CN110669819A - Method for identifying pathogenicity of peanut rot pathogenic fungi - Google Patents
Method for identifying pathogenicity of peanut rot pathogenic fungi Download PDFInfo
- Publication number
- CN110669819A CN110669819A CN201911088363.4A CN201911088363A CN110669819A CN 110669819 A CN110669819 A CN 110669819A CN 201911088363 A CN201911088363 A CN 201911088363A CN 110669819 A CN110669819 A CN 110669819A
- Authority
- CN
- China
- Prior art keywords
- peanut
- pathogenicity
- pathogenic fungi
- culture
- identifying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/18—Testing for antimicrobial activity of a material
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a pathogenicity identification method of peanut rot pathogenic fungi, belonging to the technical field of pathogenic fungi pathogenicity identification. The pathogenicity identification method comprises the steps of respectively sterilizing, washing and carrying out minimally invasive treatment on seeds and different tissues of a susceptible peanut variety, inoculating a pathogenic fungus mycelium block to realize co-culture of pathogenic fungi, the peanut seeds and the different tissues of the peanut, and observing infection pathogenicity after 5 days. The method can detect the pathogenicity of the rot pathogenic fungi at any time, is quick, simple and convenient, has high stability and good repeatability, is favorable for quickly identifying a large number of peanut disease-resistant germplasm resources, and has important significance for the breeding of peanut disease-resistant varieties and the prevention and control research of rot.
Description
Technical Field
The invention belongs to the technical field of pathogenic fungus pathogenicity identification, and particularly relates to a method for identifying pathogenicity of peanut rot pathogenic fungi.
Background
Peanuts are a temperature-loving leguminous crop which blooms on the ground and then shoots into the ground to fruit, and are oil and economic crops widely planted worldwide. But is susceptible to soil-borne diseases due to the nature of underground results. A plurality of peanut soil infectious diseases are reported, including fungal diseases, bacterial diseases, nematode diseases and the like. The fungal diseases mainly comprise stem rot, root rot, fruit rot and the like. These fungal diseases often result in peanut seedling death or underground root rot. The large-area rotting and yield reduction and even the top harvest of peanuts caused by fungal diseases are mostly reported, and the situation that the rotting and yield reduction of peanuts is aggravated in the northern production area is in the next year, so that the screening, the culture and the pathogenicity research of pathogenic fungi of the rotting and disease-causing peanut become more important, the method is a precondition and a basis for researching the mechanism of resisting the fungal rotting and disease-preventing peanut and breeding disease-resistant varieties, and is also a key for preventing and controlling the rotting and disease of the peanuts.
At present, a field test and a potted plant tieback method are mostly adopted in a peanut pathogenic fungus pathogenicity identification method; the detection method has long period and is greatly restricted by the external environment; the method for rapidly identifying the pathogenicity of the peanut pathogenic fungi has important significance for screening disease-resistant seeds of peanuts.
Disclosure of Invention
Aiming at the problems in the prior art, the invention aims to provide the method for identifying the pathogenicity of the peanut rot pathogenic fungi, which is quick, simple, convenient, high in stability and good in repeatability, and overcomes the defects that field and potted plant tieback detection is limited by the planting period and the detection period is long.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
a method for identifying the pathogenicity of pathogenic fungus of peanut rot includes such steps as respectively disinfecting, washing and minimally invasive treating the seeds and different tissues of peanut, inoculating the mycelial block of pathogenic fungus, co-culturing the pathogenic fungus with the seeds and different tissues of peanut, and observing the infection pathogenicity after 5 days.
On the basis of the scheme, the pathogenic fungus of the peanut rot disease is fusarium oxysporum.
On the basis of the scheme, the fusarium oxysporum is fusarium oxysporum Hs-f, and is preserved in the following steps in 29 months in 2019 and 08 months: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:18130 and an address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.
On the basis of the scheme, the fusarium oxysporum Hs-f is cultured by the following method:
(1) activating strains: inoculating the frozen strains into 5ml of PDA liquid culture medium, and performing shake culture at 25 ℃ and 180rpm for 8 h;
(2) enrichment culture: transferring the activated 5ml culture solution into 50ml PDA liquid culture medium, and performing shake culture at 25 ℃ and 180rpm overnight;
(3) and (3) amplification culture: and (3) coating 1ml of the enrichment culture solution on a PDA culture medium plate, airing, repeatedly coating twice, airing, and performing dark culture at 25 ℃ overnight.
On the basis of the scheme, the frozen strain is a pathogenicity-stable strain which is preserved by a single colony which is separated and purified and is quickly passaged to 50 generations.
The rapid passage is as follows:
(1) selecting a single colony, inoculating the single colony in 5ml of PDA liquid culture medium, and performing shake culture at 25 ℃ and 180rpm for 8 hours;
(2) taking 5ml of the culture solution in the step (1), transferring the culture solution into 50ml of PDA liquid culture medium, and performing shake culture at 25 ℃ and 180rpm overnight;
(3) finally, coating the culture solution in the step (2) on a PDA culture medium plate, drying in the air, repeatedly coating twice, and performing dark culture at 25 ℃ overnight after drying in the air;
(4) repeating the steps (1) to (3) to passage to 50 generations.
On the basis of the scheme, the susceptible peanut variety is No. 20 Huayu.
On the basis of the scheme, the different tissues of the peanut comprise a peanut seedling root system, a peanut seedling stem part, a peanut seedling cotyledon and a peanut leaf.
On the basis of the scheme, the co-culture conditions of the pathogenic fungi, the peanut seeds and different tissues of the peanuts are as follows: culturing at 25 deg.C under 16h/8h for 7 days in a constant temperature incubator.
On the basis of the scheme, the inoculation amount of the mycelium blocks of the pathogenic fungi is a cylindrical block with the diameter of 0.3cm (the mycelium blocks are cylindrical blocks with the diameter and the height of 0.3 cm).
On the basis of the scheme, the pathogenicity judgment standard is as follows: the inoculated point becomes yellow and black until the rot spreads.
The technical scheme of the invention has the advantages
The method can detect the pathogenicity of the rot pathogenic fungi at any time, is quick, simple, convenient, high in stability and good in repeatability, overcomes the defects that field and potted plant tieback detection is limited by the planting period and the detection period is long, can simultaneously screen the pathogenicity of the root, stem, leaf, cotyledon and seed to the peanut rot pathogenic fungi, establishes a peanut anti-infection model, is beneficial to quickly identifying a large number of peanut disease-resistant germplasm resources, and has important significance on the research of peanut disease-resistant variety breeding and rot disease prevention and control.
The specific implementation mode is as follows:
terms used in the present invention have generally meanings as commonly understood by one of ordinary skill in the art, unless otherwise specified.
The present invention will be described in further detail with reference to the following data in conjunction with specific examples. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.
Example 1: separation, screening and purification of bacterial strain
Two materials with serious rot disease incidence are selected for flower cultivation 917 and 918 in the harvest period in the Qingdao Lexi peanut production test base, and 3 plants with the rot rate of more than 50% are respectively selected. Mixing the diseased fruits of 5 plants, placing into a sealing bag, storing at low temperature with a foam box containing an ice bag, taking back to the laboratory, and storing in a refrigerator at 4 deg.C for use.
The two peanut materials are respectively selected 5 diseased fruits at random as experimental materials, and three groups of repeated experiments are respectively carried out. All experimental procedures were performed aseptically. The diseased fruit was rinsed 5 times with sterile water, soil and surface attachments were removed, and then the shell was cut with sterile scissors on a clean bench with sterile filter paper to remove water. Cutting yellow and black semen kernel into 0.5cm pieces with sterilized blade, placing into a triangular flask containing 10mL of PDA liquid culture medium with pH6.5, shaking overnight at 25 deg.C and 180rpm in a shaking table, centrifuging at 3000g for 3min, and collecting supernatant according to 10%-1、10-3、10-5After gradient dilution, streaking and separation are carried out on a plate. Selecting single colonies with different forms, continuously streaking, purifying and culturing, wherein the purifying method comprises the steps of selecting the single colonies by using an inoculating needle, inoculating the single colonies into 10ml of liquid PDA culture medium with the pH value of 6.5, carrying out overnight culture at 25 ℃, centrifuging for 1 minute at 3000g, removing the liquid culture medium, then re-suspending the thalli by using 0.5ml of liquid PDA culture medium, and inoculating the thalli on 10 solid PDA culture media by using a scratching method to increase the purifying amount; until a pure culture is obtained. The pure cultured microorganisms are identified and classified by combining the traditional morphological identification method and the molecular biology identification method (ITS sequence sequencing). 5 strains were obtained which could be associated with peanut rot and were present in both peanut materials.
Pathogenicity experiments were performed on these 5 strains, respectively: pathogenicity experiments were performed on these 5 strains, respectively: selecting 40 susceptible peanut varieties and 5 isolated peanut tissues. The results show that: the PPRF-01 strain has high pathogenicity to 28 selected 40 infected varieties and pathogenicity to cotyledon, stem, root and fresh seed; the PPRF-02 strain has high pathogenicity on 25 selected 40 susceptible varieties and has pathogenicity on cotyledon, stem, root and fresh seed. The PPRF-03 strain has high pathogenicity on 22 selected susceptible varieties of 40 varieties and has pathogenicity on cotyledon, stem and fresh seed. The PPRF-04 strain has high pathogenicity to 32 selected 40 susceptible varieties and has pathogenicity to cotyledon, stem and root. Hs-f (PPRF-05) is a highly pathogenic strain, the pathogenic rate of 5 peanut tissues of 40 selected susceptible peanut varieties can reach 100%, the stem rot rate of a field inoculation experiment reaches more than 50%, the fruit rot rate reaches more than 50%, and the root rot rate reaches more than 30%.
Wherein Hs-f has the morphological characteristics that: the Fusarium oxysporum is cultured on a PDA culture medium plate, aerial hyphae are white and flocculent, a culture medium is changed from red to purple red in 30 days of culture, a plurality of loose flocculent sclerotia with the diameter of 1.5 mm are generated on aged hyphae, and two kinds of conidia, namely large sickle-shaped conidia and small elliptic conidia, are generated.
ITS sequencing of Hs-f: and selecting a single colony to perform ITS region PCR amplification detection, selecting a sample with a bright and single electrophoresis band, storing and sequencing. The sequencing results were submitted to the NCBI database for blastn comparison, and based on the results, sequence annotation was performed and submitted to GenBank for registration, seq id no: MH 368499. ITS ITS sequence was aligned to have 100% similarity to Fusarium oxysporum. The strain is identified as Fusarium sp by combining morphological characteristics, is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, has the unit address of No. 3 Siro 1 of Beijing, Chaoyang, and has the preservation date of 2019, 08 and 29 days and the preservation number of CGMCC No. 18130.
The ITS sequence of Hs-f is shown as follows:
SEQ ID No.1：
GATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTCAGAAGTT GGGGTTTAACGGCGTGGCCGCGACGATTACCAGTAACGAGGGTTTTACTACTACGCTAT GGAAGCTCGACGTGACCGCCAATCAATTTGAGGAACGCGAATTAACGCGAGTCCCAAC ACCAAGCTGTGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTG GCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTT TTGATTTATTTATGGTTTTACTCAGAAGTTACATATAGAAACAGAGTTTAGGGGTCCTCTG GCGGGCCGTCCCGTTTTACCGGGAGCGGGCTGATCCGCCGAGGCAACAAGTGGTATGTT CACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGG
example 2: rapid culture method of Hs-f
As the Hs-f strain grows slowly on the PDA solid culture medium and the spore production time is about 15 days, the subculture conditions of the Hs-f strain are improved.
First, a single colony was picked and inoculated into a 10ml centrifuge tube containing 5ml PDA liquid medium, and shake-cultured in a shaker at 25 ℃ and 180rpm for 8 h. Then 5ml of the culture solution is transferred into a triangular flask containing 50ml of PDA liquid culture medium, and the mixture is subjected to shake culture at the temperature of 25 ℃ and the rpm of 180 overnight. And finally, coating the enriched culture solution on a PDA culture medium plate with the diameter of 9cm, airing on a super clean bench, repeatedly coating twice, airing, and placing in an incubator for dark culture overnight at 25 ℃. And the pH of the PDA liquid medium used was 6.5. The pure cultures thus obtained were rapidly passaged to 50 generations, preserving strains with stable pathogenicity. And selecting strains with stable pathogenicity after 50 passages for preservation.
Provides a method for rapid and mass propagation for meeting the large demand of screening peanut disease-resistant germplasm on pathogenic fungi.
Firstly, activating the cryopreserved strain, inoculating 0.1ml of the cryopreserved strain into a 10ml centrifuge tube containing 5ml of PDA liquid culture medium, and performing shake culture in a shaking table at 25 ℃ and 180rpm for 8 h. Then 5ml of the culture solution is transferred into a triangular flask containing 50ml of PDA liquid culture medium, and the mixture is subjected to shake culture at the temperature of 25 ℃ and the rpm of 180 overnight. And finally, coating the enriched culture solution on a PDA culture medium plate with the diameter of 9cm, airing on a super clean bench, repeatedly coating twice, airing, and placing in an incubator for dark culture overnight at 25 ℃. The mycelium can be spread over the whole plate in 3-4 days by the method, and the growth vigor is good. Whereas it takes 15 days with the conventional culture method.
Example 3: hs-f strain pathogenicity identification method
Respectively sterilizing and washing susceptible fresh peanut seeds, peanut seedling root systems, peanut seedling stem parts, peanut seedling cotyledon and peanut leaf blades, carrying out minimally invasive treatment, placing the treated peanut seeds, peanut seedling root systems, peanut seedling cotyledon and peanut leaf blades into a culture dish, and inoculating corresponding pathogenic fungus mycelium blocks with the diameter of 0.3cm to realize co-culture of peanut tissues and pathogenic fungi. Culturing at 25 deg.C under 16h/8h for 7 days in a constant temperature incubator, wherein the infection pathogenic condition is observed and counted after 5 days: the inoculated fresh seeds and other tissues have yellow and black inoculated points to decay and spread.
Hs-f bacteria have strong pathogenicity on peanut tissues and fresh seeds, wherein the pathogenicity rate on fresh peanut seeds, seedling roots, seedling stems, seedling cotyledons and leaves exceeds 50%, and the Hs-f bacteria have strong pathogenicity.
The pathogenic bacteria have the following curative statistics on various peanut tissues:
TABLE 1 Hs-f pathogenicity to various tissues of peanut
| Tissue of | Pathogenicity |
| Fresh peanut seed | Over 80 percent |
| Root system of seedling | Over 50 percent |
| Stem of seedling | Over 80 percent |
| Seedling cotyledon | Over 90 percent |
| Peanut leaf | Over 50 percent |
The pathogenicity identification contrast test is carried out on the bacterium block cultured by the traditional method and the method, and the result shows that the pathogenicity of the bacterium block cultured for 4 days is stronger on peanut cotyledons than that of the bacterium block cultured for 15 days by the traditional method, and the lesion spots formed at the inoculation point are larger; the scab formed at the inoculation point is larger at the stem part of the peanut; compared with the traditional method, the pathogenicity of the fresh seeds, the peanut leaves and the peanut roots is not obviously changed.
The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.
Sequence listing
<110> institute for peanut research in Shandong province
Qingdao city environmental sanitation development center
<120> method for identifying pathogenicity of pathogenic fungi of peanut rot
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>519
<212>DNA
<213> Fusarium oxysporum (Fusarium sp)
<400>1
gatatgctta agttcagcgg gtattcctac ctgatccgag gtcaacattc agaagttggg 60
gtttaacggc gtggccgcga cgattaccag taacgagggt tttactacta cgctatggaa 120
gctcgacgtg accgccaatc aatttgagga acgcgaatta acgcgagtcc caacaccaag 180
ctgtgcttga gggttgaaat gacgctcgaa caggcatgcc cgccagaata ctggcgggcg 240
caatgtgcgt tcaaagattc gatgattcac tgaattctgc aattcacatt acttatcgca 300
ttttgctgcg ttcttcatcg atgccagaac caagagatcc gttgttgaaa gttttgattt 360
atttatggtt ttactcagaa gttacatata gaaacagagt ttaggggtcc tctggcgggc 420
cgtcccgttt taccgggagc gggctgatcc gccgaggcaa caagtggtat gttcacaggg 480
gtttgggagt tgtaaactcg gtaatgatcc ctccgcagg 519
Claims (10)
1. A method for identifying pathogenicity of peanut rot pathogenic fungi is characterized in that seeds and different tissues of susceptible peanut varieties are respectively disinfected, washed and subjected to minimally invasive treatment, and then a pathogenic fungi mycelium block is inoculated, so that the pathogenic fungi, the peanut seeds and the different tissues of peanuts are cultured together, and the infection pathogenic condition is observed after 5 days.
2. The method for identifying the pathogenicity of a pathogenic fungus of peanut rot disease according to claim 1, wherein the pathogenic fungus of peanut rot disease is fusarium oxysporum.
3. The method for identifying the pathogenicity of pathogenic fungi of peanut rot disease according to claim 2, wherein the fusarium oxysporum is fusarium oxysporum Hs-f, which is deposited in 29 th month 08 m 2019: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:18130 and an address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.
4. The method for identifying the pathogenicity of pathogenic fungi of peanut rot disease according to claim 3, wherein the Fusarium oxysporum Hs-f is cultured by the following method:
(1) activating strains: inoculating the frozen strains into 5ml of PDA liquid culture medium, and performing shake culture at 25 ℃ and 180rpm for 8 h;
(2) enrichment culture: transferring the activated 5ml culture solution into 50ml PDA liquid culture medium, and performing shake culture at 25 ℃ and 180rpm overnight;
(3) and (3) amplification culture: and (3) coating 1ml of the enrichment culture solution on a PDA culture medium plate, airing, repeatedly coating twice, airing, and performing dark culture at 25 ℃ overnight.
5. The method for identifying the pathogenicity of pathogenic fungi of peanut rot disease according to claim 4, wherein the cryopreserved strain is a strain with stable pathogenicity, which is preserved by a single colony which is separated and purified and is rapidly passaged to 50 generations;
the rapid passage is as follows:
(1) selecting a single colony, inoculating the single colony in 5ml of PDA liquid culture medium, and performing shake culture at 25 ℃ and 180rpm for 8 hours;
(2) taking 5ml of the culture solution in the step (1), transferring the culture solution into 50ml of PDA liquid culture medium, and performing shake culture at 25 ℃ and 180rpm overnight;
(3) finally, coating the culture solution in the step (2) on a PDA culture medium plate, drying in the air, repeatedly coating twice, and performing dark culture at 25 ℃ overnight after drying in the air;
(4) repeating the steps (1) to (3) to passage to 50 generations.
6. The method for identifying the pathogenicity of pathogenic fungi causing peanut rot disease according to claim 1, wherein the susceptible peanut variety is Huayu No. 20.
7. The method for identifying the pathogenicity of pathogenic fungi causing peanut rot disease according to claim 1, wherein the different tissues of the peanut are peanut seedling root system, peanut seedling stem part, peanut seedling cotyledon and peanut leaf.
8. The method for identifying the pathogenicity of pathogenic fungi of peanut rot disease according to claim 1, wherein the conditions for co-culturing the pathogenic fungi with peanut seeds and different tissues of peanuts are as follows: culturing at 25 deg.C under 16h/8h for 7 days in a constant temperature incubator.
9. The method for identifying the pathogenicity of pathogenic fungi of peanut rot according to claim 1, wherein the inoculation amount of the mycelium block of the pathogenic fungi is a cylindrical block with a diameter of 0.3 cm.
10. The method for identifying the pathogenicity of pathogenic fungi of peanut rot disease according to claim 1, wherein the judgment standard of the pathogenicity is from yellowing and blackening of an inoculation point to spreading of rot.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911088363.4A CN110669819A (en) | 2019-11-08 | 2019-11-08 | Method for identifying pathogenicity of peanut rot pathogenic fungi |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911088363.4A CN110669819A (en) | 2019-11-08 | 2019-11-08 | Method for identifying pathogenicity of peanut rot pathogenic fungi |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110669819A true CN110669819A (en) | 2020-01-10 |
Family
ID=69086631
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911088363.4A Pending CN110669819A (en) | 2019-11-08 | 2019-11-08 | Method for identifying pathogenicity of peanut rot pathogenic fungi |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110669819A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112899342A (en) * | 2021-04-14 | 2021-06-04 | 鲁东大学 | Method for identifying pathogenicity of peanut kernel rot |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104711317A (en) * | 2014-12-12 | 2015-06-17 | 山东省花生研究所 | Identification method for pathogenicity of peanut pod rot pathogens |
| CN104711316A (en) * | 2014-12-12 | 2015-06-17 | 山东省花生研究所 | Identification method for peanut rod rot resistance of peanut germplasm resources |
-
2019
- 2019-11-08 CN CN201911088363.4A patent/CN110669819A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104711317A (en) * | 2014-12-12 | 2015-06-17 | 山东省花生研究所 | Identification method for pathogenicity of peanut pod rot pathogens |
| CN104711316A (en) * | 2014-12-12 | 2015-06-17 | 山东省花生研究所 | Identification method for peanut rod rot resistance of peanut germplasm resources |
Non-Patent Citations (2)
| Title |
|---|
| 张成玲等: "花生果腐病病菌鉴定及生物学特性", 《花生学报》 * |
| 李术臣等: "河北省花生果腐病病原鉴定及致病性研究", 《河北农业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112899342A (en) * | 2021-04-14 | 2021-06-04 | 鲁东大学 | Method for identifying pathogenicity of peanut kernel rot |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112342173B (en) | Bacillus belgii and application thereof | |
| CN111073827B (en) | Bacillus beilesensis JTB8-2 and application thereof in biological control of orobanche meloidogyne | |
| CN110305796B (en) | Aspergillus flavus PAF-1 incapable of producing aflatoxin and application thereof | |
| CN109749953B (en) | Bacillus cereus, microbial inoculum and preparation method and application thereof | |
| CN110616157B (en) | Fusarium oxysporum and application thereof | |
| CN110129212B (en) | Aspergillus flavus PEAS-10 without producing aflatoxin and application thereof | |
| CN113862156B (en) | Fusarium oxysporum (Fusarium oxysporum) K2018-1418 and application thereof | |
| CN114806896A (en) | Alternaria alternata, herbicide and application thereof | |
| CN112280709B (en) | Streptomyces and streptomyces secondary metabolite Nanchangmycin and preparation method and application thereof | |
| CN111363691B (en) | Paenibacillus polymyxa and application thereof | |
| CN110643551B (en) | Stenotrophomonas rhizophila S11 for preventing and treating rice blast and application thereof | |
| CN109735457B (en) | Mutant eurotium cristatum and application thereof in preventing and controlling barnyard grass | |
| CN115960777B (en) | Bacillus pseudomycoides and application thereof in prevention and treatment of vegetable epidemic disease | |
| CN109055265B (en) | Biocontrol bacterium and application thereof in prevention and control of gummy stem blight of crops | |
| CN108587969B (en) | Preparation and application of verticillium dahliae strain HCX-01 capable of preventing and treating cotton verticillium wilt | |
| CN108441443B (en) | Strain for preventing and treating plant nematodes and application thereof | |
| CN110669819A (en) | Method for identifying pathogenicity of peanut rot pathogenic fungi | |
| CN114032182B (en) | Fungus with functions of antagonizing pathogenic bacteria of garlic root rot and promoting growth | |
| CN116240126A (en) | Multifunctional bacillus belgium SB10 and application thereof | |
| CN107325973B (en) | Beauveria bassiana strain with strong pathogenicity on corylus avenae sinensis and application thereof | |
| CN112063558B (en) | Pseudomonas strain and application thereof | |
| CN110699264B (en) | Rapid culture method of pathogenic fungi of peanut rot | |
| CN111454848B (en) | Actinomucor elegans GD48, fermentation product, microbial inoculum and application thereof | |
| CN110982764A (en) | Bacillus tequilensis S12 for preventing and treating rice blast and application thereof | |
| CN114107132B (en) | Bacillus subtilis strain HM-1 and microbial agent and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200110 |
|
| RJ01 | Rejection of invention patent application after publication |