CN104073440B - One strain paecilomyces fumosoroseus and application thereof - Google Patents
One strain paecilomyces fumosoroseus and application thereof Download PDFInfo
- Publication number
- CN104073440B CN104073440B CN201310646232.XA CN201310646232A CN104073440B CN 104073440 B CN104073440 B CN 104073440B CN 201310646232 A CN201310646232 A CN 201310646232A CN 104073440 B CN104073440 B CN 104073440B
- Authority
- CN
- China
- Prior art keywords
- culture
- degrees celsius
- paecilomyces fumosoroseus
- strain
- spore
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses strain paecilomyces fumosoroseus and an application thereof. Paecilomyces fumosoroseus (Paecilomyces provided by the present invention? fumosoroseus) TRCC22001 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, does is its preserving number: CGMCC? No.7993, and the application that this bacterial strain is in preventing and treating sucking pest.
Description
Technical field
The present invention relates to a kind of paecilomyces fumosoroseus (Paecilomycesfumosoroseus), the preparation method also relating to a kind of this paecilomyces fumosoroseus (Paecilomycesfumosoroseus), and the application in preventing and treating sucking pest.
Background technology
Along with the foundation that sustainable agriculture is seen, exploring bio-control method nuisanceless, free of contamination has become the important topic in plant disease comprehensive control, is increasingly subject to the attention of countries in the world.
According to incompletely statistics, the entomogenous fungi recorded in the world about 100 genus kind more than 800. Reaching 405 kinds what China had reported, wherein Cordyceps 80 kinds, the fungus of parasitic nematode 10 kinds, the fungal species of parasitic insect 215 kinds, the novel species of report reaches 24 kinds. China is since the fifties, and the insect pathogenic fungus about 20 kinds of exploitation application, what usable floor area was the widest is muscardine and green muscardine fungus.
Insect pathogenic fungus refers to that those can directly invade internal, propagation under host's normal physiological conditions and cause rapidly the monoid of death. They are with the nutrient, the decomposition host tissue that absorb in hemolymph or produce toxic metabolic products and kill insecticide. In the pathogenic microorganism causing insect-borne infection disease, fungus the situation causing insect death is maximum, accounts for 60%. Meanwhile, insect pathogenic fungus is of a great variety, and insect density plays important adjustment effect, so utilizing insect pathogenic fungus species resource to carry out " controlling worm with bacterium " should be the important component part that Biological control works. The pathogenesis of insect pathogenic fungus: insect pathogenic fungus again produces spore from spore germination to thalline on polypide and is generally divided into 10 stages: (1) Spore adhesion is in Cuticle; (2) spore germination; (3) epidermis is penetrated; (4) mycelia is at blood Intracavity; (5) toxin produces; (6) host is dead; (7) mycelia invades all organs of host; (8) mycelia passes epidermis; (9) spore is produced; (10) diffusion of unit is infected. As long as completing front four-stage, just complete the invasion to host and infection; When pathogenic fungi mycelia in vivo breeds in a large number, so that it may cause that host is dead.
Summary of the invention
It is an object of the invention to provide a kind of insect pathogenic fungus preventing and treating sucking pest---paecilomyces fumosoroseus (Paecilomycesfumosoroseus). Its rDNAITS1-5.8S-ITS2 sequence:
5’-TCTCCGTTGGTGAACCAGCGGAGGGATCATTAACGAGTTTTTTCAACTCCCTAACCCTTTGTGAACATACCTATCGTTGCTTCGGCGGACTCGCCCCGGCGTCCGGACGGCCCTGCGCCGCCCGCGACGGACCCAGGCGGCCGCCGGAGACCCACAAATTCTGTTTCTATCAGTCTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACACCTTCGGGGGAGTCGGCGTTGGGGACCGGCAGCATACCGCCGGCCCCGAAATACAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACTCCAACGCGCACCGGGAACCCGACGCGGCCACGCCGAAACACCCAACTTCTGAACGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAA-3'。
Meanwhile, the present invention also aims to provide spawn culture method and the solid culture method of a kind of paecilomyces fumosoroseus (Paecilomycesfumosoroseus).
Further, it is an object of the invention to provide the application of a kind of paecilomyces fumosoroseus (Paecilomycesfumosoroseus). To achieve these goals, technical scheme have employed a kind of paecilomyces fumosoroseus (Paecilomycesfumosoroseus), and its preserving number is CGMCCNO.7993.
Meanwhile, technical scheme have employed a kind of spawn culture method of paecilomyces fumosoroseus (Paecilomycesfumosoroseus), (1) inclined-plane seed culture. Slant strains culture medium is Improvement type PDA:20% Rhizoma Solani tuber osi, 2% sucrose, 0.2% peptone, 0.1%K2HPO43H2O, 0.3%NaNO3, 0.05%MgSO47H2O, 0.05%KCl, 0.01%FeSO4, 2% agar, water 1000ml. 121 degrees Celsius of high pressure steam sterilization 30min. 26 degrees Celsius of constant temperature culture 10d are placed standby after test tube inoculation. (2) liquid seeds is cultivated. Culture medium: Improvement type PDA (removes agar). It is loaded into 500ml triangular flask, every bottled 100ml, 121 degrees Celsius of high pressure steam sterilization 30min. Access test tube slant strain (every connects two bottles), place shaking table (180 turns/min) 26 degrees Celsius cultivation 60h standby.
Meanwhile, technical scheme have employed the solid culture method of a kind of paecilomyces fumosoroseus (Paecilomycesfumosoroseus): solid medium is 70% Testa Tritici+30% Testa oryzae. Weighing raw material by solid medium proportioning, add 1.2 times of water and fully mix thoroughly, overnight rear 121 degrees Celsius of high pressure steam sterilization 30min are standby.
Further, technical scheme have employed the application in preventing and treating sucking pest of a kind of paecilomyces fumosoroseus (Paecilomycesfumosoroseus).
Diamondback moth is being prevented and treated in process by paecilomyces fumosoroseus (Paecilomycesfumosoroseus) involved in the present invention, the mortality rate of diamondback moth larvae is 76.2% by paecilomyces fumosoroseus spore powder, the mortality rate of diamondback moth larvae is 59.8% by paecilomyces fumosoroseus spore suspension, and the mortality rate of diamondback moth larvae is 58.5% by paecilomyces fumosoroseus Spore cultivation liquid.
Tea lesser leafhopper is being prevented and treated in process by paecilomyces fumosoroseus (Paecilomycesfumosoroseus) involved in the present invention, and preventive effect reaches as high as 71.3%.
The bacterial strain of the present invention: paecilomyces fumosoroseus (Paecilomycesfumosoroseus) preservation and China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), preservation address is: China. Beijing. and Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Microbe Inst., Chinese Academy of Sciences, preservation date is on 08 13rd, 2013, and its deposit number is CGMCCNo.7993.
Detailed description of the invention:
The qualification of embodiment 1TRCC22001 bacterial strain:
Molecular systematics is identified, DNA extraction method: adopt quartzite sand grind extract with CTAB method (Scottetal., 2000).
Genetic marker: rDNAITS1-5.8S-ITS2, amplimer: ITS5, ITS4 (Whiteetal., 1990).
Pcr amplification reaction condition: first 94 DEG C of heating make template DNA degeneration in 3 minutes, circulates subsequently into following temperature: 94 DEG C of degeneration 30 seconds, 50 DEG C of annealing 30 seconds, 72 DEG C extend 45 seconds, carry out 35 circulations altogether, finally extend 5 minutes (Wang, 2012) at 72 DEG C.
PCR primer detection and order-checking: PCR primer and 100bpDNAladder (MBIFermentas) with 2.0% agarose gel (agarosegel) in 0.5 × TBE electrophoretic buffer under 80V voltage electrophoresis 20 minutes, it is subsequently placed in the ethidium bromide (EB of 0.5 μ g/ml, ehidiumbromide) solution dyes 15 minutes, under the ultraviolet light of wavelength 365 and 254nm detection for the product of obvious single band by Qing Ke Bioisystech Co., Ltd purification after carry out two-way straight-through order-checking with ABI3700 (AppliedBiosystems).
Data process and statistical analysis: original series obtains sequence accurately after editing with biosoftware Bioedit7.0.9 (Hall, 1999), with the GenBank pattern downloaded and authority's strain sequence composition sequence data matrix. For sequence matrix, under Bioedit7.0.9, it is the human-edited of necessity and adjusts the new matrix obtained. By this matrix MEGA5.0 (Tamuraetal., 2011) neighbours connection method (neighbor-joining is carried out, NJ) analyze, infer phylogenetic tree, and carry out the reliability of 1000 each branches of repeat assessment by method of bootstrapping (bootstrap).
Bacterial strain phylogenetic tree is shown in accompanying drawing 1, accompanying drawing 2. Result shows that TRCC22001 bacterial strain and (Paecilomycesfumosoroseus) similarity are 98.90%, and its thalli morphology and physiological and biochemical index meet the feature of (Paecilomycesfumosoroseus), it is possible to identify that TRCC82001 bacterial strain is for (Paecilomycesfumosoroseus). By institute of microbiology of the Chinese Academy of Sciences by (Paecilomycesfumosoroseus) called after paecilomyces fumosoroseus. TRCC22001 bacterial strain is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on August 13rd, 2013, and deposit number is: CGMCCNo.7993.
Embodiment 2 spawn culture:
(1) inclined-plane seed culture. Slant strains culture medium is Improvement type PDA:20% Rhizoma Solani tuber osi, 2% sucrose, 0.2% peptone, 0.1%K2HPO43H2O, 0.3%NaNO3, 0.05%MgSO47H2O, 0.05%KCl, 0.01%FeSO4, 2% agar, water 1000ml. 121 degrees Celsius of high pressure steam sterilization 30min. 26 degrees Celsius of constant temperature culture 10d are placed standby after test tube inoculation. (2) liquid seeds is cultivated. Culture medium: Improvement type PDA (removes agar). It is loaded into 500ml triangular flask, every bottled 100ml, 121 degrees Celsius of high pressure steam sterilization 30min. Access test tube slant strain (every connects two bottles), place shaking table (180 turns/min) 26 degrees Celsius cultivation 60h standby.
Embodiment 3 solid culture
(1) Medium Proportion: 70% Testa Tritici+30% Testa oryzae. Weighing raw material by proportioning, add 1.2 times of water and fully mix thoroughly, overnight rear 121 degrees Celsius of high pressure steam sterilization 30min are standby. (2) cultural method and character observation. Culture medium is layered on respectively (thickness is advisable with 2～3cm) on aseptic porcelain dish, respectively accesses liquid seeds, mix homogeneously, cover lid, 26 degrees Celsius of constant temperature culture by 10% inoculum concentration. After 7d stirs 1 time, spraying moistens or " pouring water moistening " cultivation, and after 15d stirs again, spraying moistens or " pouring water moistening ", cultivates 20d continuously, performs upgrowth situation record. After cultivating 20d, 32 degrees Celsius are dried 40h. (3) sporulation quantity measures: weighs 1g, puts in triangular flask, adds the appropriate distilled water containing tween 80, breaks up spore, calculate the spore count of every gram with blood cell counting plate.
The virulence of embodiment 4 paecilomyces fumosoroseus (Paecilomycesfumosoroseus)
1, the infection processs of diamondback moth larvae is observed by paecilomyces fumosoroseus (Paecilomycesfumosoroseus)
Diamondback moth 3 instar larvae that picking has just been casted off a skin, connects bacterium to diamondback moth 3 instar larvae body surface by cultured paecilomyces fumosoroseus spore powder, connect after bacterium in 20 degrees Celsius, raise under relative humidity 75%～80% condition, every day, fresh cabbage leaves was changed in timing. Repeat for 3 times, often repeat 20 larvas. After process, 10h starts sampling, and every 2h samples 1 time, and after 16h, every 4h samples 1 time.Sample is fixed with the glutaraldehyde of 3%, observes, takes pictures after series of processes under scanning electron microscope. Spore germination exceedes the half of spore diameter length (non-circular spore by less diameter) as the standard of sprouting using germ tube length.
2, Pathogenic Tests
(1) inoculating spores powder: diamondback moth 3 instar larvae and the coverslip scribbling collodion are placed in culture dish lid, then the Paecilomyces Fumosoroseus of 25 degrees Celsius, SDA culture medium culturing 14d is fallen on the ware lid putting diamondback moth larvae in being inverted in, clap bottom culture dish for several times with have gentle hands, spore powder is made to fall on diamondback moth larvae and coverslip, take out that coverslip is counter covers on blood counting chamber, dripping two cotton blue liquid, making spore quantity on coverslip is 6～7 mm-2. By process after diamondback moth larvae put into be lined with wet filter paper, diameter be 15cm culture dish raise. Rearing conditions is 20 degrees Celsius, relative humidity 75%～80%, and every day, fresh cabbage leaves was changed in timing, observes susceptible symptom and records dead borer population. Repeat for 3 times, often repeat 20 larvas, with the diamondback moth larvae that do not connect bacterium for comparison. Data process and adopt Duncan duncan's new multiple range method.
(2) inoculating spores suspension: take 25 degrees Celsius, the SDA culture medium culturing paecilomyces fumosoroseus conidium of 14 days, making spore suspension (more than magnetic stirrer 10min) with the sterilized water containing 0.1% tween 80, regulating spore suspension concentration is 2 × 107Individual mL-1. With aerosol apparatus diamondback moth 3 instar larvae to being placed on filter paper and coverslip metered dose, then taking out coverslip microscopy spore quantity, making spore count on coverslip is 6～7 mm-2. Often process 20 larvas, repeat for 3 times, with 0.1% tween 80 sterilized water for comparison. Rearing conditions and data process ibid.
(3) inoculating spores culture fluid: take 25 degrees Celsius, the SDA culture medium culturing paecilomyces fumosoroseus conidium of 14 days be placed in Sharpe fluid medium, spore concentration is adjusted to 2 × 107Individual mL-1, shaking table is cultivated and is carried out connecing bacterium after 8 hours again and process, and connects bacterium method and rearing conditions ibid.
3,3 kinds of differences connect the bacterium method pathogenicity to diamondback moth larvae
Difference connects bacterium method paecilomyces fumosoroseus, and pathogenic speed and the pathogenicity of diamondback moth larvae is significantly different. Paecilomyces fumosoroseus conidium culture fluid is faster to the pathogenic speed of diamondback moth larvae than spore suspension and spore powder, processes latter 44 hours and finds that polypide shows obvious susceptible symptom, peak mortality within 72 hours, occurs, and its lethal time of 50 is 3.18 days; , there is susceptible symptom in 60 hours in the diamondback moth larvae that spore suspension and spore powder process, than Spore cultivation liquid late 16 little time, there is peak mortality in 96h, respectively 4.20 days and the 4.34 days lethal time of 50.
The preparation of embodiment 4 paecilomyces fumosoroseus (Paecilomycesfumosoroseus) preparation and drug effect
1, spore powder produces and suspension emulsion preparation
The strain preserved is activated on SDAY flat board, constant temperature (25e) illumination cultivation is to when producing spore, take spore powder to shaken cultivation in Sa Shi culture fluid (SDAY without agar) 24 hours, continue after switching to cultivate 48 hours then, bacterium solution containing a large amount of mycelia is accessed on soaking and the rice of steam sterilization extremely suitable ripe degree, inoculum concentration is 10%, bacterium solution and rice spread out in pallet after being sufficiently mixed, cultivate 10 days at 25 degrees c, within air-dry 1 day under 35 degree, collecting spore powder after 120 mesh sieves of mechanical vibration, its spore content is more than 1011g-1, quantitative spore powder being added the emulsifiable solvent naphtha of formulation optimization is configured to Emulsifiable formulation, spore content is 1010ml-1, this is pure Emulsifiable formulation, is called for short pure spore agent, on this basis, with 10% imidacloprid wettable powder as synergist, adds (i.e. 3g 100ml in pure Emulsifiable formulation in the ratio of 3% (W/V)-1), it is derived from the Emulsifiable formulation of mixture, is called for short mixed agent.Selecting imidacloprid as synergist, one to be because it be the chemical insecticide being allowed at present use in tea place, two biocompatibility that to be because between it and disinsection fungal fabulous.
2, field test
Selecting representative tea place (tea lesser leafhopper harm is serious and is distributed relatively uniform) to carry out field control effectiveness test, management condition is consistent; This tea place be typical case massif tea place, tea ridge (wide about 1～115 meter) in terraced distribution, the gradient about 60 °, rise about 40m at the bottom of slope to slope. Test includes 4 process, clear water comparison (CK), the mineral oil vehicle of humectant can compare (OI), the pure spore agent (OP) of paecilomyces fumosoroseus and mixed agent (OPI) containing 3% imidacloprid 10%. Often processing community to repeat 3 times, every plot area is about 60m2(only ridge of about 60m length), sets 1 ridge blank (not doing any process) as protection zone between community. Each microbial inoculum dilute with water 500 times spraying, the actual spore concentration making hydrojet is 2 × 107Individual spore ml-1, every community spray bacterium solution is about 5kg, and the spouting liquid (CK and OI) of non-microbial inoculum process is identical, and the group arrangement of random district, spraying 2 times altogether are pressed in all process, and the 12d that second time is sprayed at after spraying for the first time carries out, and is fine day at dusk with the bacterium time twice.
3, insect population investigation
Tea lesser leafhopper happiness is shady and cool and activeness is strong, kind jump, brings difficulty to field sampling survey. during test, sampling survey be typically in morning dew not dry before (during 8:30 in morning before) this worm less movable time carry out, the cloudy day then can whole day carry out. because of an actually ridge, every community, therefore adopt the method to Camellia sinensis numbering, the Camellia sinensis of a numbering is randomly selected as initial sampling strain during investigation, then 1 strain is extracted every 2 strains, every community looks into 10 strains altogether, every strain 10 tender leafs (taking lower second tender leaf of bud) of selective examination, leaf through lightly (bud-leaf touched is not used in observation), count on the spot and record nymph number and become borer population, finally by processing the every 10 leaf worm numbers of statistics, first with investigation insect population radix before bacterium, then every investigation in 3 or 4 days once, last investigation is done after second time uses bacterium 2 weeks, local meteorological data during field test obtains from local weather station.
4, data analysis
Tea lesser leafhopper density (worm amount/10 leaf) to each process, carries out variance analysis with DPS data processing system software. Each relative control effect (E) processed calculates as follows:
E=[1-(PCK0×PT1)/(PCK1×PT0)]×100
In formula, PT0And PT1Expression processes the average 10 leaf worm amounts of community " Invest, Then Investigate " before treatment, P respectivelyCK0And PCK1Represent the average 10 leaf worm amounts of investigation before and after the spraying of clear water check plot respectively.
5, result of the test
(1) weather conditions during test: environmental condition is the key factor affecting fungus insecticide; The field test of this research is on the occasion of local high temperature season, and from spray bacterium to observing 25 days terminated, range of temperature is 21.2～38.1 degrees Celsius, minimum day samming 22.7 degrees Celsius, the highest day samming 31.2 degrees Celsius, average day samming 26.6 degrees Celsius. From rain fall, have 14 rainfall days, wherein the rainfall of 4 rainfall days less than 1mm, 1～5mm little rain day 4d, 5～25mm at 3 days on middle rain day, at 4 days on the big rain day of 25～50mm, total rainfall reaches 241.2mm. In a word, mid-June tests the midsummer of location Suichang of Zhejiang Province, temperature drift just to mid-July, and rainwater is on the high side, thus during test, Changes in weather is bigger.
(2) field efficacy: compared with compareing with clear water, tea lesser leafhopper is all produced certain control effect by the 500 times of diluent sprayings of the Emulsifiable formulation of two kinds of funguses, but with the effect of mixed agent significantly better than pure microbial inoculum, the highest preventive effect of paecilomyces fumosoroseus is 71.3%.500 times of diluent sprayings of the alone mineral oil vehicle containing 3% imidacloprid 10% wettable powder also obtain suitable preventive effect, and preventive effect is always investigated the highest after application for the first time, then declines to a great extent. To give average and sequence by the preventive effect of investigation all previous after bacterium, result is paecilomyces fumosoroseus mixed agent preventive effect 62.1 ± 12.2%, next to that mineral oil 50.3 ± 14.3% containing trace imidacloprid and the pure microbial inoculum of paecilomyces fumosoroseus, only has preventive effect 19.0 ± 23.2%.
It should be noted last that, above example is merely to illustrate and unrestricted technical scheme, although the present invention being described in detail with reference to above-described embodiment, it will be understood by those within the art that: still the present invention can be modified or equivalent replacement, without deviating from any modification or partial replacement of the spirit and scope of the present invention, it all should be encompassed in the middle of scope of the presently claimed invention.
Table 1:3 kind difference connects the mortality rate of diamondback moth larvae after bacterium method processes
| Connect bacterium method | Corrected mortality (%) | Percentage of pupation (%) | The lethal time of 50 |
| Spore powder | 76.2±1.13a | 20.4±1.39a | 4.34 |
| Spore suspension | 59.8±1.36b | 36.2±1.81b | 4.30 |
| Spore cultivation liquid | 58.5±2.04b | 38.4±1.56b | 3.18 |
Accompanying drawing explanation
Fig. 1 is the rDNAITS1-5.8S-ITS2 sequence of paecilomyces fumosoroseus (Paecilomycesfumosoroseus) TRCC22001CGMCCNo.7993.
Fig. 2 is paecilomyces fumosoroseus (Paecilomycesfumosoroseus) TRCC22001CGMCCNo.7993 phylogenetic tree based on rDNAITS1-5.8S-ITS2 sequence construct.
Claims (4)
1. paecilomyces fumosoroseus (Paecilomycesfumosoroseus) bacterial strain, it is deposited in Chinese microorganism strain keeping administration committee's common micro-organisms center CGMCC on August 13rd, 2013, and deposit number is 7993.
2. the cultural method of Paecilomyces Fumosoroseus strain as claimed in claim 1, it is characterised in that described cultural method includes spawn culture and solid culture;
Described spawn culture is particularly as follows: (1) inclined-plane seed culture, and slant strains culture medium is Improvement type PDA:20% Rhizoma Solani tuber osi, 2% sucrose, 0.2% peptone, 0.1%K2HPO4·3H2O, 0.3%NaNO3, 0.05%MgSO4·7H2O, 0.05%KCl, 0.01%FeSO4, 2% agar, 1000 milliliters of water; 121 degrees Celsius of high pressure steam sterilizations 30 minutes; 26 degrees Celsius of constant temperature culture 10 days are placed standby after test tube inoculation; (2) liquid seeds is cultivated, culture medium: remove the Improvement type PDA of agar; It is loaded into 500 milliliters of triangular flasks, often bottled 100 milliliters, 121 degrees Celsius of high pressure steam sterilizations 30 minutes; Accessing test tube slant strain, every connects two bottles, places shaking table, 180 revs/min, 26 degrees Celsius cultivate 60 hours standby.
3. cultural method as claimed in claim 2, it is characterised in that described solid culture, particularly as follows: weigh raw material by solid medium proportioning, adds 1.2 times of water and fully mixes thoroughly, overnight rear 121 degrees Celsius of high pressure steam sterilizations 30 minutes are standby;
Described solid medium is 70% Testa Tritici+30% Testa oryzae.
4. the Paecilomyces Fumosoroseus strain as claimed in claim 1 application in preventing and treating sucking pest.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310646232.XA CN104073440B (en) | 2013-12-06 | 2013-12-06 | One strain paecilomyces fumosoroseus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310646232.XA CN104073440B (en) | 2013-12-06 | 2013-12-06 | One strain paecilomyces fumosoroseus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104073440A CN104073440A (en) | 2014-10-01 |
| CN104073440B true CN104073440B (en) | 2016-06-15 |
Family
ID=51595048
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310646232.XA Active CN104073440B (en) | 2013-12-06 | 2013-12-06 | One strain paecilomyces fumosoroseus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104073440B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105941486B (en) * | 2016-05-16 | 2021-08-31 | 江西天人生态股份有限公司 | Agricultural insecticidal composition and application thereof |
| CN106376600A (en) * | 2016-08-30 | 2017-02-08 | 江西天人生态股份有限公司 | Paecilomyces fumosoroseus wettable powder and preparation method thereof |
| CN106489928A (en) * | 2016-08-31 | 2017-03-15 | 江西天人生态股份有限公司 | A kind of exhibition film oil-suspending agent and its preparation method and application |
| CN106489927A (en) * | 2016-08-31 | 2017-03-15 | 江西天人生态股份有限公司 | A kind of paecilomyces fumosoroseus oil-suspending agent and preparation method thereof |
| CN106417282A (en) * | 2016-09-22 | 2017-02-22 | 江西天祥通用航空股份有限公司 | Paecilomyces fumosoroseus granules and preparing method thereof |
| CN107410367B (en) * | 2017-09-01 | 2020-04-17 | 江西省科学院微生物研究所 | Paecilomyces fumosoroseus oil and preparation method thereof and insecticide |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182466A (en) * | 2007-11-20 | 2008-05-21 | 华南农业大学 | Paecilomyces Fumosoroseus strain and uses thereof |
| JP2008260764A (en) * | 2007-03-20 | 2008-10-30 | Sumitomo Chemical Co Ltd | Application method of microorganism-containing preparation |
| CN102630710A (en) * | 2012-04-10 | 2012-08-15 | 江苏省农业科学院 | Method for increasing infectivity of Paecilomyces fumosoroseus on Bemisia tabaci by utilizing plant source extract |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9399050B2 (en) * | 2000-10-04 | 2016-07-26 | Paul Edward Stamets | Controlling insects and arthropods using preconidial mycelium and extracts of preconidial mycelium from entomopathogenic fungi |
-
2013
- 2013-12-06 CN CN201310646232.XA patent/CN104073440B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008260764A (en) * | 2007-03-20 | 2008-10-30 | Sumitomo Chemical Co Ltd | Application method of microorganism-containing preparation |
| CN101182466A (en) * | 2007-11-20 | 2008-05-21 | 华南农业大学 | Paecilomyces Fumosoroseus strain and uses thereof |
| CN102630710A (en) * | 2012-04-10 | 2012-08-15 | 江苏省农业科学院 | Method for increasing infectivity of Paecilomyces fumosoroseus on Bemisia tabaci by utilizing plant source extract |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104073440A (en) | 2014-10-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104073440B (en) | One strain paecilomyces fumosoroseus and application thereof | |
| CN101851597B (en) | Streptomyces griseoflavus for resisting alfalfa diseases and screening method thereof | |
| CN109762759B (en) | Bacillus belgii GUAL203 and application thereof | |
| CN106754489A (en) | Methylotrophic bacillus F7 and its application | |
| CN102851219B (en) | Paecilomyces lilacinus and application thereof | |
| CN105219655B (en) | Aspergillus flavus biocontrol bacterial strain and its application of aflatoxin are not produced to fungicide resistance and | |
| CN109504638B (en) | Bacillus belgii GUAL210 and application thereof | |
| CN108384734B (en) | Biocontrol microbial inoculum for preventing and treating tobacco root and stem diseases and preparation method thereof | |
| WO2023000612A1 (en) | Fungicide for botryodiplodia theobromae and use thereof | |
| CN110157625A (en) | A kind of composite bacteria agent, preparation method and application for inhibiting to produce malicious aspergillus flavus | |
| CN109266559B (en) | A kind of application of Trichoderma harzianum LTR-2 | |
| CN110317747A (en) | A kind of bacillus amyloliquefaciens JT68 and its application in prevention and treatment tea anthracnose | |
| CN110074140A (en) | A kind of biocontrol agent, preparation method and application producing malicious aspergillus flavus | |
| Narayanasamy et al. | Frankia | |
| CN107760630B (en) | Bacillus methylotrophicus B18, microbial inoculum and application thereof | |
| CN110129212A (en) | One plant of Aspergillus flavus PEAS-10 and application thereof for not producing aflatoxin | |
| CN110305796A (en) | One plant of Aspergillus flavus PAF-1 and application thereof for not producing aflatoxin | |
| CN109852564A (en) | Bacillus amyloliquefaciens 327 and its application | |
| CN105018393A (en) | Bacillus megaterium strain and application thereof | |
| CN115747103B (en) | Sinorhizobium meliloti LQR-15 capable of promoting growth of traditional Chinese medicinal materials, microbial inoculum and application | |
| CN108315282B (en) | Bacillus methylotrophicus and application thereof in preventing and treating cercospora | |
| CN109055236B (en) | Isaria pinicola WSWM1171 and application thereof in prevention and control of potato corm moth pupae | |
| CN110122508B (en) | Antagonistic antibacterial agent for producing toxic aspergillus flavus, preparation method and application thereof | |
| CN113881576A (en) | Cordyceps javanicus Bd01 and application thereof | |
| CN105018394A (en) | Bacillus amyloiquefaciens strain and application thereof in rice false smut prevention and control |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| PP01 | Preservation of patent right | ||
| PP01 | Preservation of patent right |
Effective date of registration: 20180613 Granted publication date: 20160615 |
|
| PD01 | Discharge of preservation of patent | ||
| PD01 | Discharge of preservation of patent |
Date of cancellation: 20210613 Granted publication date: 20160615 |