12 and the Aspergillus flavus strain S2599 small subunit ribosomal RNA gene sequence is 99 percent, and the similarity is 100 percent.

The general primers are adopted to detect the expression condition of the toxic gene of the strain PEASH-12, and the result shows that eight toxic key genes of afiT, nor-1, afiR, omtA, ordA, ver-1, verA and verB in the genes on the toxic gene cluster of the strain PEASH-12 are not expressed, so that the strain does not produce toxicity.

The morphological identification and the molecular biology identification result show that the bacterial strain PEASH-12 is aspergillus flavus which does not produce aflatoxin; it was stored in 2018 on 08/01: china general microbiological culture Collection center (CGMCC) with the collection number of CGMCC NO:15998 and the address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

Secondly, analyzing the toxin production condition of aspergillus flavus

(1) Culture for producing toxin

Inoculating the strain on an MEA slant test tube culture medium, and culturing at 28 ℃ for 3d to activate the strain; 4mL of sterile water was added to the slant tube medium and washed to obtain an Aspergillus flavus suspension. The number of spores was recorded under a microscope using a hemocytometer.

Adding 10mL of toxigenic culture solution into a 50mL centrifuge tube, and adding a certain amount of bacterial suspension to make the final concentration of spores be 10⁵mL, 30 ℃, 200rpm, cultured for 7 days.

(2) Aflatoxins B in toxigenic culture solutions₁Measurement of (2)

Detecting AFB in fermentation liquor by adopting methods of immunoaffinity chromatography purification, liquid chromatography separation and fluorescence detector detection₁. The specific operation is as follows: passing 2mL of fermentation liquid through an immunoaffinity chromatography column, eluting with 20mL of water for 2 times at a flow rate of 3mL per minute, discarding eluent, allowing air to enter the column, extruding water out of the column, eluting with 1.5mL of methanol for several times, collecting eluent, concentrating to 0.7mL, diluting with water to 1mL, shaking up, loading, separating by high performance liquid chromatography, and detecting by a fluorescence detector.

The chromatographic conditions are that a chromatographic column is Venusil MP C18(5 mu m, 4.6mm, × 150mm), the column temperature is 40 ℃, the mobile phase is methanol and water (V: 45:55), the flow rate is 1.3mL/min, a post-column photochemical derivatization method is adopted, namely a photochemical derivatization device is 254nm, the excitation wavelength is 360nm, the emission wavelength is 450nm, and the sample injection amount is 20 mu L, and the result is shown in figure 1.

Aflatoxin is not detected in the toxigenic fermentation broth of the aspergillus flavus strain PEASH-12, and the strain PEASH-12 is further proved to be a non-toxigenic strain.

Example 2 inhibitory Effect of the Strain PEASH-12 on toxigenic Aspergillus flavus

1. Laboratory inhibition test

1) Test method

(1) Preparation of the culture Medium

Intact corn and peanut granules are selected, 10g of even size peanuts and corn are weighed separately and sterilized at 121 ℃ for 15 minutes.

(2) Preparation of the bacterial suspension

Aspergillus flavus (Aspergillus flavus NRRL 3357 standard strain) for producing toxin3357) Professor Homoba plum, Zhongshan university) on MEA slant test tube medium, culturing at 20 deg.C for 5 days, dipping spores on the medium with cotton swab in sterile water, shaking with vortex oscillator, and adjusting the concentration of spores to 2 × 10 with blood counting plate⁴spore/mL for use.

(3) Test for inhibitory Effect

Respectively adding 1mL of non-toxigenic bacteria CGMCC15998 and toxigenic Aspergillus flavus (10)⁴:10⁴) Spore suspension was used as experimental group. Then 1ml of Aspergillus flavus (10) producing toxin is added into the triangular flask⁴) An isovolumetrically mixed spore suspension with sterile water was used as a positive control and the bottles were gently shaken to cover the spores onto peanuts and corn. Each was cultured in triplicate at 30 ℃ for 14 days in the dark.

(4) Determination of aflatoxin content

Placing the cultured corn and peanut samples into an autoclave, and sterilizing at 121 deg.C for 30min (to inactivate Aspergillus flavus); the sterilized sample is put into a high-speed universal pulverizer to be smashed, then 50ml of 80% methanol is added into a triangular flask, the mixture is vibrated for 30min at a high speed by an oscillator, and then the filtered extract is measured by HPLC by using sterilized filter paper.

2) Test results

TABLE 1 non-toxigenic Aspergillus flavus inhibitory effect on toxigenic bacteria

As can be seen from Table 1, the toxin-producing bacteria-free CGMCC15998 has the inhibition toxin-producing rate of 83.81% for the toxin-producing bacteria in the peanuts and 80.33% for the toxin-producing bacteria in the corns, and the toxin-producing bacteria-free CGMCC15998 can well inhibit the toxin-producing bacteria.

2. Inhibition test in the field

1) Test method

Preparing a non-toxigenic aspergillus flavus bacterial liquid: activating non-toxigenic strain PEASH-12 in MEA culture medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml of 5%The spores are washed by the peanut protein solution, and 5 percent of peanut protein solution is used for preparing the spore with the concentration of 3.9 × 10⁵Spore suspension per mL.

2) Field inhibition test of non-toxigenic fungus liquid

1 month before peanut harvest, the PEASH-12 spore suspension is added at 300L/mu (spore concentration is 3.9 × 10⁵pieces/mL) was irrigated at the peanut rhizosphere, and the control group changed the PEASH-12 spore suspension to tap water, and the other operations were the same.

And (3) taking soil samples from 10 and 20 days before and after the PEASH-12 spore suspension is applied to the soil samples, detecting the quantity of thalli in the soil samples, separating and identifying the aspergillus flavus, and comparing the quantity of the aspergillus flavus in the soil samples and the proportion change condition of the toxin-producing aspergillus flavus before and after the PEASH-12 spore suspension is applied.

3) Analysis of the reproductive Capacity of a suspension of PEASH-12 spores in soil

TABLE 2 changes in the amount and proportion of Aspergillus flavus in soil after application of PEASH-12 spore suspension

As can be seen from Table 2, in the control group (no PEASH-12 spore suspension is applied), the proportion of the aspergillus flavus producing the toxin in the soil is 70.23%, and after the PEASH-12 spore suspension is applied for 10 days, the colony number of the aspergillus flavus in the soil is increased from 213.45cfu/g soil to 3660.89cfu/g soil, the soil aspergillus flavus is rapidly increased, and the proportion of the aspergillus flavus producing the toxin is rapidly reduced, which indicates that after the control group is not applied to produce the toxin, the PEASH-12 spore suspension can rapidly grow and propagate in the peanut soil, and can competitively inhibit the growth and propagation of the aspergillus flavus producing the toxin, and reduce the proportion of the aspergillus flavus producing the toxin, thereby reducing the proportion of the peanut infected by the aspergillus flavus and reducing the pollution risk of the peanut aflatoxin.

4) Prevention and control of peanut stem rot

When the peanuts are harvested, the incidence of the stem rot of the peanuts in the control group and the peanuts after the PEASH-12 spore suspension is counted, the incidence of the stem rot is taken as a stem rot incidence strain/total peanut strain, and the result is shown in a table 3.

TABLE 3 peanut root rot onset following administration of PEASH-12 spore suspension

Group of	Incidence of Stem rot (%)
		Control group	8.78
Test group	1.07

As can be seen from Table 3, the incidence of peanut root rot after the application of the PEASH-12 spore suspension decreased from 8.78% to 1.07% in the control group.

5) Peanut storage and toxin determination

And (3) drying and weighing each seed sample after harvesting the peanuts, respectively filling the seed samples into seed bags, and storing the seed bags in dry and cool places. And (3) measuring the aflatoxin content of the peanuts stored for 0, 1, 2, 3, 4, 5, 6, 7 and 8 months, and calculating the capability of the aflatoxin-free aspergillus flavus CGMCC15998 for inhibiting the production of the aflatoxin in the peanuts compared with a control group.

TABLE 4 changes in aflatoxin content in peanuts during storage

As can be seen from Table 4, the control group did not irrigate peanuts in the peanut field with PEASH-12 spore suspension, aflatoxin could be detected at the time of harvest, and as the storage time was prolonged, the aflatoxin content was 20.45 μ g/kg at five months of storage, which exceeded the national limit standard of 20 μ g/kg, and aflatoxin exceeded standard and was not edible. The content of aflatoxin in the peanut of the control group increases rapidly with the prolonging of the storage period, and reaches 100.45 mug/kg by the eighth month.

The test group can not detect aflatoxin within 6 months of storage time, which shows that the risk of aflatoxin infection in the peanut storage process can be obviously reduced by applying the PEASH-12 spore suspension to the peanut planting field. The analysis reason is that after the non-toxigenic aspergillus flavus is applied to the peanut planting field, a dominant strain can be formed in the peanut planting field, and growth and reproduction of toxigenic aspergillus flavus in the peanut field are inhibited, so that the peanut is infected by toxigenic bacteria.

Secondly, the influence of the preparation method of the spore suspension on the aspergillus flavus without producing toxin

The test group comprises activating non-toxigenic strain PEASH-12 in MEA culture medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml of 5% peanut protein isolate solution to wash off spores, and preparing with 5% peanut protein isolate solution to obtain spores with concentration of 3.9 × 10⁵Spore suspension per mL.

Control group, activating non-toxigenic strain PEAS-10 in MEA culture medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml distilled water to wash off spores, and preparing with distilled water to spore concentration of 3.9 × 10⁵Spore suspension per mL.

And (3) irrigating the bacterial liquids prepared in the test group and the control group at the rhizosphere of the peanuts by 300L/mu respectively 1 month before the peanuts are harvested, and taking the group without application of spore suspension as a blank control group.

And taking a soil sample 30 days after the PEASH-12 spore suspension is applied, detecting the quantity of thalli in the soil sample, separating and identifying the aspergillus flavus, and comparing the quantity of the aspergillus flavus in the soil sample after the antagonistic bacteria is applied and the proportion change condition of the toxin-producing aspergillus flavus. The results are shown in Table 5.

TABLE 5 Aspergillus flavus number and ratio Change after EASH-12 spore suspension formulated by application method

The results in Table 5 show that the aspergillus flavus cultured by the method does not produce toxic aspergillus flavus, has strong field viability and good inhibition effect on the toxic aspergillus flavus.

Influence of the bacterial strain PEASH-12 on the utilization rate of the organic fertilizer

Control group: a 5% peanut protein isolate solution of the same volume as the test group;

and (4) irrigating the experimental group and the control group at the rhizosphere of the peanuts at 300L/mu 1 month before the peanuts are harvested, and performing the same daily management on the peanuts.

The soil of the test group and the control group was collected at the time of harvesting the peanuts, the organic matter content in the soil was measured, and the results of calculating the organic matter utilization ratio (organic matter utilization ratio/% (organic matter content in soil at the time of harvesting/organic matter content in soil immediately after applying the bacteria) × 100 for the test group and the control group are shown in table 6.

TABLE 6 utilization of organic matter in soil after application of PEASH-12 spore suspension

As can be seen from Table 6, the utilization rate of organic matter in the soil was increased after the application of the antagonistic bacteria, which indicates that the PEASH-12 strain of the present invention can not only reduce the occurrence of peanut diseases, but also increase the utilization rate of organic matter in the soil.

The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.

Sequence listing

<110> institute for peanut research in Shandong province

<120> aspergillus flavus PEASH-12 without producing aflatoxin and application thereof

<130>2019

<141>2019-05-28

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>574

<212>DNA

<213>Aspergillus flavus PEASH-12

<400>1

gacctgcgga aggatcatta ccgagtgtag ggttcctagc gagcccaacc tcccacccgt 60

gtttactgta ccttagttgc ttcggcgggc ccgccattca tggccgccgg gggctctcag 120

ccccgggccc gcgcccgccg gagacaccac gaactctgtc tgatctagtg aagtctgagt 180

tgattgtatc gcaatcagtt aaaactttca acaatggatc tcttggttcc ggcatcgatg 240

aagaacgcag cgaaatgcga taactagtgt gaattgcaga attccgtgaa tcatcgagtc 300

tttgaacgca cattgcgccc cctggtattc cggggggcat gcctgtccga gcgtcattgc 360

tgcccatcaa gcacggcttg tgtgttgggt cgtcgtcccc tctccggggg ggacgggccc 420

caaaggcagc ggcggcaccg cgtccgatcc tcgagcgtat ggggctttgt cacccgctct 480

gtaggcccgg ccggcgcttg ccgaacgcaa atcaatcttt ttccaggttg acctcggatc 540

aggtagggat acccgctgaa cttaagcata tcat 574

<210>2

<211>19

<212>DNA

<213> Artificial sequence (Aspergillus flavus PEASH-12)

<400>2

tccgtaggtg aacctgcgg 19

<210>3

<211>20

<212>DNA

<213> Artificial sequence (Aspergillus flavus PEASH-12)

<400>3

tcctccgctt attgatatgc 20

Claims

1. The aspergillus flavus without producing aflatoxin is characterized in that: the non-toxigenic Aspergillus flavus is Aspergillus flavus (Aspergillus flavus) PEASH-12, which is deposited at year 2018, month 08 and day 01: china general microbiological culture Collection center (CGMCC) with the collection number of CGMCC NO:15998 and the address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

2. A biocontrol microbial inoculum for producing aspergillus flavus is characterized in that: the preparation method comprises the following steps:

activating non-toxigenic Aspergillus flavus strain PEASH-12 in MEA culture medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml of 5% peanut protein solution, washing spores, and adding 5% peanut protein solution until the spore concentration of PEASH-12 is 3.9 × 10⁵Bacterial suspension per mL to obtain;

the non-toxigenic aspergillus flavus strain PEASH-12 is non-toxigenic aspergillus flavus with the preservation number of CGMCC NO: 15998.

3. The use of the biocontrol microbial inoculum for producing aspergillus flavus of claim 2, which is characterized in that: the method is used for reducing crop diseases, improving the utilization rate of organic fertilizer, reducing the content of aflatoxin in agricultural products during harvesting and prolonging the storage period of the agricultural products.

4. A method for reducing crop diseases and improving the utilization rate of organic fertilizer is characterized in that: the biocontrol microbial inoculum for producing the aspergillus flavus in the claim 2 is irrigated to the rhizosphere of the crops at 300L/mu 1 month before the crops are harvested.

5. A method for reducing aflatoxin content in agricultural products at harvest and prolonging storage life of the agricultural products, which is characterized in that: the biocontrol microbial inoculum for producing the aspergillus flavus in the claim 2 is irrigated to the rhizosphere of the crops at 300L/mu 1 month before the crops are harvested.