CN110129212B

CN110129212B - Aspergillus flavus PEAS-10 without producing aflatoxin and application thereof

Info

Publication number: CN110129212B
Application number: CN201910451833.2A
Authority: CN
Inventors: 张初署; 龚魁杰; 孙杰; 于丽娜; 毕洁; 王明清; 栾云霞
Original assignee: Shandong Peanut Research Institute
Current assignee: Shandong Peanut Research Institute
Priority date: 2019-05-28
Filing date: 2019-05-28
Publication date: 2020-07-28
Anticipated expiration: 2039-05-28
Also published as: CN110129212A

Abstract

The invention discloses aspergillus flavus PEAS-10 incapable of producing aflatoxin and application thereof, belonging to the technical field of microorganisms. The Aspergillus flavus which does not produce toxin is Aspergillus flavus (PEAS-10) which is preserved in 2018 in 08 and 01 months: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:15997 and the address of the CGMCC is as follows: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province. The strain can rapidly grow and propagate in the field, can efficiently inhibit the growth, propagation and toxin production of toxin-producing aspergillus flavus, and has obvious effect of field prevention and control of aflatoxin pollution; the Aspergillus flavus PEAS-10 spore suspension without generating toxicity can reduce the occurrence of peanut diseases and increase the utilization rate of soil organic matters.

Description

Aspergillus flavus PEAS-10 without producing aflatoxin and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to aspergillus flavus PEAS-10 incapable of producing aflatoxin and application thereof.

Background

Aflatoxins are metabolites of aspergillus flavus and aspergillus parasiticus. A large amount of experimental data show that the aflatoxin can cause experimental liver cancer to be induced by human beings and various animals, is the strongest chemical carcinogen found at present, and has 75 times greater capability than that of the dimethyl nitrosamine to induce liver cancer. Aflatoxin is also a virulent agent, with 68 times of arsenic and 10 times of potassium cyanide, and can cause severe liver damage and death in a short period of time.

Peanuts are the crop most susceptible to Aspergillus flavus infection. The peanuts are likely to be infected with aspergillus flavus in the whole growth process, and particularly in the later growth period, the pollution of the aspergillus flavus is aggravated after the seed coats of the peanuts are damaged due to the change of temperature and humidity and the harm of sick rats and the like. After the peanuts are harvested, the influence of air temperature, air humidity and storage conditions can cause aspergillus flavus infection more easily. In the process of reproduction and metabolism of the aspergillus flavus, a large amount of toxins (mainly aflatoxin B1) are generated to pollute peanuts and products thereof. It has been found that this toxin is likely to be present in improperly preserved peanuts and peanut oil, peanut beverages, and peanut butter. Due to the pollution of aspergillus flavus, the growth of peanuts can be inhibited, so that the yield of the peanuts is reduced, and the yield is reduced by about 10 percent.

The aflatoxin pollution of the peanuts mainly comprises pollution before the peanuts are harvested and pollution after the peanuts are harvested. The peanuts are easy to be infected by aspergillus flavus before being harvested, and researches show that the soil is a main source of the aspergillus flavus of the peanuts, and the aspergillus flavus in the peanut pods is directly related to the aspergillus flavus in the soil, so that the researches on the field biological prevention and control of the peanut aspergillus flavus pollution are of great significance in order to effectively prevent and reduce the pollution of the peanut aflatoxin.

Biocontrol aflatoxin is a substance that utilizes beneficial (or at least harmless) organisms and metabolites thereof to change the layout of microorganisms, inhibit the growth of toxigenic strains or inhibit the synthesis of toxins thereof, thereby achieving the level of reducing aflatoxin of agricultural products; or the aflatoxin is adsorbed and degraded by the actions of biological adhesion, degradation and the like, so that the aim of removing the aflatoxin is fulfilled. Compared with other treatment methods, the biological prevention and control method has the advantages of simple operation, no damage to the original quality of agricultural products, safety, high efficiency, environmental friendliness and the like, and represents a new direction for green control of aflatoxin.

The field control of the peanut aspergillus flavus pollution is mainly characterized in that water supply is ensured during the peanut pod development period in the later growth period of the peanuts, the situation that the infection chances of the aspergillus flavus are increased due to the breakage of seed coats caused by drought before harvesting is avoided, the occurrence of other diseases, insect pests and mouse pests is avoided, and the pod damage caused by plowing is avoided in the pod bearing period and the pod development period. Sun-drying the legume in time after harvesting to make the water content less than 5%, and screening new peanut varieties with resistance. However, the aspergillus flavus has strong viability, and the produced spores can resist various severe natural conditions, so that the infection of the aspergillus flavus cannot be completely avoided.

At present, the aspergillus flavus which does not produce the toxin is separated from the soil, only the research of inhibiting the growth of the aspergillus flavus which produces the toxin in a laboratory is carried out, and the field experimental research is not carried out. At present, some antagonistic bacteria are not suitable for field growth, have no growth advantage in the field and cannot play a role in inhibiting the production of toxic aspergillus flavus.

Disclosure of Invention

Aiming at the problems of poor field adaptability, low survival rate, poor field application effect and the like of the existing antagonistic bacteria for producing the toxic aspergillus flavus, the invention aims to provide a non-toxigenic strain for efficiently inhibiting the production of the toxic aspergillus flavus. The strain can rapidly grow and propagate in the field, can efficiently inhibit the growth and propagation of toxin-producing aspergillus flavus, and has obvious effect of preventing and controlling aflatoxin pollution in the field.

In order to achieve the purpose, the technical scheme of the invention is as follows:

aspergillus flavus producing no aflatoxin, said Aspergillus flavus producing no aflatoxin being Aspergillus flavus (Aspergillus flavus) PEAS-10, deposited at 08 months and 01 days 2018 in: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:15997 and the address of the CGMCC is as follows: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

On the basis of the scheme, the aspergillus flavus not producing toxin is separated from the village of the pond in the backland of Jialing area of Nanchong city, Sichuan province.

On the basis of the scheme, the colony morphology of the aspergillus flavus not producing toxin is as follows: strains were on modified mengladesh medium: producing white hyphae and yellow-green spores; yellow spores were produced on DG18 medium and a bright orange color reaction on AFPA medium.

On the basis of the scheme, the non-toxigenic aspergillus flavus ITS sequence is shown as SEQ ID No. 1.

The application of the bacterial suspension, the whole culture solution, the whole culture, the spores, the crude extract or the extracellular metabolite of the aspergillus flavus which does not produce the aflatoxin is used for biological prevention and control of the toxigenic aspergillus flavus.

On the basis of the scheme, the bacterial suspension, the whole culture solution, the whole culture, the spores, the crude extract or the extracellular metabolite of the aspergillus flavus which does not produce the aflatoxin is applied to antagonize the growth of the toxin-producing aspergillus flavus or inhibit the biosynthesis of the aflatoxin or degrade the aflatoxin.

A biocontrol microbial inoculum for producing the aspergillus flavus is prepared by the following method:

activating non-toxigenic Aspergillus flavus strain PEAS-10 in MEA culture medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml of 5% peanut protein solution, washing spores, diluting with 5% peanut protein solution until the spore concentration of PEAS-10 is 10⁶The spore suspension per m L.

The application of the biocontrol microbial inoculum for producing the toxic aspergillus flavus is used for reducing crop diseases, improving the utilization rate of organic fertilizer, reducing the content of aflatoxin in agricultural products during harvesting and prolonging the storage period of the agricultural products.

A method for reducing crop diseases and increasing the utilization rate of organic fertilizer comprises the step of irrigating the biocontrol microbial inoculum for producing the toxic aspergillus flavus at the rhizosphere of crops by 300L/mu in 1 month before the crops are harvested.

A method for reducing aflatoxin content in agricultural products during harvesting and prolonging the storage period of the agricultural products comprises the step of irrigating the biocontrol microbial inoculum for producing the aflatoxin aspergillus at 300L/mu at the rhizosphere of crops 1 month before the crops are harvested.

The technical scheme of the invention has the advantages that:

according to the invention, the aspergillus flavus strain incapable of producing aflatoxin is obtained through separation and purification, the strain can rapidly grow and propagate in the field, the growth, propagation and toxin production of toxin-producing aspergillus flavus can be efficiently inhibited, and the effect of field prevention and control of aflatoxin pollution is remarkable. The Aspergillus flavus PEAS-10 spore suspension without generating toxicity can reduce the occurrence of peanut diseases and increase the utilization rate of soil organic matters.

Drawings

FIG. 1 shows the measurement of aflatoxin content in the fermentation broth of strain PEAS-10.

Detailed Description

Terms used in the present invention have generally meanings as commonly understood by one of ordinary skill in the art, unless otherwise specified.

The present invention will be described in further detail with reference to the following data in conjunction with specific examples. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

The Aspergillus flavus which does not produce toxin is Aspergillus flavus (PEAS-10) which is preserved in 2018 in 08 and 01 months: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:15997 and the address of the CGMCC is as follows: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

Example 1

Separation, purification and identification of bacterial strain

1. Collecting samples in peanut planting land (2018.05 collected in the village dam of the Onya village of the pond of the Tumen of the Jialing area of Nanchong city, Sichuan province), taking 5 sub-samples (2cm wide and 5cm deep soil) within the range of 10 × 10m according to a diagonal method for mixing to form a sample, filling the collected sample into a plastic bag, pricking pin holes to facilitate gas exchange, transporting to a laboratory, storing at 4 ℃ for screening aspergillus flavus.

2. And (5) separating and purifying the strain.

(1) Preparation of soil sample bacterial suspension

10g of soil sample was added with 90m L0.1% peptone sterile water (w/v), shaken at room temperature for 30min to make 10^-1Suspending the bacteria, and taking out 0.5m L10^-1The bacterial suspension was added with 4.5m L0.1.1% peptone sterile water to prepare 10^-2Diluting the bacterial suspension; preparation of 10 by the above method^-3A diluted bacterial suspension.

(2) Isolation and purification of the strains

Taking 0.1m L bacterial liquid from each dilution, coating the bacterial liquid on an improved Bangla red culture medium, culturing for 5d in the dark at the temperature of 30 ℃, repeating for 3 times for each dilution, selecting the aspergillus flavus with yellow green spores to perform secondary streak separation on the improved Bangla red culture medium until a single colony is obtained, selecting the aspergillus flavus with the single colony on an MEA slant test tube culture medium, culturing for 3d at the temperature of 30 ℃, and storing at the temperature of 4 ℃.

Through the method, the strain PEAS-10 is obtained by separation.

(3) Identification of Strain PEAS-10

Morphological identification

The isolated strains of the invention are on a modified Bengal Red Medium: producing white hypha and yellow-green spores by aspergillus flavus; yellow spores were produced on DG18 medium and a bright orange color reaction on AFPA medium; and the strain is cultured in a toxin-producing culture solution, and aflatoxin is not produced.

Molecular identification

The strain PEAS-10 was molecularly identified by ITS gene sequence.

Primers used for amplification of Aspergillus flavus genome ITS were:

ITS1：5’-TCCGTAGGTGAACCTGCGG-3’(SEQ ID No.2)；

ITS4：5’-TCCTCCGCTTATTGATATGC-3’(SEQ ID No.3)。

the PCR amplification conditions comprise the procedures of pre-denaturation at 94 ℃ for 5min for 1 cycle, denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, extension at 72 ℃ for 90s for 30 cycles, final extension at 72 ℃ for 7min, amplification, storage at 4 ℃, sequencing of products by Shanghai Biotechnology Limited, and comparison on the sequencing result B L AST research (http:// www.ncbi.nlm.nih.gov /).

Sequencing shows that the ITS sequence of the bacterial strain PEAS-10 is as follows:

ACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACC CGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCT CAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCT GAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATC GATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATC GAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGT CATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGA CGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTC ACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTG ACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT

the ITS sequence comparison shows that the similarity of the ITS gene sequence of the strain PEAS-10 and the gene sequence of the Aspergillus flavus strain L WU-31 small subunit ribosomal RNA is 100%.

The expression condition of the toxic gene of the strain PEAS-10 is detected by adopting a universal primer, and the result shows that seven toxic key genes of nor-1, afiR, omtA, ordA, ver-1, verA and verB in the genes on the toxic gene cluster of the strain PEAS-10 are not expressed, so that the strain does not produce toxicity.

The morphological identification and the molecular biology identification result show that the strain PEAS-10 is aspergillus flavus which does not produce aflatoxin; it was stored in 2018 on 08/01: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:15997 and the address of the CGMCC is as follows: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

Secondly, analyzing the toxin production condition of aspergillus flavus

(1) Culture for producing toxin

Inoculating the strain to MEA slant tube culture medium, culturing at 28 deg.C for 3 days, activating, adding 4m L sterile water to the slant tube culture medium, washing to obtain Aspergillus flavus suspension, and recording the number of spores with blood counting plate under microscope.

Adding 10m of the toxigenic culture solution of L m into a 50m L centrifuge tube, and adding a certain amount of bacterial suspension to make the final concentration of spores be 10⁵M L, 30 ℃, 200rpm, cultured for 7 days.

(2) Aflatoxins B in toxigenic culture solutions₁Measurement of (2)

Detecting AFB in fermentation liquor by adopting methods of immunoaffinity chromatography purification, liquid chromatography separation and fluorescence detector detection₁The specific operation is that 2m L fermentation liquor passes through an immunoaffinity chromatography column, the flow rate is 3m L per minute, water 20m L is used for 2 times of elution, eluent is discarded, air enters the column, water is extruded out of the column, methanol with the size of 1.5m L is used for fractional elution, the eluent is collected and concentrated to 0.7m L, the eluent is diluted to 1m L by water, the shaking is uniform, the sample is loaded, the high performance liquid chromatography separation is carried out, and the fluorescence detector detection is carried out.

The chromatographic conditions are that a chromatographic column is Venusil MP C18(5 mu m, 4.6mm, × 150mm), the column temperature is 40 ℃, the mobile phase is methanol and water (V: 45:55), the flow rate is 1.3m, L/min, a post-column photochemical derivatization method is adopted, namely a photochemical derivatization device is 254nm, the excitation wavelength is 360nm, the emission wavelength is 450nm, and the sample injection amount is 20 mu, L through detection by a fluorescence detector, and the result is shown in figure 1.

Aflatoxin is not detected in the aflatoxin-producing fermentation broth of the aspergillus flavus strain PEAS-10, and the strain PEAS-10 is further proved to be a non-toxigenic strain.

Example 2 inhibitory Effect of the Strain PEAS-10 on the production of toxigenic Aspergillus flavus

1. Laboratory inhibition test

1) Test method

(1) Preparation of the culture Medium

Intact corn and peanut granules are selected, 10g of even size peanuts and corn are weighed separately and sterilized at 121 ℃ for 15 minutes.

(2) Preparation of the bacterial suspension

Inoculating Aspergillus flavus (Aspergillus flavus NRR L3357 standard strain (Aspergillus flavus NRR L3357 provided by Proc. Hezaki professor of Zhongshan university) on MEA slant test tube culture medium, culturing at 20 deg.C for 5 days, dipping spores on the culture medium with cotton swab in sterile water, shaking with vortex oscillator, and adjusting the spore concentration to 2 × 10 with blood counting plate⁴Spores/m L, ready for use.

(3) Test for inhibitory Effect

Adding 1m L non-toxigenic bacteria CGMCC15997 and toxigenic Aspergillus flavus (10)⁴:10⁴) Spore suspension as experimental group then 1m L toxigenic bacteria (10) was added to the flask⁴) An isovolumetrically mixed spore suspension with sterile water was used as a positive control and the bottles were gently shaken to cover the spores onto peanuts and corn. Each was cultured in triplicate at 30 ℃ for 14 days in the dark.

(4) Determination of aflatoxin content

Placing cultured semen Maydis and semen Arachidis Hypogaeae samples into autoclave, sterilizing at 121 deg.C for 30min (to inactivate Aspergillus flavus), mashing sterilized samples in high speed universal pulverizer, adding 50ml 80% methanol into triangular flask, shaking at high speed for 30min with oscillator, filtering with sterilized filter paper, and measuring the extractive solution with HP L C.

2) Test results

TABLE 1 non-toxigenic Aspergillus flavus inhibitory effect on toxigenic bacteria

As can be seen from Table 1, the inhibiting rate of the non-toxigenic bacteria PEAS-10 to toxigenic bacteria in peanuts is 74.02%, the inhibiting rate to toxigenic bacteria in corn is 81.19%, and the non-toxigenic bacteria PEAS-10 can well inhibit the toxigenic bacteria.

2. Inhibition test in the field

1) Test method

Preparing a non-toxigenic aspergillus flavus bacterial liquid: activating non-toxigenic strain PEAS-10 in MEA culture medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml of 5% peanut protein solution to wash off spores, and preparing with 5% peanut protein solution to obtain spore with concentration of 10⁶Spore suspension of individual/m L.

2) Field inhibition test of non-toxigenic fungus liquid

1 month before peanut harvest, non-toxigenic bacteria liquid (spore concentration is 10)⁶Pieces/m L) was irrigated at 300L/mu at the peanut rhizosphere, the control group was changed from non-toxigenic inoculum to tap water, and the other operations were the same.

And (3) taking soil samples from 10 days before applying the non-toxigenic aspergillus flavus strain PEAS-10 to 10 days after applying the strain to harvest, detecting the quantity of thalli in the soil samples, separating and identifying the aspergillus flavus, and comparing the quantity of the aspergillus flavus in the soil samples and the proportion change condition of the aspergillus flavus producing the toxigenic aspergillus flavus before and after applying the non-toxigenic aspergillus flavus strain PEAS-10.

3) Analysis of reproductive capacity of non-toxigenic Aspergillus flavus strain PEAS-10 in soil

TABLE 2 changes in the amount and ratio of Aspergillus flavus in soil after application of non-toxigenic Aspergillus flavus

As can be seen from Table 2, in the control group (no applied non-toxigenic bacteria), the number of Aspergillus flavus colonies in the soil is 213.45cfu/g, the proportion of the toxigenic Aspergillus flavus is 70.23%, while after the non-toxigenic Aspergillus flavus is applied for 10 days, the number of the Aspergillus flavus colonies in the soil is rapidly increased to 2954.23cfu/g of soil, the soil Aspergillus flavus is rapidly increased, and the proportion of the toxigenic bacteria is rapidly reduced to 9.65%; after 20 days of bacterium application, the colony number of aspergillus flavus in the soil reaches 7865.5cfu/g, and the proportion of the toxin-producing aspergillus flavus is reduced to 1.51 percent; when the strain is harvested, the colony number of the aspergillus flavus in the soil reaches 8564.50cfu/g, and the proportion of the aspergillus flavus producing toxin is reduced to 0.98 percent; from the results, the bacteria which do not produce the poison grow and reproduce in the soil rapidly after the bacteria which do not produce the poison are applied, the colony number of the aspergillus flavus in the soil increases rapidly after 20 days of the bacteria application, the growth tends to be slow later, and the result shows that the effect of applying the bacteria which do not produce the poison is the best 20 days before the peanuts are harvested; meanwhile, after the non-toxigenic bacteria are applied, the non-toxigenic bacteria can rapidly grow and propagate in the peanut soil, the growth and propagation of the non-toxigenic aspergillus flavus can be competitively inhibited, the proportion of the toxigenic bacteria is reduced, experiments show that after the non-toxigenic bacteria are applied, the proportion of the toxigenic bacteria is reduced from 70.23% of a control group to 0.98% before harvesting, the proportion of the toxigenic bacteria is rapidly reduced, so that the proportion of the toxigenic bacteria infecting peanuts is reduced, and the pollution risk of the peanut aflatoxin is reduced.

4) Prevention and control of flower root rot

When the peanuts are harvested, the morbidity of the peanut root rot of the control group and the peanuts after the PEAS-10 spore suspension is counted, the incidence of the root rot is the root rot pathogenic strain/total peanut strain, and the results are shown in a table 3.

TABLE 3 peanut root rot onset following PEAS-10 spore suspension administration

Group of	Incidence of root rot (%)
		Control group	12.14
PEAS-10 spore suspension	2.47

As can be seen from Table 3, the incidence of peanut root rot after the PEAS-10 spore suspension is applied is reduced to 2.47% from 12.14% of the control group, and the analysis reason is that the PEAS-10 spore suspension can inhibit the peanut root rot while inhibiting the toxigenic aspergillus flavus.

5) Prevention and control of peanut stem rot

When the peanuts are harvested, the incidence conditions of the stem rot of the peanuts in the control group and the peanuts after the PEAS-10 spore suspension is counted, the incidence rate of the stem rot is determined by taking the stem rot incidence strain/total peanut strain, and the results are shown in a table 4.

TABLE 4 peanut root rot onset following PEAS-10 spore suspension administration

Group of	Incidence of Stem rot (%)
		Control group	9.14
PEAS-10 spore suspension	1.27

As can be seen from Table 4, the incidence of peanut root rot decreased from 9.24% to 1.27% in the control group after the application of the PEAS-10 spore suspension.

6) Peanut storage and toxin determination

And (3) drying and weighing each seed sample after harvesting the peanuts, respectively filling the seed samples into seed bags, and storing the seed bags in dry and cool places. And (3) measuring the aflatoxin content of the peanuts stored for 0, 1, 2, 3, 4, 5, 6, 7 and 8 months, and calculating the capability of the non-toxigenic aspergillus flavus PEAS-10 for inhibiting the generation of the peanut aflatoxin compared with a control group.

TABLE 5 changes in aflatoxin content in peanuts during storage

As can be seen from Table 5, the control group did not use the peanuts which do not produce the toxigenic bacteria PEAS-10 to irrigate the peanut field, aflatoxin can be detected during harvesting, and as the storage time is prolonged, the aflatoxin content is 20.45 mug/kg and exceeds the national limit standard by 20 mug/kg when the peanuts are stored for five months, and the aflatoxin exceeds the standard and cannot be eaten. The content of aflatoxin in the peanut of the control group increases rapidly with the prolonging of the storage period, and reaches 100.45 mug/kg by the eighth month.

The test group can not detect the aflatoxin within 6 months of storage time, which shows that the risk of aflatoxin infection in the peanut storage process can be obviously reduced by applying the non-toxigenic bacterium PEAS-10 to the peanut planting field. The analysis reason is that after the non-toxigenic aspergillus flavus is applied to the peanut planting field, a dominant strain can be formed in the peanut planting field, and growth and reproduction of toxigenic aspergillus flavus in the peanut field are inhibited, so that the peanut is infected by toxigenic bacteria.

Secondly, the influence of the preparation method of the spore suspension on the aspergillus flavus without producing toxin

Test groups: activating non-toxigenic strain PEAS-10 in MEA culture medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml of 5% peanut protein isolate solution to wash off spores, and preparing with 5% peanut protein isolate solution to obtain spore with concentration of 10⁶Spore suspension of individual/m L.

Control group: activating non-toxigenic strain PEAS-10 in MEA culture medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml distilled water to wash off spores, and preparing with tap water to obtain spore concentration of 10⁶Spore suspension of individual/m L.

1 month before peanut harvest, the spore suspensions prepared in the test group and the control group are respectively irrigated to the peanut rhizosphere at 300L/mu, and the group without the spore suspension is used as a blank control group.

And (3) taking a soil sample 30 days after the spore suspension is applied, detecting the quantity of thalli in the soil sample, separating and identifying the aspergillus flavus, and comparing the quantity of the aspergillus flavus in the soil sample after the PEAS-10 spore suspension is applied and the proportion change condition of the aspergillus flavus producing toxin. The results are shown in Table 6.

TABLE 6 Aspergillus flavus changes in quantity and ratio after application of PEAS-10 spore suspensions formulated in different ways

The results in Table 6 show that the aspergillus flavus cultured by the method does not produce toxic aspergillus flavus, has strong field viability and good inhibition effect on the toxic aspergillus flavus.

Influence of the bacterial strain PEAS-10 on the utilization rate of the organic fertilizer

Control group: a 5% peanut protein isolate solution of the same volume as the test group;

the test group and the control group are irrigated to the peanut rhizosphere at 300L/mu 1 month before the peanuts are harvested, and other daily management is the same.

And (3) collecting the soil of the test group and the soil of the control group when the peanuts are harvested, measuring the content of organic matters in the soil, and calculating the utilization rate of the organic matters of the test group and the control group (the utilization rate of the organic matters/% (the content of the organic matters in the soil when the peanuts are harvested/the content of the organic matters in the soil when the peanuts are applied with bacteria) × 100). The results are shown in Table 7.

TABLE 7 utilization of organic matter in soil after PEAS-10 spore suspension application

Group of	Organic matter utilization (%)
		Control group	29
Test group	74

As can be seen from Table 7, the utilization rate of organic matter in soil was increased after the application of antagonistic bacteria, which indicates that the PEAS-10 strain of the present invention not only reduced the occurrence of peanut diseases, but also increased the utilization rate of organic matter in soil.

The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.

Sequence listing

<110> institute for peanut research in Shandong province

<120> Aspergillus flavus PEAS-10 without producing aflatoxin and application thereof

<130>2019

<141>2019-05-28

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>574

<212>DNA

<213>Aspergillus flavus PEAS-10

<400>1

acctgcggaa ggatcattac cgagtgtagg gttcctagcg agcccaacct cccacccgtg 60

tttactgtac cttagttgct tcggcgggcc cgccattcat ggccgccggg ggctctcagc 120

cccgggcccg cgcccgccgg agacaccacg aactctgtct gatctagtga agtctgagtt 180

gattgtatcg caatcagtta aaactttcaa caatggatct cttggttccg gcatcgatga 240

agaacgcagc gaaatgcgat aactagtgtg aattgcagaa ttccgtgaat catcgagtct 300

ttgaacgcac attgcgcccc ctggtattcc ggggggcatg cctgtccgag cgtcattgct 360

gcccatcaag cacggcttgt gtgttgggtc gtcgtcccct ctccgggggg gacgggcccc 420

aaaggcagcg gcggcaccgc gtccgatcct cgagcgtatg gggctttgtc acccgctctg 480

taggcccggc cggcgcttgc cgaacgcaaa tcaatctttt tccaggttga cctcggatca 540

ggtagggata cccgctgaac ttaagcatat caat 574

<210>2

<211>19

<212>DNA

<213> Artificial sequence (Aspergillus flavus PEAS-10)

<400>2

tccgtaggtg aacctgcgg 19

<210>3

<211>20

<212>DNA

<213> Artificial sequence (Aspergillus flavus PEAS-10)

<400>3

tcctccgctt attgatatgc 20

Claims

1. An aspergillus flavus strain without producing aflatoxin, which is characterized in that: the aspergillus flavus not producing toxin is aspergillus flavus (A), (B)Aspergillus flavus) PEAS-10, deposited at month 01, 2018 at: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:15997 and the address of the CGMCC is as follows: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.

2. Use of a bacterial suspension or whole culture of aflatoxin-free aspergillus flavus as claimed in claim 1, characterized in that: is used for biological prevention and control of the toxigenic aspergillus flavus.

3. Use according to claim 2, characterized in that: the bacterial suspension or the whole culture of the aspergillus flavus which does not produce the aflatoxin is applied to antagonizing the growth of the aspergillus flavus which produces the toxin or inhibiting the biosynthesis of the aflatoxin.

4. A biocontrol microbial inoculum for producing aspergillus flavus is characterized in that: the preparation method comprises the following steps:

activating the Aspergillus flavus PEAS-10 of claim 1 in MEA medium, culturing at 28-30 deg.C for 6-7 days, adding 20ml of 5% peanut protein solution, washing off spores, and diluting with 5% peanut protein solution to obtain PEAS-10 with spore concentration of 10⁶The bacterial suspension per m L is obtained.

5. The use of the biocontrol microbial inoculum for producing aspergillus flavus of claim 4, which is characterized in that: the peanut foliar fertilizer is used for reducing the morbidity of root rot and stem rot of peanuts, improving the utilization rate of organic fertilizer, reducing the content of aflatoxin in the peanuts during harvesting and prolonging the storage period of the peanuts.

6. A method for reducing the incidence rate of peanut root rot and stem rot and increasing the utilization rate of organic fertilizer is characterized in that the biocontrol microbial inoculum for producing the aspergillus flavus in the claim 4 is irrigated to the rhizosphere of peanuts at 300L/mu 1 month before the peanuts are harvested.

7. A method for reducing aflatoxin content in peanuts at harvest and prolonging the storage period of the peanuts, which is characterized in that the biocontrol microbial inoculum for producing the poisonous aspergillus flavus in claim 4 is irrigated to the rhizosphere of the peanuts at 300L/mu 1 month before the peanuts are harvested.