CN110074140A - A kind of biocontrol agent, preparation method and application producing malicious aspergillus flavus - Google Patents
A kind of biocontrol agent, preparation method and application producing malicious aspergillus flavus Download PDFInfo
- Publication number
- CN110074140A CN110074140A CN201910452636.2A CN201910452636A CN110074140A CN 110074140 A CN110074140 A CN 110074140A CN 201910452636 A CN201910452636 A CN 201910452636A CN 110074140 A CN110074140 A CN 110074140A
- Authority
- CN
- China
- Prior art keywords
- aspergillus flavus
- biocontrol agent
- peanut
- malicious
- aflatoxin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N3/00—Spore forming or isolating processes
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- Mycology (AREA)
- Biomedical Technology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Agronomy & Crop Science (AREA)
- Plant Pathology (AREA)
- Pest Control & Pesticides (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of biocontrol agent, preparation method and applications for producing malicious aspergillus flavus, belong to harmful microorganism biocontrol agent technical field.The present invention produces the biocontrol agent of malicious aspergillus flavus, and effective component is not produce the Aspergillus flavus PEAS-10 of aflatoxin and do not produce the Aspergillus flavus PAF-1 of aflatoxin；Aspergillus flavus strain in biocontrol agent of the present invention being capable of fast-growth, breeding in field, and can efficiently inhibit to produce malicious aspergillus flavus growth and breeding and produce poison, peanut disease can be significantly reduced, the Aflatoxin in Peanut byHigh content of harvest is few, peanut storage period is long, relative to the processing of single microbial inoculum, excellent effect.
Description
Technical field
The invention belongs to harmful microorganism biocontrol agent technical fields, and in particular to a kind of biocontrol microorganisms for producing malicious aspergillus flavus
Agent, preparation method and application.
Background technique
Aflatoxin is the metabolite of aspergillus flavus and aspergillus parasiticus.A large amount of experimental data shows aflatoxin
The mankind and many animals can be made to induce experimental hepatocellular carcinoma, be the strongest chemical carcinogen having now been found that, compare dimethyl nitrite
Amine induced hepatocellular carcinoma ability is 75 times big.Aflatoxin or a kind of violent in toxicity, acute toxicity are 68 times of arsenic, potassium cyanide
10 times, liver can be made to be badly damaged and cause death in a short time.
Peanut is the crops for being easiest to infection Aspergillus flavus.It is yellow to be likely to infection in the overall process of growth for peanut
Aspergillus, especially at later stages, better than the variation of temperature, humidity, the harm etc. of disease pest mouse is destroyed the kind skin of peanut
The pollution of Aspergillus flavus can all be aggravated afterwards.It is influenced after harvesting peanut by temperature, air humidity and condition of storage, it is easier to incur Huang Qu
Mycotic infection.Aspergillus flavus will generate a large amount of toxin (mainly yellow aspergillus poison B1) in breeding and metabolic processes,
Pollute peanut and its product.It has been established that, in the peanut and peanut oil, peanut beverage, peanut butter of improper storage, is likely to
There are this toxin.Due to the pollution of Aspergillus flavus, the growth of peanut also suffers from inhibition, causes the underproduction of peanut, and the underproduction reaches
10% or so.
Aflatoxin pollution of peanuts pollutes after polluting and harvest before mainly having harvesting peanut.Peanut before harvest be easy by
To infecting for aspergillus flavus, research shows that soil is the main source of aspergillus flavus bacterium, aspergillus flavus and soil in peanut pod
In aspergillus flavus have a direct connection, therefore in order to effectively prevent, reduce the pollution of peanut aflatoxin, research peanut is yellow
The crop field biology prevention and control of aspergillus pollution have very important significance.
Biological prevention and control (Biocontrol) aflatoxin refers to biology and its generation using beneficial (or at least harmless)
It thanks to product to change the layout of microorganism, inhibit the growth of toxigenic bacterium strain or inhibits the synthesis of its toxin, to reach reduction
The level of agricultural product aflatoxin；Either by bioadhesion, degradation the effects of, absorption, aflatoxin degradation reach
To the purpose of removal aflatoxin.Compared to other processing methods, biological prevention and control are easy to operate, do not destroy the original product of agricultural product
Matter has safe and efficient, advantages of environment protection, represents the new direction of aflatoxin green control.
The control in field of aspergillus flavus bacterium pollution mainly in peanut late growth stage, guarantees water during peanut pod development
Divide supply, avoid arid before harvesting that the rupture of kind of skin is caused to increase the infection chance of Aspergillus flavus, avoids other diseases, worms and mouse
Harmful generation avoids ploughing and pod is caused to damage in fruiting period and shell development phase.It dries pod in time after harvesting, makes water content
Lower than 5%, resistant new peanut variety etc. is screened.But since the viability of Aspergillus flavus is strong, the spore of generation can be supported
Resist a variety of severe natural conditions, can not thoroughly avoid the infection of Aspergillus flavus.
It is separated from soil at present and does not produce malicious Aspergillus flavus, only carried out inhibiting to produce malicious Aspergillus flavus growth in laboratory
Research, also without carrying out field experiment research.Presently, there are some biocontrol microorganisms to be not suitable for field growing, does not grow in field excellent
Gesture does not have the effect for inhibiting to produce malicious Aspergillus flavus.Moreover, single microbial inoculum there is a problem of bad adaptability, control efficiency difference.
Summary of the invention
Aiming at the problems existing in the prior art, the purpose of the present invention is to provide a kind of compound biocontrol fungicide, the microbial inoculums
Field can fast-growth, breeding, and can efficiently inhibit to produce malicious aspergillus flavus growth and breeding and produce poison, relative to list
The processing of one microbial inoculum, excellent effect.
In order to achieve the above object, the technical solution of the present invention is as follows:
A kind of biocontrol agent producing malicious aspergillus flavus, effective component is the Aspergillus flavus PEAS-10 for not producing aflatoxin
The Aspergillus flavus PAF-1 of aflatoxin is not produced；
The Aspergillus flavus PEAS-10 of the not toxin producing was preserved on 08 01st, 2018: Chinese microorganism strain is protected
Administration committee's common micro-organisms center is hidden, deposit number is CGMCC NO:15997, address are as follows: Chaoyang District, Beijing City North Star west
The institute 3 of road 1, request depositary institution are Shandong Peanut Inst.；
The Aspergillus flavus PAF-1 of the not toxin producing was preserved in: Chinese microorganism strain preservation on 08 01st, 2018
Administration committee's common micro-organisms center, deposit number are CGMCC NO:15996, address are as follows: BeiChen West Road, Chaoyang District, BeiJing City
No. 1 institute 3, request depositary institution are Shandong Peanut Inst..
On the basis of above scheme, the spore of the Aspergillus flavus PEAS-10 of aflatoxin is not produced in the biocontrol agent
Subnumber amount >=108A/g；Spore quantity >=10 of the Aspergillus flavus PAF-1 of aflatoxin are not produced8A/g.
On the basis of above scheme, the preparation method of the biocontrol agent for producing malicious aspergillus flavus, step are as follows:
(1) bacterial strain is seeded in respectively on MEA culture medium, 30 DEG C are cultivated 3-5 days, until generating yellow green spore；
(2) on the microbial inoculum culture medium after the atoxigenic aspergillus flavus strain after activation to be inoculated into sterilizing respectively, 30 DEG C of trainings
It supports 5-8 days, rocks daily once, grow Aspergillus flavus on culture medium uniformly；After culture, Aspergillus flavus spore quantity >=
108A/g culture medium；
(3) by a certain percentage by the culture medium of cultured PEAS-10 containing Aspergillus flavus and Aspergillus flavus PAF-1 in (2)
Mixing, the spore count ratio of most latter two bacterial strain are PEAS-10: PAF-1=1: 2-2: 7 to get the biocontrol microorganisms for producing malicious aspergillus flavus
Agent, preservation under room temperature.
On the basis of above scheme, Aspergillus flavus PEAS-10 and Aspergillus flavus in the biocontrol agent of malicious aspergillus flavus are produced
The mixing ratio of the spore of PAF-1 is 1: 3.
On the basis of above scheme, the microbial inoculum culture medium is made of following methods:
Peanut red coat is crushed to 0.5 × 0.5cm or so size, by the mass ratio 1: 1-2: 3 of peanut red coat and distilled water
Ratio mixing, while be added mass percent be 1%-1.5%CaCl2, 121 DEG C of sterilizing 20min.
The purposes of the biocontrol agent of the malicious aspergillus flavus of production of above method preparation, for inhibit Aspergillus flavus to grow and produce poison,
Aflatoxin in agricultural product when reducing corps diseases, the utilization rate for improving organic fertilizer, improving crop yield, reduce harvest
Content extends agricultural product storage period.
On the basis of above scheme, the crops are peanut or corn.
A method of inhibiting Aspergillus flavus growth and produce poison, is harvested first 1 month to crop, production prepared by the above method
Malicious aspergillus flavus biocontrol agent, is spread at crop rhizosphere with 30kg/ mus.
A method of corps diseases are reduced, the utilization rate of organic fertilizer is improved or improves crop yield, to crop harvesting
It obtains first 1 month, production poison aspergillus flavus biocontrol agent prepared by the above method is spread at crop rhizosphere with 30kg/ mus.
A method of reduce harvest when agricultural product in aflatoxin content or extend agricultural product storage period, to crop harvesting
It obtains first 1 month, production poison aspergillus flavus biocontrol agent prepared by the above method is spread at crop rhizosphere with 30kg/ mus, is received in due course
It obtains, sunning is placed on dry shady place storage.
The advantages of technical solution of the present invention:
Not producing the aspergillus flavus strain of aflatoxin in compound biocontrol fungicide of the invention being capable of fast-growth, numerous in field
It grows, and can efficiently inhibit to produce the growth of malicious aspergillus flavus and breeding and produce poison, prevention and control aflatoxin contamination effect in field is aobvious
It writes, handles peanut using biocontrol agent of the present invention, there is significant preventive effect to peanut root rot, stem rot；Treated, and peanut is received
After obtaining, aflatoxin content is few, is able to extend peanut storage period.Relative to the processing of single microbial inoculum, excellent effect.
Detailed description of the invention
The measurement of aflatoxin content in Fig. 1 bacterial strain PAF-1 fermentation liquid；
The measurement of aflatoxin content in Fig. 2 bacterial strain PEAS-10 fermentation liquid.
Specific embodiment
Term as used in the present invention generally has those of ordinary skill in the art usual unless otherwise specified
The meaning of understanding.
Combined with specific embodiments below, and referring to the data further detailed description present invention.Following embodiment only be
It illustrates the present invention, rather than limits the scope of the invention in any way.
The Aspergillus flavus of not toxin producing of the invention is Aspergillus flavus (Aspergillus flavus) PEAS-10, in
Be preserved on 08 01st, 2018: China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number are
CGMCCNO:15997, address are as follows: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, request depositary institution are that Shandong Province's peanut is ground
Study carefully institute.
The Aspergillus flavus of not toxin producing of the invention is Aspergillus flavus (Aspergillus flavus) PAF-1, in 2018
Year is preserved in for 01 day 08 month: China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number CGMCC
NO:15996, address are as follows: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, request depositary institution are Shandong Peanut Inst..
The acquisition of embodiment 1 bacterial strain PEAS-10 and PAF-1
One, bacterial strain isolating and purifying and identifies
1, sample acquires: in peanut cultivation (sampling time 2018.05, sampling position are respectively Sichuan Province's Nanchong City
The village Tang Cunba, the Jialing District township Tu Men and Qingdao of Shandong province Laixi City Wangcheng subdistrict office) acquisition sample, each sample
(100g) is taken 5 subsamples (soil of 2cm wide, 5cm depth) in the range of 10 × 10m by diagonal method, and mixing is used as one
Sample.The sample of acquisition is put into polybag, a little pin holes is pricked to be conducive to gas exchanges, is transported to laboratory, be put in 4 DEG C of guarantors
It deposits, is screened for Aspergillus flavus.
2, bacterial strain isolates and purifies.
(1) preparation of pedotheque bacteria suspension
10g soil sample is taken, 0.1% peptone sterile water (w/v) of 90mL is added, 30min is shaken in room temperature, is made 10-1Bacterium is outstanding
Liquid；0.5mL 10 is taken again-1Bacteria suspension adds 0.1% peptone sterile water of 4.5mL, prepares 10-2The bacteria suspension of dilution；By upper
State method preparation 10-3The bacteria suspension of dilution.
(2) isolation and purification of bacterial strain
Each dilution takes 0.1mL bacterium solution, is coated on the rose bengal medium of improvement, 30 DEG C of dark culturing 5d, often
A dilution is repeated 3 times.Aspergillus flavus of the picking with yellow green spore carries out secondary on the rose bengal medium of improvement
Scribing line separation, until obtaining single bacterium colony.The Aspergillus flavus of picking single bacterium colony is on MEA slant tube culture medium, in 30 DEG C
It is stored in 4 DEG C after culture 3d.
By the above method, the present invention is separated from Sichuan Province, the village Tang Cunba, the township Tu Men, Nanchong City Jialing District pedotheque and is obtained
Bacterial strain PEAS-10 is obtained, separation obtains bacterial strain PAF-1 from Qingdao of Shandong province Laixi City Wangcheng subdistrict office pedotheque.
(3) it identifies
1. the identification of bacterial strain PEAS-10
Morphological Identification
The bacterial strain that the present invention separates is on the rose bengal medium of improvement: Aspergillus flavus generates white hypha and yellow green
Spore；Yellow spore is generated on DG18 culture medium, and the color reaction of bright orange is generated on AFPA culture medium；And the bacterial strain
It is cultivated in producing malicious culture solution, does not generate aflatoxin.
Molecular Identification
Molecular Identification is carried out to bacterial strain PEAS-10 by ITS gene order.
Aspergillus flavus genome ITS amplification primer used are as follows:
ITS1:5 '-TCCGTAGGTGAACCTGCGG-3 ' (SEQ ID No.1)；
ITS4:5 '-TCCTCCGCTTATTGATATGC-3 ' (SEQ ID No.2).
PCR amplification condition are as follows: pcr amplification reaction program are as follows: 94 DEG C of initial denaturation 5min, 1 circulation；94 DEG C of denaturation 30s, 54
DEG C annealing 30s, 72 DEG C of extensions 90s, totally 30 recycle；72 DEG C of last extension 7min.After amplification, product is stored in 4 DEG C.Product is sent
It is sequenced to Shanghai Sheng Gong bioengineering Co., Ltd, compared on sequencing result BLAST researches (http: //
www.ncbi.nlm.nih.gov/)。
Through being sequenced it is found that the following SEQ ID No.3 of the ITS sequence of bacterial strain PEAS-10 of the present invention:
ACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTA
CCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACAC
CACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTT
GGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCT
TTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCT
TGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAG
CGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGAC
CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT
It compares through ITS sequence it is found that the ITS gene order and aspergillus flavus strain LWU-31 of bacterial strain PEAS-10 of the present invention are small
The similitude 100% of subunit ribosomal rna gene sequence.
Using universal primer, detects bacterial strain PEAS-10 and produce virus gene expression, as a result, it has been found that, bacterial strain PEAS-10 is produced
The malicious key gene of seven productions of nor-1, afIR, omtA, ordA, ver-1, verA, verB in gene on virus gene cluster does not have
Expression, therefore the bacterial strain does not produce poison.
Morphological Identification binding molecule Biology identification result is it is found that bacterial strain PEAS-10 is the Huang for not producing aflatoxin
Aspergillus；It was preserved on 08 01st, 2018: China Committee for Culture Collection of Microorganisms's common micro-organisms center,
Deposit number is CGMCC NO:15997, address are as follows: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, request depositary institution are mountain
Eastern province peanut research institute.
2. the identification of bacterial strain PAF-1
Morphological Identification
The bacterial strain that the present invention separates is on the rose bengal medium of improvement: Aspergillus flavus generates white hypha and yellow green
Spore；Yellow spore is generated on DG18 culture medium, and the color reaction of bright orange is generated on AFPA culture medium；And the bacterial strain
It is cultivated in producing malicious culture solution, does not generate aflatoxin.
Molecular Identification
Molecular Identification is carried out to bacterial strain PAF-1 by ITS gene order.
Aspergillus flavus genome ITS amplification primer used are as follows:
ITS1:5 '-TCCGTAGGTGAACCTGCGG-3 ' (SEQ ID No.1)；
ITS4:5 '-TCCTCCGCTTATTGATATGC-3 ' (SEQ ID No.2).
PCR amplification condition are as follows: pcr amplification reaction program are as follows: 94 DEG C of initial denaturation 5min, 1 circulation；94 DEG C of denaturation 30s, 54
DEG C annealing 30s, 72 DEG C of extensions 90s, totally 30 recycle；72 DEG C of last extension 7min.After amplification, product is stored in 4 DEG C.Product is sent
It is sequenced to Shanghai Sheng Gong bioengineering Co., Ltd, compared on sequencing result BLAST researches (http: //
www.ncbi.nlm.nih.gov/)。
Through being sequenced it is found that the following SEQ ID No.4 of the ITS sequence of bacterial strain PAF-1 of the present invention:
GACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGT
ACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACA
CCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCT
TGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTC
TTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGC
TTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGA
GCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGA
CCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA
It compares through ITS sequence it is found that the ITS gene order and aspergillus flavus strain CMXY26475 of bacterial strain PAF-1 of the present invention are small
The similitude 100% of subunit ribosomal rna gene sequence.
Using universal primer, detects bacterial strain PAF-1 and produce virus gene expression, as a result, it has been found that, bacterial strain PAF-1 produces malicious base
Because the malicious key gene of tetra- productions of afIT, afIR, omtA, verA in the gene on cluster is not expressed, therefore the bacterial strain does not produce poison.
Morphological Identification binding molecule Biology identification result is it is found that bacterial strain PAF-1 is the Huang song for not producing aflatoxin
Mould；It was preserved on 08 01st, 2018: China Committee for Culture Collection of Microorganisms's common micro-organisms center is protected
Hiding number is CGMCC NO:15996, address are as follows: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, request depositary institution are Shandong
Province peanut research institute.
Embodiment 2 Aspergillus flavus PEAS-10 and PAF-1 produce malicious situation analysis
(1) poison culture is produced
Aspergillus flavus PEAS-10 and PAF-1 bacterial strain are inoculated in respectively on MEA slant tube culture medium, 28 DEG C of culture 3d
It is activated；4mL sterile water is added on slant tube culture medium, is rinsed, Aspergillus flavus PEAS-10 suspension is made respectively
With Aspergillus flavus PAF-1 suspension.Under the microscope with the quantity of blood counting chamber record spore.
Add the production poison culture solution of 10mL in 50mL centrifuge tube, adds a certain amount of Aspergillus flavus PEAS-10 or PAF-1
Bacteria suspension makes spore final concentration of 105/ mL, is cultivated 7 days by 30 DEG C, 200rpm.
(2) aflatoxin B in malicious culture solution is produced1Measurement
Above-mentioned hair is detected using the method for immunoaffinity chromatography purification, liquid chromatogram separation, fluorescence detector detection respectively
AFB in zymotic fluid1.Concrete operations are as follows: 2mL fermentation liquid is passed through into immune affinity chromatographic column, flow velocity 3mL per minute, with water 20mL points 2
Secondary elution, eluent discard, and admit air into pillar, water are squeezed out pillar, then eluted by several times with 1.5mL methanol, collect elution
Liquid is concentrated into 0.7mL, and is diluted with water to 1mL, shakes up, loading, high performance liquid chromatography separation, fluorescence detector detection.
Chromatographic condition: chromatographic column is Venusil MP C18 (5 μm, 4.6mm × 150mm)；Column temperature is 40 DEG C；Mobile phase is
Methanol: water (V:V=45:55)；Flow velocity is 1.3mL/min；Using Post-column photochemical derivatization method: Photochemical derivatization device 254nm；With
Fluorescence detector detection, excitation wavelength 360nm, launch wavelength 450nm, 20 μ L of sample volume.The result is shown in Figure 1.
Aspergillus flavus strain PEAS-10 and aspergillus flavus strain PAF-1 is produced in malicious fermentation liquid and aflatoxin is not detected, into one
Step confirms that aspergillus flavus strain PEAS-10 and aspergillus flavus strain PAF-1 is not toxigenic bacterium strain.
Embodiment 3
A kind of biocontrol agent and preparation method thereof of prevention and control aflatoxin contamination
(1) microorganism used therefor: Aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1
(2) actication of culture: bacterial strain is seeded in respectively on MEA culture medium, and 30 DEG C are cultivated 3-5 days, until generating yellow green
Spore is advisable.
(3) preparation of microbial inoculum culture medium: peanut red coat is crushed to 0.5 × 0.5cm or so size, by peanut red coat and steaming
The ratio of the mass ratio 1: 1-2: 3 of distilled water mixes, while it is 1%-1.5%CaCl that mass percent, which is added,2, 121 DEG C of sterilizings
20min。
(3) on the microbial inoculum culture medium after the atoxigenic aspergillus flavus strain after activation to be inoculated into sterilizing respectively, 30 DEG C of trainings
It supports 5-8 days, rocks daily once, grow Aspergillus flavus on culture medium uniformly；After culture 5-8 days, Aspergillus flavus spore count
Amount reaches 108It is more than/g culture medium.
(4) culture medium of above-mentioned cultured PEAS-10 containing Aspergillus flavus and Aspergillus flavus PAF-1 is mixed by a certain percentage
It closes, the spore count ratio (PEAS-10: PAF-1) of most latter two bacterial strain is 1: 3, and prevention and control aflatoxin contamination is prepared
Microbial inoculum.Preservation under room temperature.
One, biocontrol agent of the present invention inhibits Aspergillus flavus to produce malicious effect
1, inhibit to test in laboratory
1) test method
(1) preparation of culture medium
Complete not damaged corn and peanut pellets are selected, then weighs 10g peanut of uniform size and jade respectively
Rice, 121 DEG C sterilize for 15 minutes.
(2) preparation of bacteria suspension
To produce malicious Aspergillus flavus (3357 reference culture of aspergillus flavus NRRL (Aspergillus flavus NRRL 3357),
There is provided by Zhongshan University He Zhumei professor's friendship) it is inoculated on MEA slant tube culture medium, 20 DEG C are cultivated 5 days, and cotton swab is then used
The spore on culture medium is dipped in sterile water, is shaken uniformly using turbula shaker, it is then with blood counting chamber that spore is dense
Degree is adjusted to 2 × 104Spore/ml, it is spare.
The microbial inoculum of 0.1g prevention and control aflatoxin contamination is weighed in sterile water, is shaken uniformly, so using turbula shaker
Spore concentration is adjusted to 2 × 10 with blood counting chamber afterwards4Spore/ml, it is spare.
(3) inhibitory effect is tested
It is separately added into above-mentioned diluted 1ml biocontrol agent into triangular flask and produces malicious Aspergillus flavus (104∶104) pityrosporion ovale is outstanding
Liquid is as experimental group.Then 1ml toxigenic bacterium (10 is added into triangular flask4) and the spore bacteria suspension that mixes in equal volume of sterile water make
For positive controls, gently shaking bottle covers spore on peanut and corn.Each do three in parallel, 30 DEG C, dark item
It is cultivated 14 days under part.
(4) aflatoxin content measures
Cultured corn and peanut sample are put into high-pressure sterilizing pot 121 DEG C, being sterilized under 30min (makes Huang Qu
Mould inactivation)；Sterilized sample is put into high speed Universal pulverizer and is smashed to pieces, 50ml 80% then and into triangular flask is added
Methanol, with oscillator high speed concussion 30min, be then filtered extracting solution with sterilized filter paper and be measured with HPLC.
2) test result
The effect of 1 biocontrol agent of table inhibition toxigenic bacterium
As it can be seen from table 1 it is 86.86% that biocontrol agent, which produces malicious rate to the inhibition of toxigenic bacterium in peanut, in corn
To produce malicious rate to the inhibition of toxigenic bacterium be 87.22%, which can be good at inhibiting the production poison of toxigenic bacterium.And it is individual
PEAS-10 inhibits to produce malicious rate in peanut to be 74.02%, inhibits to produce malicious rate in corn to be 81.19%；Single PAF-1 exists
Inhibit to produce malicious rate in peanut to be 78.02%, it is 84.26% that the inhibition in corn, which produces malicious rate, it can be seen that, relative to single
Bacterium, compound biocontrol fungicide of the invention inhibit the malicious rate of production to significantly improve.
2, in Field information
1) test method
To 1 month before harvesting peanut, by aspergillus flavus toxigenic bacterium biocontrol agent, (aspergillus flavus toxigenic bacterium prepared by embodiment 3 was raw
Anti- microbial inoculum) it is spread at peanut rhizosphere with 30kg/ mus, not apply biocontrol agent group as blank control group, other daily managements are tried
It is identical with blank control group to test group.
Application biocontrol agent is applied 10,20 days after bacterium and respectively takes a pedotheque to harvest, detects in soil sample thalline quantity simultaneously
Separation identification is carried out to Aspergillus flavus, compare the aspergillus flavus quantity in the soil sample of application biocontrol microorganisms front and back and produces malicious aspergillus flavus ratio change
Change situation.
2) the fertility analysis of malicious aspergillus flavus in the soil is not produced
Table 2 applies after biocontrol agent aspergillus flavus quantity and ratio situation of change in soil
From table 2 it can be seen that control group (not applying biocontrol agent), aspergillus flavus clump count is 213.45cfu/g in soil,
Producing malicious Aspergillus flavus proportion is 70.23%, and after applying biocontrol agent 10 days, and the clump count of Aspergillus flavus is from fast in soil
Speed increases to 6221.12cfu/g soil, and soil Aspergillus flavus increases sharply, while toxigenic bacterium proportion is quickly fallen to
1.58%；Apply bacterium 20 days, aspergillus flavus clump count reaches 9245.24cfu/g in soil, produces malicious Aspergillus flavus proportion and is reduced to
0.87%；Aspergillus flavus clump count reaches 9532.45cfu/g in soil when harvest, produces malicious Aspergillus flavus proportion and is reduced to
0.75%.
As can be seen from the above results, toxigenic bacterium does not mushroom out breeding in the soil after application biocontrol agent, applies bacterium 20
Aspergillus flavus clump count rapid development in soil after it increases tend to slowly, illustrate that toxigenic bacterium should harvesting peanut for application later
Preceding 20 days application effects are best；After not toxigenic bacterium is administered simultaneously, toxigenic bacterium can not be mushroomed out in peanut soil, be bred, and
Energy Competitive assays produce the growth and breeding of malicious Aspergillus flavus, reduce the ratio of toxigenic bacterium, from experiment as can be seen that applying not toxigenic bacterium
Afterwards, ratio shared by toxigenic bacterium from the 70.23% of control group be reduced to before harvest 0.75%, ratio shared by toxigenic bacterium is rapid
It reduces, to reduce the ratio of toxigenic bacterium infecting peanut, reduces aflatoxin pollution of peanuts risk.
3) prevention and control of peanut root rot
Control group is counted when harvesting peanut and applies the incidence of peanut root rot after biocontrol agent, is fallen ill with root rot
Bacterial strain/total peanut bacterial strain is root rot disease incidence, the results are shown in Table 3.
Table 3 applies peanut root rot incidence after biocontrol agent
| Group | Root rot disease incidence (%) |
| Control group | 18.21 |
| Biocontrol agent group | 2.57 |
As can be seen from Table 3, the disease incidence of peanut root rot is dropped to by the 18.21% of control group after application biocontrol agent
2.57%, reason is analyzed, first is that biocontrol agent is inhibiting to produce malicious Aspergillus flavus while can also inhibit peanut root rot bacterium；Second is that raw
There is peanut red coat in anti-microbial inoculum, the polyphenolic substance in scarlet can inhibit the growth and breeding of pine root fungus.
4) prevention and control of Diplodia gossypina
Control group is counted when harvesting peanut and applies the incidence of Diplodia gossypina after biocontrol agent, is fallen ill with stem rot
Bacterial strain/total peanut bacterial strain is stem rot disease incidence, the results are shown in Table 4.
Table 4 applies peanut root rot incidence after biocontrol agent
| Group | Stem rot disease incidence (%) |
| Control group | 9.78 |
| Biocontrol agent group | 1.08 |
As can be seen from Table 4, the disease incidence of peanut root rot is dropped to by the 9.78% of control group after application biocontrol agent
1.08%.
5) peanut storage and toxin determination
Each increment is individually dried and is weighed after above-mentioned harvesting peanut, is respectively charged into seed packet, and dry shady place is placed in
Storage.Measurement 0,1,2,3,4,5,6,7,8 month Aflatoxin in Peanut byHigh content of storage, compared with the control group, calculating does not produce
The ability that malicious aspergillus flavus inhibits peanut aflatoxin to generate.
The variation of Aflatoxin in Peanut byHigh content in 5 storage of table
As can be seen from Table 5, control group is the peanut that biocontrol agent Peanut Fields of the present invention are not used, and can be examined in harvest
Aflatoxin is measured, with the extension of storage time, aflatoxin content is 20.45 μ g/kg when storing five months, is surpassed
20 μ g/kg of national limit standard is crossed, aflatoxin is exceeded, cannot eat.With the extension of storage phase, control group peanut is yellow bent
Mould content of toxins rapid development has reached 100.45 μ g/kg when by eight month.
Test group does not all detect aflatoxin within storage time 7 months, illustrates biocontrol agent imposing on peanut
Planting site can be substantially reduced the risk that aflatoxin is infected in peanut storage.Single PEAS-10 microbial inoculum processing or single
The peanut of PAF-1 microbial inoculum processing can detect aflatoxin in 6th month in storage；This illustrates compound biocontrol fungicide of the present invention
It can be effectively reduced Aflatoxin in Peanut byHigh content, extend peanut storage phase.
Two, influence of the cultural method to malicious Aspergillus flavus is not produced
1, influence of the microbial inoculum culture medium to the growth and breeding for not producing malicious Aspergillus flavus
Test group:
(1) microorganism used therefor: Aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1
(2) actication of culture: bacterial strain is seeded in respectively on MEA culture medium, and 30 DEG C are cultivated 3-5 days, until generating yellow green
Spore is advisable.
(3) preparation of microbial inoculum culture medium: peanut red coat is crushed to 0.5 × 0.5cm or so size, by peanut red coat and steaming
The ratio of the mass ratio 1: 1 of distilled water mixes, while it is 1%CaCl that mass percent, which is added,2, 121 DEG C of sterilizing 20min.
(3) on the microbial inoculum culture medium after the atoxigenic aspergillus flavus strain after activation to be inoculated into sterilizing respectively, 30 DEG C of trainings
It supports, rocks daily once, grow Aspergillus flavus on culture medium uniformly；After culture 5 days, through detecting Aspergillus flavus spore quantity
≥108/ g culture medium.
(4) culture medium of above-mentioned cultured PEAS-10 containing Aspergillus flavus and Aspergillus flavus PAF-1 is mixed by a certain percentage
It closes, the spore count ratio (PEAS-10: PAF-1) of most latter two bacterial strain is 1: 3, and prevention and control aflatoxin contamination is prepared
Microbial inoculum.Preservation under room temperature.
Control group 1:
(1) microorganism used therefor: Aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1
(2) actication of culture: bacterial strain is seeded in respectively on MEA culture medium, and 30 DEG C are cultivated 3-5 days, until generating yellow green
Spore is advisable.
(3) preparation of microbial inoculum culture medium: peanut red coat is crushed to 0.5 × 0.5cm or so size, by peanut red coat and steaming
The ratio of the mass ratio 1: 1 of distilled water mixes.
(3) on the microbial inoculum culture medium after the atoxigenic aspergillus flavus strain after activation to be inoculated into sterilizing respectively, 30 DEG C of trainings
It supports, rocks daily once, grow Aspergillus flavus on culture medium uniformly；After culture 6 days, through detecting Aspergillus flavus spore quantity
≥108/ g culture medium.
(4) culture medium of above-mentioned cultured PEAS-10 containing Aspergillus flavus and Aspergillus flavus PAF-1 is mixed by a certain percentage
It closes, the spore count ratio (PEAS-10: PAF-1) of most latter two bacterial strain is 1: 3, and prevention and control aflatoxin contamination is prepared
Microbial inoculum.Preservation under room temperature.
Control group 2:
(1) microorganism used therefor: Aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1；
(2) actication of culture: bacterial strain is seeded in respectively on MEA culture medium, and 30 DEG C are cultivated 3-5 days, until generating yellow green
Spore is advisable.
The preparation of microbial inoculum culture medium: it is mixed in the ratio of wheat and the mass ratio 1: 1 of distilled water, while quality percentage is added
Than for 1%CaCl2, 121 DEG C of sterilizing 20min.
(3) on the microbial inoculum culture medium after the atoxigenic aspergillus flavus strain after activation to be inoculated into sterilizing respectively, 30 DEG C of trainings
It supports, rocks daily once, grow Aspergillus flavus on culture medium uniformly；After culture 8 days, through detecting Aspergillus flavus spore quantity
≥108/ g culture medium.
(4) culture medium of above-mentioned cultured PEAS-10 containing Aspergillus flavus and Aspergillus flavus PAF-1 is mixed by a certain percentage
It closes, the spore count ratio (PEAS-10: PAF-1) of most latter two bacterial strain is 1: 3, and prevention and control aflatoxin contamination is prepared
Microbial inoculum.Preservation under room temperature.
These results suggest that cultural method used in the present invention is conducive to the growth and breeding for not producing malicious Aspergillus flavus, arrival has
It is short to imitate incubation time used in the Aspergillus flavus spore of concentration.
2, influence of the microbial inoculum culture medium to malicious Aspergillus flavus field survival ability is not produced
(1) test group
To 1 month before harvesting peanut, aspergillus flavus toxigenic bacterium biocontrol agent prepared by test group is spread on peanut with 30kg/ mus
At rhizosphere, not apply biocontrol agent group as blank control group, other daily management test groups are identical with blank control group.
A pedotheque is taken within 30 days after application biocontrol agent, detect thalline quantity in soil sample and Aspergillus flavus is divided
From identification, compares the aspergillus flavus quantity after applying biocontrol microorganisms in soil sample and produce malicious aspergillus flavus ratio situation of change.
(2) control group 1
To 1 month before harvesting peanut, aspergillus flavus toxigenic bacterium biocontrol agent prepared by control group 1 is spread on flower with 30kg/ mus
It takes root at border, other daily managements above-mentioned (1) are identical.
A pedotheque is taken within 30 days after application biocontrol agent, detect thalline quantity in soil sample and Aspergillus flavus is divided
From identification, compares the aspergillus flavus quantity after applying biocontrol microorganisms in soil sample and produce malicious aspergillus flavus ratio situation of change.
(3) control group 2
To 1 month before harvesting peanut, aspergillus flavus toxigenic bacterium biocontrol agent prepared by control group 2 is spread on flower with 30kg/ mus
It takes root at border, other daily managements above-mentioned (1) are identical.
Application takes a pedotheque after biocontrol agent 30 days, detect thalline quantity in soil sample and divide Aspergillus flavus
From identification, compares the aspergillus flavus quantity after applying biocontrol microorganisms in soil sample and produce malicious aspergillus flavus ratio situation of change.
It the results are shown in Table 6.
Table 6 applies aspergillus flavus quantity and ratio situation of change after the biocontrol agents of different cultural method cultures
As seen from the results in Table 6, the present invention, which cultivates, does not produce malicious Aspergillus flavus compared with control group, and field survival ability is strong, to production
The inhibiting effect of malicious Aspergillus flavus is good.
Three, influence of the biocontrol agent prepared by the present invention to the utilization rate of organic fertilizer
Test group:
(1) microorganism used therefor: Aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1
(2) actication of culture: bacterial strain is seeded in respectively on MEA culture medium, and 30 DEG C are cultivated 3-5 days, until generating yellow green
Spore is advisable.
(3) preparation of microbial inoculum culture medium: peanut red coat is crushed to 0.5 × 0.5cm or so size, by peanut red coat and steaming
The ratio of the mass ratio 1: 1 of distilled water mixes, while it is 1%CaCl that mass percent, which is added,2, 121 DEG C of sterilizing 20min.
(3) on the microbial inoculum culture medium after the atoxigenic aspergillus flavus strain after activation to be inoculated into sterilizing respectively, 30 DEG C of trainings
It supports, rocks daily once, grow Aspergillus flavus on culture medium uniformly；After culture 5 days, through detecting Aspergillus flavus spore quantity
Reach 108/ g culture medium.
(4) culture medium of above-mentioned cultured PEAS-10 containing Aspergillus flavus and Aspergillus flavus PAF-1 is mixed by a certain percentage
It closes, the spore count ratio (PEAS-10: PAF-1) of most latter two bacterial strain is 1: 3, and prevention and control aflatoxin contamination is prepared
Microbial inoculum.Preservation under room temperature.
Blank control group: peanut red coat is crushed to 0.5 × 0.5cm or so size, by the matter of peanut red coat and distilled water
Ratio of the amount than 1: 1 mixes, while it is 1%CaCl that mass percent, which is added,2, 121 DEG C of sterilizing 20min.30 DEG C cultivate 5 days, often
It is rocked once.
To 1 month before harvesting peanut, test group biocontrol agent is spread at peanut rhizosphere with 30kg/ mus, while will control
Group microbial inoculum is also spread at peanut rhizosphere with 30kg/ mus, as blank control group, other daily management test groups and blank control group
It is identical.Experimental group and control group soil are acquired immediately after applying microbial inoculum, measure the content of organic matter.
Test group and control group soil are acquired when harvesting peanut, measures soil with organic matter content, calculate test group and right
According to the utilization rate of group organic matter, ((there is soil organic matter utilization rate/%=when content of organic matter when harvest in soil/just apply bacterium
Machine matter content) * 100) it the results are shown in Table 7.
Table 7 applies the utilization power of the soil organism after biocontrol agent
| Group | Organic matter utilization rate (%) |
| Control group | 58 |
| Biocontrol agent group | 81 |
As can be seen from Table 7, soil with organic matter utilization rate increases after applying biocontrol microorganisms, this illustrates life prepared by the present invention
Anti- microbial inoculum can not only reduce the generation of the disease of peanut, moreover it is possible to increase the utilization rate of the soil organism.
The above described is only a preferred embodiment of the present invention, being not that the invention has other forms of limitations, appoint
What those skilled in the art changed or be modified as possibly also with the technology contents of the disclosure above equivalent variations etc.
Imitate embodiment.But without departing from the technical solutions of the present invention, according to the technical essence of the invention to above embodiments institute
Any simple modification, equivalent variations and the remodeling made, still fall within the protection scope of technical solution of the present invention.
Sequence table
<110>Shandong Peanut Inst.
<120>a kind of biocontrol agent, preparation method and application for producing malicious aspergillus flavus
<130> 2019
<141> 2019-05-28
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>artificial sequence (Aspergillus flavus)
<400> 1
tccgtaggtg aacctgcgg 19
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Aspergillus flavus)
<400> 2
tcctccgctt attgatatgc 20
<210> 3
<211> 574
<212> DNA
<213> Aspergillus flavus PEAS-10
<400> 3
acctgcggaa ggatcattac cgagtgtagg gttcctagcg agcccaacct cccacccgtg 60
tttactgtac cttagttgct tcggcgggcc cgccattcat ggccgccggg ggctctcagc 120
cccgggcccg cgcccgccgg agacaccacg aactctgtct gatctagtga agtctgagtt 180
gattgtatcg caatcagtta aaactttcaa caatggatct cttggttccg gcatcgatga 240
agaacgcagc gaaatgcgat aactagtgtg aattgcagaa ttccgtgaat catcgagtct 300
ttgaacgcac attgcgcccc ctggtattcc ggggggcatg cctgtccgag cgtcattgct 360
gcccatcaag cacggcttgt gtgttgggtc gtcgtcccct ctccgggggg gacgggcccc 420
aaaggcagcg gcggcaccgc gtccgatcct cgagcgtatg gggctttgtc acccgctctg 480
taggcccggc cggcgcttgc cgaacgcaaa tcaatctttt tccaggttga cctcggatca 540
ggtagggata cccgctgaac ttaagcatat caat 574
<210> 4
<211> 576
<212> DNA
<213> Aspergillus flavus PAF-1
<400> 4
gacctgcgga aggatcatta ccgagtgtag ggttcctagc gagcccaacc tcccacccgt 60
gtttactgta ccttagttgc ttcggcgggc ccgccattca tggccgccgg gggctctcag 120
ccccgggccc gcgcccgccg gagacaccac gaactctgtc tgatctagtg aagtctgagt 180
tgattgtatc gcaatcagtt aaaactttca acaatggatc tcttggttcc ggcatcgatg 240
aagaacgcag cgaaatgcga taactagtgt gaattgcaga attccgtgaa tcatcgagtc 300
tttgaacgca cattgcgccc cctggtattc cggggggcat gcctgtccga gcgtcattgc 360
tgcccatcaa gcacggcttg tgtgttgggt cgtcgtcccc tctccggggg ggacgggccc 420
caaaggcagc ggcggcaccg cgtccgatcc tcgagcgtat ggggctttgt cacccgctct 480
gtaggcccgg ccggcgcttg ccgaacgcaa atcaatcttt ttccaggttg acctcggatc 540
aggtagggat acccgctgaa cttaagcata tcaata 576
Claims (10)
1. a kind of biocontrol agent for producing malicious aspergillus flavus, it is characterised in that: its effective component is not produce the aspergillus flavus of aflatoxin
The bacterium PEAS-10 and Aspergillus flavus PAF-1 for not producing aflatoxin；
The Aspergillus flavus PEAS-10 of the not toxin producing was preserved in: Chinese microorganism strain preservation pipe on 08 01st, 2018
Reason committee common micro-organisms center, deposit number are CGMCC NO:15997, address are as follows: BeiChen West Road, Chaoyang District, BeiJing City 1
Number institute 3, request depositary institution are Shandong Peanut Inst.；
The Aspergillus flavus PAF-1 of the not toxin producing was preserved in: Chinese microorganism strain preservation management on 08 01st, 2018
Committee's common micro-organisms center, deposit number are CGMCC NO:15996, address are as follows: BeiChen West Road, Chaoyang District, BeiJing City 1
Institute 3, request depositary institution are Shandong Peanut Inst..
2. producing the biocontrol agent of malicious aspergillus flavus according to claim 1, it is characterised in that: do not produce yellow song in the biocontrol agent
Spore quantity >=10 of the Aspergillus flavus PEAS-10 of mould toxin8A/g；The spore of the Aspergillus flavus PAF-1 of aflatoxin is not produced
Subnumber amount >=108A/g.
3. producing the preparation method of the biocontrol agent of malicious aspergillus flavus according to claim 2, it is characterised in that: step are as follows:
(1) bacterial strain is seeded in respectively on MEA culture medium, 30 DEG C are cultivated 3-5 days, until generating yellow green spore；
(2) on the microbial inoculum culture medium after the atoxigenic aspergillus flavus strain after activation to be inoculated into sterilizing respectively, 30 DEG C of culture 5-8
It, rocks once daily, grows Aspergillus flavus on culture medium uniformly；After culture, Aspergillus flavus spore quantity >=108A/g
Culture medium；
(3) culture medium of PEAS-10 containing Aspergillus flavus cultured in (2) and Aspergillus flavus PAF-1 is mixed in a certain ratio,
The spore count ratio of most latter two bacterial strain is PEAS-10: PAF-1=1: 2-2: 7 to get the biocontrol agent for producing malicious aspergillus flavus, often
Warm preservation.
4. producing the preparation method of the biocontrol agent of malicious aspergillus flavus according to claim 3, it is characterised in that: produce malicious aspergillus flavus
The mixing ratio of the spore of Aspergillus flavus PEAS-10 and Aspergillus flavus PAF-1 is 1: 3 in biocontrol agent.
5. producing the preparation method of the biocontrol agent of malicious aspergillus flavus according to claim 3, it is characterised in that: the microbial inoculum culture
Base is made of following methods:
Peanut red coat is crushed to 0.5 × 0.5cm or so size, by the ratio of peanut red coat and the mass ratio 1: 1-2: 3 of distilled water
Example mixing, while it is 1%-1.5%CaCl that mass percent, which is added,2, 121 DEG C of sterilizing 20min.
6. the purposes of the biocontrol agent of the malicious aspergillus flavus of production of any one of claim 3~5 the method preparation, it is characterised in that use
Poison is grown and produced in inhibition Aspergillus flavus, reduce corps diseases, the utilization rate of raising organic fertilizer, raising crop yield, drop
Aflatoxin content in agricultural product when low harvest extends agricultural product storage period.
7. purposes according to claim 6, it is characterised in that: the crops are peanut or corn.
8. a kind of method for inhibiting Aspergillus flavus growth and producing poison, it is characterised in that: harvested first 1 month to crop, right is wanted
The production poison aspergillus flavus biocontrol agent for asking any one of 3~5 the method preparations, is spread at crop rhizosphere with 30kg/ mus.
9. a kind of utilization rate for reducing corps diseases, improving organic fertilizer or the method for improving crop yield, it is characterised in that:
It is harvested first 1 month to crop, production poison aspergillus flavus biocontrol agent prepared by any one of claim 3~5 the method, with
30kg/ mus are spread at crop rhizosphere.
10. the method for aflatoxin content or extension agricultural product storage period, feature exist in agricultural product when a kind of reduction harvest
In: it is harvested first 1 month to crop, production poison aspergillus flavus biocontrol agent prepared by any one of claim 3~5 the method, with
30kg/ mus are spread at crop rhizosphere, harvest in due course, and sunning is placed on dry shady place storage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910452636.2A CN110074140B (en) | 2019-05-28 | 2019-05-28 | Biocontrol microbial inoculum for producing aspergillus flavus, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910452636.2A CN110074140B (en) | 2019-05-28 | 2019-05-28 | Biocontrol microbial inoculum for producing aspergillus flavus, preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110074140A true CN110074140A (en) | 2019-08-02 |
| CN110074140B CN110074140B (en) | 2020-06-09 |
Family
ID=67422156
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910452636.2A Active CN110074140B (en) | 2019-05-28 | 2019-05-28 | Biocontrol microbial inoculum for producing aspergillus flavus, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110074140B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110683911A (en) * | 2019-11-20 | 2020-01-14 | 吉林大学 | Biochar-based aflatoxin prevention and control slow-release fertilizer and preparation method thereof |
| CN112609021A (en) * | 2021-01-13 | 2021-04-06 | 中国农业科学院农产品加工研究所 | Aspergillus flavus RPA primer, kit, and aspergillus flavus detection method and device |
| CN113604368A (en) * | 2021-09-09 | 2021-11-05 | 华南农业大学 | Complex microbial inoculum and detection method thereof, complex microbial preparation and application thereof |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN85106023A (en) * | 1985-07-30 | 1987-02-04 | 长岡均 | Method for extracting effective components from Basidiomycetes mycelium |
| CN101363006A (en) * | 2008-09-08 | 2009-02-11 | 浙江大学 | Aspergillus flavus strain without producing aspergillus flavus toxin and uses thereof |
| CN103509723A (en) * | 2013-09-25 | 2014-01-15 | 中国农业科学院农产品加工研究所 | Aspergillus flavus producing no aflatoxin and application thereof |
| CN103937687A (en) * | 2014-04-23 | 2014-07-23 | 中国农业科学院农产品加工研究所 | Aspergillus flavus mixed strain incapable of producing aflatoxin and application thereof |
| CN104789480A (en) * | 2015-03-10 | 2015-07-22 | 浙江大学 | Aspergillus flavus strain and mixed flora not producing aflatoxin and application thereof |
| CN105219654A (en) * | 2015-09-25 | 2016-01-06 | 中国农业科学院油料作物研究所 | The aspergillus flavus strain of aflatoxin and the application in aflatoxin pollution of peanuts biological control thereof are not produced in one strain |
| CN107142217A (en) * | 2016-12-06 | 2017-09-08 | 青岛至成生物技术有限公司 | A kind of biological pesticide for being used to reduce crops aflatoxin content |
| CN105219655B (en) * | 2015-09-25 | 2018-08-24 | 浙江大学 | Aspergillus flavus biocontrol bacterial strain and its application of aflatoxin are not produced to fungicide resistance and |
| CN108434338A (en) * | 2018-06-06 | 2018-08-24 | 张可池 | Using anticancer herbal drug as the righting qi-restoratives Chinese medicine preparation of raw material |
-
2019
- 2019-05-28 CN CN201910452636.2A patent/CN110074140B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN85106023A (en) * | 1985-07-30 | 1987-02-04 | 长岡均 | Method for extracting effective components from Basidiomycetes mycelium |
| CN101363006A (en) * | 2008-09-08 | 2009-02-11 | 浙江大学 | Aspergillus flavus strain without producing aspergillus flavus toxin and uses thereof |
| CN103509723A (en) * | 2013-09-25 | 2014-01-15 | 中国农业科学院农产品加工研究所 | Aspergillus flavus producing no aflatoxin and application thereof |
| CN103937687A (en) * | 2014-04-23 | 2014-07-23 | 中国农业科学院农产品加工研究所 | Aspergillus flavus mixed strain incapable of producing aflatoxin and application thereof |
| CN104789480A (en) * | 2015-03-10 | 2015-07-22 | 浙江大学 | Aspergillus flavus strain and mixed flora not producing aflatoxin and application thereof |
| CN105219654A (en) * | 2015-09-25 | 2016-01-06 | 中国农业科学院油料作物研究所 | The aspergillus flavus strain of aflatoxin and the application in aflatoxin pollution of peanuts biological control thereof are not produced in one strain |
| CN105219655B (en) * | 2015-09-25 | 2018-08-24 | 浙江大学 | Aspergillus flavus biocontrol bacterial strain and its application of aflatoxin are not produced to fungicide resistance and |
| CN107142217A (en) * | 2016-12-06 | 2017-09-08 | 青岛至成生物技术有限公司 | A kind of biological pesticide for being used to reduce crops aflatoxin content |
| CN108434338A (en) * | 2018-06-06 | 2018-08-24 | 张可池 | Using anticancer herbal drug as the righting qi-restoratives Chinese medicine preparation of raw material |
Non-Patent Citations (2)
| Title |
|---|
| GAYATHRI GUNALAN等: ""Production, optimization of chitinase using Aspergillus flavus and its biocontrol of phytopathogenic fungi"", 《JOURNAL OF PHARMACY RESEARCH》 * |
| SOHAIL等: ""In vitro antimicrobial study of Aspergillus flavus mycelial extract against different bacterial and fungal pathogenic strains"", 《INTERNATIONAL JOURNAL OF BIOSCIENCES》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110683911A (en) * | 2019-11-20 | 2020-01-14 | 吉林大学 | Biochar-based aflatoxin prevention and control slow-release fertilizer and preparation method thereof |
| CN112609021A (en) * | 2021-01-13 | 2021-04-06 | 中国农业科学院农产品加工研究所 | Aspergillus flavus RPA primer, kit, and aspergillus flavus detection method and device |
| CN112609021B (en) * | 2021-01-13 | 2023-01-17 | 中国农业科学院农产品加工研究所 | Aspergillus flavus RPA primer, kit, and aspergillus flavus detection method and device |
| CN113604368A (en) * | 2021-09-09 | 2021-11-05 | 华南农业大学 | Complex microbial inoculum and detection method thereof, complex microbial preparation and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110074140B (en) | 2020-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110157625A (en) | A kind of composite bacteria agent, preparation method and application for inhibiting to produce malicious aspergillus flavus | |
| CN105296381B (en) | One bacillus subtilis CYY-25 and its application | |
| CN110074140A (en) | A kind of biocontrol agent, preparation method and application producing malicious aspergillus flavus | |
| CN105543132A (en) | Bacillus methylotrophicus YB-F7 and application thereof in preventing plant diseases | |
| CN110129212A (en) | One plant of Aspergillus flavus PEAS-10 and application thereof for not producing aflatoxin | |
| CN104762230B (en) | Prevent and treat Shewanella alga and its application of crop storage phase Aspergillus flavus and toxin | |
| CN110305796A (en) | One plant of Aspergillus flavus PAF-1 and application thereof for not producing aflatoxin | |
| CN105602863A (en) | Bacillus subtilis strain for high yield of lipopeptide antibiotic and poly-gamma-glutamic acid | |
| CN110157626A (en) | One plant of Aspergillus flavus PEASH-12 and application thereof for not producing aflatoxin | |
| CN104789480A (en) | Aspergillus flavus strain and mixed flora not producing aflatoxin and application thereof | |
| CN104073440B (en) | One strain paecilomyces fumosoroseus and application thereof | |
| CN105219655A (en) | Flavus biocontrol strain and the application thereof of aflatoxin do not produced to sterilant resistance | |
| CN108384734B (en) | Biocontrol microbial inoculum for preventing and treating tobacco root and stem diseases and preparation method thereof | |
| CN109266559B (en) | A kind of application of Trichoderma harzianum LTR-2 | |
| CN105210749B (en) | A kind of method for improving rice blast neck blast resistance identification accuracy | |
| CN104630072A (en) | Trichoderma atroviride Ta-9 strain and application thereof in prevention and control of rice diseases | |
| CN103484377A (en) | Trichoderma spp. strain antagonizing maize stem rot and sheath blight and application thereof | |
| CN109762752A (en) | One plant is killed streptomyces nodocus bacterial strain and its application | |
| CN110184197B (en) | Beauveria bassiana oil suspending agent | |
| CN110122508A (en) | A kind of drip irrigation, preparation method and application producing malicious aspergillus flavus | |
| CN109749938A (en) | The endogenetic fungus and its microbial inoculum of one plant of reduction notoginseng root rot disease incidence | |
| CN107841474A (en) | A kind of pond life Delftiatsuruhatensis and its application in rice green smut preventing and treating | |
| CN111909863B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN106754396B (en) | A kind of Chinese toon endogenetic fungus TS8 and its secondary metabolite, preparation method and application | |
| CN109355234A (en) | A kind of rhizobium YZM0144 and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |