CN115927052A

CN115927052A - Bacillus belgii, microbial agent and application thereof

Info

Publication number: CN115927052A
Application number: CN202210880615.2A
Authority: CN
Inventors: 陈捷胤; 王丹; 戴小枫; 宋健; 张丹丹; 李冉; 孔志强; 刘晓炜
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2022-07-25
Filing date: 2022-07-25
Publication date: 2023-04-07

Abstract

The disclosure relates to a Bacillus belgii, which is classified and named as Bacillus belgii Bacillus velezensis, and the preservation number of the Bacillus belgii is CGMCC No.24931. The strain can effectively prevent and treat the blight of flowers and provides a new direction for preventing and treating plant diseases and insect pests.

Description

Bacillus belgii, microbial agent and application thereof

Technical Field

The application belongs to the technical field of microorganisms, and particularly relates to bacillus beiLeisi, a microbial agent and application thereof.

Background

The planting mode of the fresh cut flowers is continuous cropping and continuous cropping, so that the soil fertility is easy to decline, the nutrition is unbalanced, the incidence rate of plant diseases and insect pests is increased year by year, wherein the quality and the yield of the flowers are seriously influenced by the blight of the flowers caused by Fusarium oxysporum (Fusarium oxysporum). The blight is a soil-borne vascular bundle disease, can be harmful in the whole growth period of the gerbera jamesonii, causes large-area dead seedlings of flowers, even dead birth, and seriously influences the continuous and steady development of the flower industry. At present, main prevention and control measures for flower blight mainly adopt chemical pesticides as main materials, reasonable cultivation measures are matched, field management is enhanced, and comprehensive prevention and control are carried out, but the long-term use of the chemical pesticides causes reduction of beneficial microorganisms in soil and increase of drug resistance of pathogenic bacteria, and meanwhile, the main prevention and control measures have the defects of high cost, harm to natural environment and the like.

With the development of science and technology and the improvement of living standard, the demands of people on green agriculture and organic agriculture are more prominent, biological control is pushed to the stage of the times, and the biological control becomes a new measure for controlling plant diseases and insect pests and also indicates a new direction for controlling flower blight. At present, biological control research on blight of other economic crops has achieved certain effect, but the application of the biological control research on the blight of other economic crops in actual flower production is rarely reported.

Disclosure of Invention

In order to meet the actual needs, the disclosure provides bacillus belvesii, a microbial agent and application thereof in preventing and treating flower blight.

In one aspect, the disclosure provides a Bacillus belgii, which is classified and named as Bacillus belgii Bacillus velezensis, and the preservation number is CGMCC No.24931.

According to the disclosure, the gyrB sequence of Bacillus belgii is shown in SEQ ID No. 1.

In another aspect, the present disclosure provides a microbial agent, wherein, optionally, the microbial agent comprises 60-90 parts by weight of bacillus beijerinckii powder, 5-20 parts by weight of dispersing agent, 5-15 parts by weight of wetting agent, 1-15 parts by weight of suspending agent, and 1-10 parts by weight of protective agent.

Preferably, the microbial agent comprises 70-80 parts by weight of bacillus belief strain powder, 10-20 parts by weight of a dispersing agent, 5-10 parts by weight of a wetting agent, 3-10 parts by weight of a suspending agent and 1-5 parts by weight of a protective agent.

According to the disclosure, the bacterial powder of bacillus beleisi is prepared by a method comprising the following steps:

s1, inoculating the Bacillus beiLeisi in the first aspect of the disclosure into an LB culture medium for shake flask culture to obtain a Bacillus beiLeisi fermentation liquid;

and S2, mixing the diatomite carrier with the Bacillus beiLeisi fermentation liquor, drying and crushing to obtain the Bacillus beiLeisi powder.

According to the present disclosure, wherein the shake flask culture conditions comprise: shaking culture at 150-250rpm at 25-30 deg.C for 40-60 hr.

According to the disclosure, the LB medium contains 4-6g/L yeast extract, 9-11g/L tryptone, 9-11g/L NaCl, 0.2-0.4g/L potassium humate, 1.4-1.6g/L composite amino acid powder, and 0.05-0.15mL/L defoamer.

According to the disclosure, wherein the Bacillus beleisis content is (0.8-1). Times.10 ¹⁰ CFU/mL。

On the other hand, the disclosure provides the application of the bacillus belgii and/or the microbial agent in preventing and treating flower blight.

According to the present disclosure, wherein the flower comprises at least one of gerbera jamesonii, feverfew, multi-headed chrysanthemum, rose, lily.

Through the technical scheme, the Bacillus belvesii is obtained, and the strain can be used for effectively preventing and treating flower blight and provides a new direction for preventing and treating plant diseases and insect pests.

Additional features and advantages of the disclosure will be set forth in the detailed description which follows.

Biological material preservation information

The Bacillus belgii KRS001 is classified and named as Bacillus belgii velezensis, is preserved in the China general microbiological culture Collection center of the culture Collection of microorganisms with the preservation address: the microbiological research institute of western road No.1, 3, national academy of sciences, north-kyo, the rising area, the preservation date: in 2022, 5 and 19 days, the preservation number of the strains is as follows: CGMCC No.24931.

Drawings

FIG. 1 is a graph of the effect of administration of microbial agents of the present disclosure on African daisy wilt disease.

FIG. 2 is the effect of the control group on the administration of African daisy wilt disease.

Detailed Description

The following detailed description of specific embodiments of the present disclosure is provided in connection with the accompanying drawings. It should be understood that the detailed description and specific examples, while indicating the present disclosure, are given by way of illustration and explanation only, not limitation.

In one aspect, the disclosure provides a Bacillus belgii, the classification of the strain is named as Bacillus belgii velezensis, and the preservation number is CGMCC No.24931.

Optionally, the gyrB sequence of Bacillus belgii is shown in SEQ ID No. 1.

In another aspect, the present disclosure provides a microbial agent, wherein the microbial agent includes 60 to 90 parts by weight of bacillus belgii powder, 5 to 20 parts by weight of a dispersing agent, 5 to 15 parts by weight of a wetting agent, 1 to 15 parts by weight of a suspending agent, and 1 to 10 parts by weight of a protective agent.

Preferably, the microbial agent comprises 70-80 parts by weight of bacillus belvesii powder, 10-20 parts by weight of a dispersing agent, 5-10 parts by weight of a wetting agent, 3-10 parts by weight of a suspending agent and 1-5 parts by weight of a protective agent.

More preferably, the microbial agent comprises 70-75 parts by weight of bacillus belief strain powder, 10-15 parts by weight of a dispersing agent, 5-8 parts by weight of a wetting agent, 3-5 parts by weight of a suspending agent and 1-3 parts by weight of a protective agent.

Optionally, the dispersing agent is selected from any one of sodium lignosulfonate, sodium carboxymethylcellulose and saponin powder; the wetting agent is selected from any one of polyethylene glycol, sodium dodecyl sulfate and tween-80; the suspending agent is selected from any one of Langtian titanium LT676, langtian titanium EF96 and Langtian titanium LTQ 661; the protective agent is any one of ascorbic acid (VC), humic acid and cyclodextrin.

Optionally, the bacterial powder of bacillus belgii is prepared by a method comprising the following steps:

s1, inoculating the Bacillus belgii into an LB culture medium for shake flask culture to obtain a Bacillus belgii fermentation liquor;

Optionally, the shake flask culture conditions comprise: shaking and culturing at 150-250rpm at 25-30 deg.C for 40-60 hr.

Optionally, the LB culture medium contains 4-6g/L yeast extract, 9-11g/L tryptone, 9-11g/L NaCl, 0.2-0.4g/L potassium humate, 1.4-1.6g/L composite amino acid powder and 0.05-0.15mL/L defoaming agent.

Optionally, the Bacillus belgii is present in an amount of (0.8-1). Times.10 ¹⁰ CFU/mL；

In another aspect, the present disclosure provides the use of the bacillus belvesii of the first aspect and/or the microbial agent of the second aspect for controlling flower blight.

Optionally, the flower comprises at least one of a gerbera, a feverfew, a multi-headed chrysanthemum, a rose, and a lily.

The present disclosure is further illustrated by the following examples. The raw materials used in the examples are all available from commercial sources.

Example 1

Isolation and identification of bacterial species

The Bacillus belgii KRS001 is separated from Xinjiang healthy cotton field soil by a gradient dilution method, and the specific separation method comprises the following steps: weighing 1g of shady and air-dried soil of the root of healthy Xinjiang cotton field plants, pouring the soil into a 50mL sterile centrifuge tube, adding 10mL sterile water, carrying out vortex oscillation, and continuing oscillation for 2 hours on a 200rpm/min shaking table; standing for 10min, collecting the upper suspension, diluting to 10 suspension, collecting 6 sterile 50mL centrifuge tubes, adding 9mL sterile water, and collecting 1mL 10 ¹ The suspension is put into a 9mL sterile water centrifuge tube to obtain gradient dilution to 10 ² The suspension of (2); by analogy, respectively obtaining the gradient dilution to 10 ³ 、10 ⁴ 、10 ⁵ 、10 ⁶ The suspension of (a); respectively coating 50 μ L of the gradient suspension on an LB plate, performing static culture in an incubator at 28 ℃, and observing after 24 h; selecting strains of single colonies with different forms, carrying out three-generation rotating plate separation to obtain purified strains, wherein one strain is named as KRS001.

Carrying out amplification and sequencing on gyrB gene fragments of the separated and purified strain KRS001, and specifically comprising the following steps: KRS001 strain was cultured in LB liquid medium (formulation of LB liquid medium: 5g/L yeast extract, 10g/L tryptone, 10g/L NaCl, 0.3 g/L98 wt% potassium humate, 1.5g/L composite amino acid powder, 0.15mL/L antifoaming agent; shaking table) at 200rpm/min and 28 ℃ for 24 hours, centrifuged at 10000rpm/min for 1min, collected and extracted with genomic DNA, amplified with gyrB gene universal primers using the extracted genomic DNA as a template, and the PCR product was sent to a manufacturer for sequencing, as shown in SEQ ID NO.1, and identified as Bacillus velezensis (Bacillus velezensis) by BLAST comparison at NCBI.

SEQ ID NO.1

AACGGGAAGCGGGATATAAGTGTCCGGCGGTCTTCACGGTGTAGGGGCGTCTGTCGTAAACGCCTTGTCGACCACTCTTGACGTTACGGTTCATCGTGACGGAAAAATCCACTATCAGGCGTACGAGCGCGGTGTACCTGTGGCCGATCTTGAAGTGATCGGTGATACTGATAAGACCGGAACGATTACGCACTTCGTTCCGGATCCGGAAATTTTCAAAGAAACAACCGAATACGACTATGACCTGCTTTCAAACCGTGTCCGGGAATTGGCCTTCCTGACAAAAGGCGTAAACATCACGATTGAAGACAAACGTGAAGGACAAGAACGGAAAAACAAGTACCACTACGAAGGCGGAATCAAAAGCTATGTTGAGTACTTAAACCGTTCCAAAGAAGTCGTTCATGAAGAGCCGATTTATATCGAAGGCGAGAAAGACGGGATAACGGTTGAAGTTGCATTGCAATACAACGACAGCTATACAAGCAATATTTATTCTTTCACAAATAATATCAACACATACGAAGGCGGCACGCACGAAGCCGGATTTAAAACCGGTCTGACCCGTGTCATAAACGACTATGCAAGAAGAAAAGGGATTTTCAAAGAAAATGATCCGAATTTAAGCGGGGATGATGTGAGAGAAGGGCTGACTGCCATTATTTCAATTAAGCATCCTGATCCGCAATTCGAAGGTCAGACGAAAACGAAGCTCGGCAACTCCGAAGCGAGAACGATCACTGACACGCTGTTTTCTTCTGCGCTGGAAACATTCCTTCTTGAAAATCCGGACTCAGCCCGCAAAATCGTTGAAAAAGGTTTAATGGCCGCAAGAGCGCGGATGGCAGCGAAAAAAGCGCGGGAATTGACCCGCCGCAAAAGTGCGCTTGAGATTTCCAATCTGCCGGGCAAACTGGCGGACTGTTCTTCTAAAGATCCGAGCATTTCCGAGCTGTATATCGTAGAGGGTGACTCTGCGGGCGGATCAGCGAAACAGGGACGGGACCGTCATTTCCAAGCCATTCTGCCGCTGCGCGGTAAGATTCTGAACGTTGAGAAAGCCAGACTTGATAAGATTCTCTCAAACAATGAGGTCAGATCAATGATCACGGCCCTCGGAACGAGGAATCGGAGAAGATTTTAATCTGAAAAAGCGCGTTATCATAGTCAGTGTCAT

Example 2

This example was used to determine the bacteriostatic effect of the strain KRS001 against different pathogenic fungi.

The plate confronting method is used for determining the bacteriostatic effect of the separated and purified strain KRS001 on different pathogenic fungi: a microorganism (i.e., verticillium dahliae), fusarium oxysporum (Fusarium oxysporum), fusarium graminearum (Fusarium graminearum), magnaporthe oryzae (Magnaporthe oryzae), botrytis cinerea (Botrytis cinerea) and Colletotrichum gloeosporioides (Colletotrichum gloesproides) stored in glycerol at-80 ℃ were activated on a PDA plate, 8mm of a cake was punched from the edge of the colony by a sterile punch and transferred to a new PDA plate, KRS001 broth was streaked at a distance of 3cm from the cake, and the radius of the bacterial spot was observed and counted after 3 to 5 days, a control group (blank LB broth treatment was used as a control, the medium components were as in example 1), the radius of the bacterial spot was a, the radius of the treatment group was b, and the ratio was calculated by the following formula, and the specific results are shown in Table 1:

the bacteriostatic rate (%) = [ (a-b) × 100/a ] × 100%.

TABLE 1 bacteriostatic effect of Bacillus belgii KRS001 on different pathogenic fungi

Pathogenic bacteria for test	Inhibition rate/%)
		Verticillium dahliae	100％
Fusarium oxysporum	92.34±5.2％
		Fusarium graminearum	89.33±1.55％
Magnaporthe oryzae	100％
		Botrytis cinerea (Botrytis cinerea)	99.52±0.03％
Colletotrichum gloesporioides	79.72±3.67％

Example 3

Preparation of KRS001 microbial agent: (1) Selecting a single colony of KRS001 strain, inoculating the single colony in LB liquid culture medium, and shaking at 200rpm at 28 ℃ overnight to obtain a seed solution; (2) Inoculating the seed liquid into an LB liquid culture medium according to the inoculation amount of 1 percent for carrying out amplification culture for 2 days, wherein the culture conditions are 200rpm and constant temperature shaking at 28 ℃, and the formula of the LB liquid culture medium used in the method is the same as that of the example 1; (3) Mixing the fermentation liquor and diatomite until no obvious liquid is separated out in a short time, and then drying the mixture in an air drying oven at 45 ℃ until the weight is unchanged for 5 times continuously; (4) Crushing the dried substances by using a jet mill to obtain bacterial powder of bacillus beilesiensis; (5) And (2) mixing 74 parts by weight of the bacterial powder with 5 parts by weight of wetting agent sodium dodecyl sulfate, 3 parts by weight of suspending agent sodium titanyl EF96 (purchased from Shenzhen titanium biotechnologies Limited), 15 parts by weight of dispersing agent sodium lignosulfonate and 1 part by weight of protective agent ascorbic acid VC, and uniformly mixing the mixture by using an airflow pulverizer to obtain the KRS001 microbial agent.

The KRS001 microbial inoculum has the following effects that the KRS001 microbial inoculum is applied to a greenhouse plot with high incidence of African chrysanthemum wilt disease in Sanming City of Fujian province:

before use, cleaning environmental plant residues on high-incidence plots of African daisy blight, carrying out rotary tillage and soil turning for 30cm, exposing for 7 days, after the planting density is determined, intensively applying 300 times of microbial agents on leveled soil according to row spacing and 2 days before flowers are transplanted by adopting a drip irrigation technology to form strip fertilization belts, wherein the width of each fertilization belt is not less than 50cm, the fertilization depth is not less than 60cm, 200 times of microbial agents can be used for dipping roots before bare-root flower seedlings are planted, transplanting is carried out after the bare-root flower seedlings are planted, the flower flowering period is subjected to drip irrigation once in 2-3 months according to the planting conditions, and the application effect statistics shows that the disease incidence rate of each crop of African daisy plants is reduced to 13.2% from about 80% before; the number of cut flowers on an African daisy plant has been increased from about 25-28 to about 32-40 per year before.

In conclusion, the Bacillus belgii and the microbial agent provided by the disclosure can effectively reduce the morbidity of the gerbera jamesonii plant and promote the growth of the gerbera jamesonii plant.

The preferred embodiments of the present disclosure have been described in detail above, however, the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present disclosure within the technical idea of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

It should be noted that the various features described in the above embodiments may be combined in any suitable manner without departing from the scope of the invention. In order to avoid unnecessary repetition, various possible combinations will not be separately described in this disclosure.

In addition, any combination of various embodiments of the present disclosure may be made, and the same should be considered as the disclosure of the present disclosure, as long as it does not depart from the spirit of the present disclosure.

Claims

1. The Bacillus belgii is characterized in that the Bacillus belgii is classified and named as Bacillus velezensis, and the preservation number is CGMCC No.24931.

2. The Bacillus belgii of claim 1, wherein the gyrB sequence of the Bacillus belgii is set forth in SEQ ID No. 1.

3. The microbial agent is characterized by comprising 60-90 parts by weight of bacillus belief powder, 5-20 parts by weight of a dispersing agent, 5-15 parts by weight of a wetting agent, 1-15 parts by weight of a suspending agent and 1-10 parts by weight of a protective agent.

4. The microbial agent according to claim 3, wherein the microbial agent comprises 70-80 parts by weight of Bacillus belgii powder, 10-20 parts by weight of a dispersing agent, 5-10 parts by weight of a wetting agent, 3-10 parts by weight of a suspending agent and 1-5 parts by weight of a protective agent.

5. The microbial agent according to claim 3 or 4, wherein the bacterial powder of Bacillus belgii is prepared by a method comprising the following steps:

s1, inoculating the Bacillus beiLeisi of any one of claims 1-2 in an LB culture medium for shake flask culture to obtain a Bacillus beiLeisi fermentation liquor;

6. The microbial inoculant of claim 5, wherein the shake flask culture conditions comprise: shaking and culturing at 150-250rpm at 25-30 deg.C for 40-60 hr.

7. The microbial inoculum according to claim 5, wherein the LB culture medium contains 4-6g/L yeast extract, 9-11g/L tryptone, 9-11g/L NaCl, 0.2-0.4g/L potassium humate, 1.4-1.6g/L composite amino acid powder and 0.05-0.15mL/L defoaming agent.

8. The microbial agent according to claim 3, wherein the content of Bacillus beleisi is (0.8-1). Times.10 ¹⁰ CFU/mL。

9. Use of the bacillus beijerinckii according to any one of claims 1 to 2 and/or the microbial agent according to any one of claims 3 to 8 for controlling flower blight.

10. The use of claim 9, wherein the flower comprises at least one of an african chrysanthemum, a white chrysanthemum, a multi-headed chrysanthemum, a rose, and a lily.