CN115747130B - Culture medium for promoting destruxin Mr006 to produce spores, preparation and application thereof - Google Patents
Culture medium for promoting destruxin Mr006 to produce spores, preparation and application thereof Download PDFInfo
- Publication number
- CN115747130B CN115747130B CN202210572361.8A CN202210572361A CN115747130B CN 115747130 B CN115747130 B CN 115747130B CN 202210572361 A CN202210572361 A CN 202210572361A CN 115747130 B CN115747130 B CN 115747130B
- Authority
- CN
- China
- Prior art keywords
- culture
- culture medium
- metarhizium anisopliae
- spore
- production
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a culture medium for promoting the production of spores of Metarhizium anisopliae Mr006, and a preparation and application thereof, and belongs to the technical field of biology. The culture medium comprises the following components in percentage by mass: 40%; rice husk: 15%; maltose: 0.3%; soy flour: 15%; yeast powder: 5%; water: 23.5%; insect freeze-dried powder: 1.5%; zinc phosphate: 0.15%; ferrous sulfate: 0.1%; the insect body freeze-dried powder is spodoptera frugiperda insect body freeze-dried powder. Metarhizium leighmetarhiziumrileyi The Mr006 has a preservation number of CGMCC No.40171, and is preserved in the China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) on the 5 th month 9 th year 2022, and the preservation address is: no. 1 and No. 3 of the north cinquefoil of the morning sun area of beijing city. The component screening and the optimal design of culture conditions of a culture medium are carried out on a strain Mr006 which is derived from the Spodoptera frugiperda in corn fields, so that a culture method for better promoting the production of spores of the Metarhizium anisopliae Mr006 is found, and support is provided for the application of the Metarhizium anisopliae Mr 006.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a culture medium for promoting the production of spores of Metarhizium anisopliae Mr006, a preparation and application thereof, in particular to a culture method for promoting the production of spores of Metarhizium anisopliae, which is applied to the prevention and control of lepidoptera pests such as spodoptera frugiperda.
Background
At present, the damage of pests to crops is one of the important factors causing agricultural yield reduction. The long-term and large-scale use of chemical pesticides brings a series of side effects of exceeding pesticide residues of agricultural products, rising the resistance level of the pests year by year, polluting the environment and the like while killing the pests. In view of this, biological control is increasingly being considered, and the use of entomopathogenic microorganisms for pest control is one of the important means for pest biological control. Compared with other insecticidal microorganisms, the insecticidal fungi have the advantages of being popular, friendly to the environment, not easy to generate drug resistance and the like, and play an important role in biological control of pests.
Metarhizium leighMetarhizium rileyi) Is widely distributed entomopathogenic fungi in China, can infect various lepidoptera pests, has extremely high infectivity on spodoptera pests such as spodoptera frugiperda, spodoptera exigua, spodoptera soyata, spodoptera litura and the like, and has higher development and utilization values.
The spore yield, the spore production time and the like are important factors influencing the application of the Metarhizium anisopliae strain. At present, the green muscardine fungus fermentation substrate mostly adopts low-cost agricultural and sideline products such as wheat bran, corn flour, rice flour and the like as nutrients so as to obtain the maximum spore yield. In optimizing the matrix combination, shortening of spore production time is hardly considered as an index, and only spore yield is targeted.
The most commonly used culture media for culturing the Metarrhizium anisopliae in the laboratory are a saxomaltose-yeast culture medium and a potato culture medium, but the problems of low spore yield, low spore germination rate, long spore production period, high cost and the like still exist. At present, few researches on the spore yield and spore production time of the Metarhizium anisopliae are reported on inorganic salt metal ions and worm tissues.
Metarhizium anisopliae Mr006 is obtained by separating and identifying Spodoptera frugiperda stiff insects infected with entomogenous fungi in the field from investigation of the Taihe corn planting area by a biological control team of a plant protection and agricultural product quality safety institute of Anhui province. Specific sequencing results were as follows (540 bp):
GCTACCTGATTCGAGGTCACTCTTGGAGAAGTTTGTGCGTTTTACGGCAGTGGCCGCGCCGCGCTCCTGTTGCGAGGTTGTGCTACTACGCAGAGGAGGCCGCGACGGGGCCGCCAATTCATTTCGGGGGCGGCGCCGCAGGGAACCGCCTGAGCGGCCCGGCTGACAATCGCCGGCCCCCAACACCAAACCGCGGGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTTGTATGATTCCACTCAGACGTGCCAAAGGCTAAGAGATACAGAGTTTCGGTCCCGCGGCGGGCGCCTGTTTCCGGGCGGGCTCTGGACGAGCCCGGTCCGGGGCAAATGACCCGCCGAGGCAACAGGAAAAGGGTATAAGTTCACATGGGGTTGGGAGTGA
experiments show that the spodoptera frugiperda and corn borer obtained by laboratory separation have good effects. Based on the method, the solid fermentation spore production test of the destruxia of the Metarrhizium anisopliae Mr006 with different components of culture media is carried out by adding inorganic salt metal ions, worm tissues and the like, so as to simplify the production process, shorten the spore production time, improve the spore yield and reduce the production cost, and the culture method for promoting the production of the spores of the destruxia of the Metarrhizium anisopliae Mr006 is obtained.
Disclosure of Invention
1. Problems to be solved
Aiming at the problems of the prior art, the aim is to provide a culture method for promoting the production of spores of Metarhizium anisopliae Mr006 so as to provide support for the post-fermentation production.
2. Technical proposal
In order to solve the problems, the invention adopts the following technical scheme.
A culture medium for promoting the production of spores of Metarhizium anisopliae Mr006,
the culture medium comprises the following components in percentage by mass,
40% of rice;
15% of rice hulls;
maltose 0.3%;
15% of soybean powder;
5% of yeast powder;
23.5% of water;
1.5% of insect freeze-dried powder;
0.15% of zinc phosphate;
ferrous sulfate 0.1%;
the insect body freeze-dried powder is spodoptera frugiperda insect body freeze-dried powder;
the Metarhizium anisopliae metarhizium rileyi Mr006 has a preservation number of CGMCC NO.40171, and is preserved in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) at a preservation address of: beijing, chaoyang area, north Chenxi Lu No. 1, 3;
a Metarhizium anisopliae Mr006 preparation is prepared by culturing the culture medium and adding adjuvants, and the preparation is suspension.
Use of a medium as described in the preceding paragraph for promoting spore production.
An application of the Metarhizium anisopliae Mr006 preparation in promoting spore production.
3. Advantageous effects
Compared with the prior art, the invention has the beneficial effects that:
metarhizium anisopliae is an entomopathogenic fungus with strong pathogenicity to nocturnal larvae, and often causes high-intensity insect epidemics in nature. Most fungi research works require indoor artificial culture of the fungi, and the nutrient composition requirements of different fungi on the culture medium are greatly different. The destruxin is generally cultured by adopting a malt sugar yeast agar medium (Sabouraudmaltose agarsupplementedyeast extract, SMAY), and the culture medium is balanced in the aspects of hypha growth, spore yield, spore production speed and the like of fungi, but has longer growth period and lower spore yield. Different strains may also react differently to the culture components, and thus the composition of the optimal medium varies from strain to strain. In view of the above, in order to better develop related researches on the Metarrhizium anisopliae, component screening and culture condition optimization design are carried out on a strain Mr006 separated from the Metarrhizium anisopliae in corn fields so as to find a culture method for better promoting the Metarrhizium anisopliae Mr006 to produce spores, and support is provided for the application of the Metarrhizium anisopliae Mr 006.
In order to obtain a culture method for better promoting the sporulation of the Metarrhizium anisopliae Mr006, on the basis of optimizing a laboratory culture medium and culture conditions, screening pilot fermentation components, amplifying culture and analyzing the influence on the sporulation starting time and sporulation quantity.
The invention provides a culture method for promoting the production of spores of Metarhizium anisopliae Mr 006:
(1) Weighing the following raw materials according to the weight (kg) proportion, and uniformly mixing: 40% of rice, 15% of rice husk, 0.3% of maltose, 15% of soybean meal, 5% of yeast powder, 23.5% of water, 1.5% of spodoptera frugiperda lyophilized powder, 0.15% of zinc phosphate and 0.1% of ferrous sulfate;
(2) After the evenly mixed raw materials are kept stand and soaked for 4 hours, the raw materials are packed into bags and sterilized for 50 minutes at 121 ℃, the liquid seed bacterial liquid of the Metarhizium anisopliae Mr006 is inoculated after the temperature is reduced to 30 ℃, the inoculum size is 10 percent, and after the evenly mixed raw materials are stirred, the raw materials are firstly cultured in a 28 ℃ illumination incubator (16L/8D, alternate light and dark) and are cultured for 3 days; the temperature was adjusted to 24℃and the light (23L/1D, light-dark alternation) was continued to culture, and after 14D of culture, the fermentation was stopped, and the samples were taken and examined at regular intervals.
(3) Washing the conidium collected from the solid fermentation culture medium with Tween-80 solution to obtain conidium solution, preparing into dilution solution with proper concentration by 10 times dilution method, observing under microscope by using cell counting method, and calculating the spore amount.
Detailed Description
The invention is further described below in connection with specific embodiments.
1. Materials and methods
Material
Metarhizium anisopliae Mr006 was isolated from Spodoptera frugiperda by this laboratory and stored.
Saxomaltose-yeast medium: maltose 4%, peptone 1%, yeast extract powder 1%, agar 1.5%.
Spodoptera frugiperda body freeze-dried powder: the 6-year-old larvae fed by a laboratory are subjected to ultralow temperature freeze drying, and are added with liquid nitrogen for grinding and crushing to obtain the feed.
Liquid seed medium: maltose 4%, peptone 1%, yeast extract powder 1%, zinc sulfate 0.15%, ferrous sulfate 0.1%.
Raw materials and inorganic salts for solid fermentation media: rice, rice hull, maltose, soybean meal, yeast powder, water, zinc sulfate, ferrous sulfate and the like.
The main equipment comprises: a steam sterilizer, an ultra-clean workbench, a temperature-control shaking table, a temperature-control biochemical incubator, a balance, a microscope, a spore collector and the like.
Method
Spore production start time: in the mycelium growth process, when green powder starts to appear, immediately picking out, checking under a microscope, and determining the conidium as the starting time of sporogenesis.
Spore count: scraping the spore powder collected after fermentation from the culture medium (material) or collecting the spore powder by a spore collector, putting the spore powder into a 100mL conical flask, adding sterile water containing 0.05% Tween-80, stirring for 30min on a magnetic stirrer to fully disperse spores to prepare uniform spore suspension, and determining the spore amount by a haemocytometer method.
LC 50 Value measurement: the collected spore powder was prepared into 1×10 powder with sterile water of 0.05% Tween-80 4 Per mL, 1X 10 5 Per mL, 1X 10 6 Per mL, 1X 10 7 Per mL, 1X 10 8 Five concentration spore suspensions per mL. At each concentrationSpodoptera littoralis larvae 20 heads at 3 years old were treated with 0.05% tween-80 water as a control. Inoculating bacterial solutions with different concentrations, then placing the bacterial solutions into a phytotron for breeding, observing and recording the death number of the insects for 10 days. Repeated 3 times. Calculating LC 50 Values.
The infection rate result of the destruxer's metarhizium anisopliae Mr006 spores: after the optimal combination and the common combination are used for respectively culturing, the destruxin Mr006 spore powder is obtained, and the concentration is respectively set to be 1 multiplied by 10 4 Per mL, 1X 10 5 Per mL, 1X 10 6 Per mL, 1X 10 7 Per mL, 1X 10 8 Five concentration spore suspensions per mL for 10 treatments, 20 head worms per treatment, 4 replicates. Selecting 3-instar larvae of spodoptera frugiperda with consistent growth, treating the spore suspension by a pest dipping method, and detecting the larva carrier rate for 24 hours.
Results of the green muscardine fungus Mr006 potting test: respectively culturing by using the optimal combination and the common combination to obtain the destruxin Mr006 spore powder according to mass percent
Metarhizium anisopliae Mr006 1×10 9 Spores/g;
EL10 5%；
T-40 5%；
4% of calcium dodecyl benzene sulfonate;
0.03% of strigolactone;
0.5% of organic silicon defoamer;
magnesium aluminium silicate 0.5%
Xanthan gum 0.1%
Rapeseed oil balance.
The preparation method comprises the following steps: grinding solid auxiliary agents such as an active ingredient thickener and the like in an oil phase carrier through a sand mill according to a formula, adding the rest auxiliary agent substances according to the formula, then adding the destruximab Mr006 spore powder, adjusting to the required concentration, fully shearing and uniformly stirring to obtain a finished product.
200 corn seedlings obtained by indoor potting are inoculated with 3-year larvae of spodoptera frugiperda, and each 2 corn seedlings are planted. 10 hundred million spores/milliliter of Metarhizium anisopliae Mr006 dispersible oil suspending agent is sprayed on 100 g of stems and leaves for each mu, and the control effect is investigated in 5 days, 7 days, 14 days and 21 days respectively.
2. Results and analysis
Promote optimization of culture conditions of destruxin Mr006 spore production and spore production
Based on the early test, a saxomaltose-yeast culture medium (SMAY) is adopted, and (1) an illumination incubator at 28 ℃ is respectively arranged for culture (16L/8D, light and dark alternate) for 14D; (2) Culturing in an illumination incubator at 28 ℃ for 3D (16L/8D, alternate light and dark); adjusting the temperature to 24 ℃, and continuously culturing by illumination (23L/1D, alternate light and dark) for 14D; and comparing the spore yield.
The Metarhizium anisopliae Mr006 grows well under the culture condition (2), the spore production starting time is early, and after 14d culture, the spore production amount reaches 8.2 multiplied by 10 8 Individual/cm 2 While the spore yield of the culture condition (1) is 1×10 8 Individual/cm 2 The method comprises the steps of carrying out a first treatment on the surface of the . Therefore, the temperature is reduced in the later period, the spore production is facilitated under the dark condition, the culture condition (2) is obviously better than the culture condition (1), and the subsequent experiment is confirmed to be carried out under the culture condition (2).
Promote optimization of the culture component of the beauveria bassiana Mr006 spore production
Based on the early test, adding a proper amount of inorganic salt and insect freeze-dried powder (see table 1 in detail) into a saxomaltose-yeast culture medium (SMAY) respectively, taking the saxomaltose-yeast culture medium (SMAY) without the addition as a control, and culturing for 3 days according to the culture condition (2), namely, culturing in an illumination incubator at 28 ℃ (16L/8D, alternate light and dark); adjusting the temperature to 24 ℃, and continuously culturing by illumination (23L/1D, alternate light and dark) for 14D; during which the starting time of the production of spores was determined and the final spore yield was compared.
TABLE 1 results of optimization experiments on Medium composition
| Component braiding Number (number) | Insect freeze-dried powder （%） | Dipotassium hydrogen phosphate （%） | Manganese sulfate （%） | Calcium chloride （%） | Zinc sulfate （%） | Ferrous sulfate （%） | Start time of spore production （d） | Average sporulation (108 +. cm2） | LC50 values (106) personal/mL) |
| 1 | 1 | - | - | - | - | - | 6 | 8.5 | 2.6 |
| 2 | 1.5 | - | - | - | - | - | 6 | 9.2 | 2.2 |
| 3 | 2 | - | - | - | - | - | 6 | 9.3 | 2.0 |
| 4 | - | 0.05 | - | - | - | - | 8 | 7.5 | 6.6 |
| 5 | - | 0.1 | - | - | - | - | 8 | 7.6 | 6.5 |
| 6 | - | 0.15 | - | - | - | - | 8 | 8.1 | 6.3 |
| 7 | - | - | 0.05 | - | - | - | 7 | 7.8 | 6.2 |
| 8 | - | - | 0.1 | - | - | - | 7 | 7.5 | 6.1 |
| 9 | - | - | 0.15 | - | - | - | 7 | 7.6 | 6.3 |
| 10 | - | - | - | 0.05 | - | - | 9 | 3.5 | 15.3 |
| 11 | - | - | - | 0.1 | - | - | 9 | 2.0 | 25.6 |
| 12 | - | - | - | 0.15 | - | - | 9 | 1.2 | 46.2 |
| 13 | - | - | - | - | 0.05 | - | 4 | 8.2 | 5.6 |
| 14 | - | - | - | - | 0.1 | - | 4 | 8.4 | 5.3 |
| 15 | - | - | - | - | 0.15 | - | 4 | 8.6 | 5.3 |
| 16 | - | - | - | - | - | 0.05 | 5 | 8.6 | 5.9 |
| 17 | - | - | - | - | - | 0.1 | 5 | 8.8 | 5.6 |
| 18 | - | - | - | - | - | 0.15 | 5 | 8.8 | 5.5 |
| CK | - | - | - | - | - | - | 8 | 8.2 | 6.3 |
As is clear from the results in Table 1, in saxomaltose-Adding different inorganic salts, insect lyophilized powder, and LC for starting time, spore yield, and spore yield of Metarhizium anisopliae Mr006 50 The values all have an effect. Calcium chloride inhibits growth, the spore production starting time is delayed, the spore production amount is obviously reduced, and LC 50 The value rises significantly; dipotassium hydrogen phosphate has little influence on the spore yield; manganese sulfate can properly advance spore production starting time, for LC 50 The value has little influence; the zinc sulfate advances the spore production starting time from 8 days to 4 days, and the spore production amount is increased along with the increase of the addition amount, and the highest spore production amount can reach 8.6X10 8 Individual/cm 2 ，LC 50 The value drops slightly; the ferrous sulfate advances the spore production starting time from 8 days to 5 days, and the spore production amount is obviously improved, which can reach 8.8x10 at most 8 Individual/cm 2 ， LC 50 The value drops slightly; the addition of the lyophilized powder of the insect body can also shorten the starting time of spore production, improve the spore yield and reach 9.3X10 at most 8 Individual/cm 2 Can significantly reduce LC 50 Values.
Therefore, the zinc sulfate, ferrous sulfate and spodoptera frugiperda freeze-dried powder can obviously shorten the spore production starting time, improve the spore yield and improve the toxicity of the Mr006 strain.
Metarhizium leigh Mr006 solid fermentation process
According to the component proportions in the table 2, optimizing a culture medium containing spodoptera littoralis freeze-dried powder, and determining an optimal solid fermentation process suitable for Metarhizium anisopliae Mr006 by taking the spore production starting time and the spore production amount as indexes.
Inoculating stored Metarhizium anisopliae Mr006 into liquid seed culture medium, culturing for 3-5 days, and stopping culturing when mycelium pellet appears when the culture solution is turbid. Mixing the materials according to the treatment of table 2, standing and soaking for 4 hours, bagging for high-pressure sterilization at 121 ℃ for 50 minutes, inoculating the destruxia armeniacae Mr006 liquid seed bacterial liquid after the temperature is reduced to 30 ℃, stirring and mixing uniformly, fermenting and culturing at 28 ℃ for 72 hours, reducing the temperature to 24 ℃, continuing culturing, determining the spore production starting time until the spore production is complete, stopping fermentation, and sampling and checking at regular time. And after fermentation, collecting spore powder by utilizing a spore collector, and calculating the spore yield.
TABLE 2 results of Metarhizium anisopliae Mr006 solid fermentation experiments
| Component (A) Numbering device | Rice （%） | Rice husk （%） | Maltose （%） | Soybean powder （%） | Yeast powder （%） | Insect freeze-drying Powder (%) | Zinc sulfate （%） | Ferrous sulfate （%） | Water and its preparation method （%） | Start time of spore production （d） | Average spore yield (109/g) | LC50 values (106) personal/mL) |
| 1 | 35 | 20 | 0.2 | 20 | 3 | 1 | 0.1 | 0.15 | 21 | 6 | 9.1 | 4.2 |
| 2 | 40 | 15 | 0.3 | 15 | 7 | 2 | 0.15 | 0.1 | 21 | 5 | 9.6 | 3.8 |
| 3 | 45 | 10 | 0.4 | 10 | 5 | 1.5 | 0.2 | 0.05 | 28.5 | 5 | 8.8 | 4.0 |
| 4 | 35 | 20 | 0.4 | 10 | 7 | 1 | 0.2 | 0.15 | 27 | 4 | 9.2 | 4.5 |
| 5 | 40 | 15 | 0.3 | 15 | 5 | 1.5 | 0.15 | 0.1 | 23.5 | 4 | 11.2 | 3.3 |
| 6 | 45 | 10 | 0.2 | 20 | 3 | 2 | 0.1 | 0.05 | 20 | 5 | 8.3 | 4.1 |
| 7 | 35 | 20 | 0.2 | 20 | 3 | 2 | 0.1 | 0.05 | 20 | 5 | 8.6 | 4.5 |
| 8 | 40 | 15 | 0.3 | 10 | 5 | 1.5 | 0.2 | 0.15 | 28.5 | 4 | 8.9 | 4.3 |
| 9 | 45 | 10 | 0.4 | 15 | 7 | 1 | 0.15 | 0.1 | 22 | 4 | 7.2 | 4.9 |
| 10 | 35 | 20 | 0.4 | 20 | 7 | 2 | 0.2 | 0.05 | 16 | 6 | 8.6 | 4.3 |
| 11 | 40 | 15 | 0.3 | 10 | 5 | 1.5 | 0.15 | 0.1 | 28.5 | 5 | 10.2 | 3.5 |
| 12 | 45 | 10 | 0.2 | 15 | 3 | 1 | 0.1 | 0.15 | 26 | 5 | 8.0 | 5.1 |
| 13 | 35 | 20 | 0.2 | 20 | 3 | - | - | -- | - | 8 | 2.6 | 8.51 |
| 14 | 40 | 15 | 0.3 | 15 | 7 | - | - | - | -- | 9 | 2.1 | 8.94 |
| 15 | 45 | 10 | 0.4 | 10 | 5 | - | - | - | - | 9 | 1.6 | 8.36 |
From the test results in Table 2, it can be seen that: the solid fermentation culture mediums with different component ratios have short spore production starting time and great spore production quantity influence difference on the Metarhizium anisopliae Mr006, and the maximum 15 treated spore quantities are 11.2 multiplied by 10 9 At least 1.6X10 g/g 9 Individual/g; the spore production starting time is at the earliest 4d and at the latest 9d. LC (liquid Crystal) device 50 The minimum value is 3.3X10 6 And a total of 8.94X10 g/mL 6 And each mL. Wherein the treatment 5 is combined optimally, the spore production time is shortened from 9 days to 4 days, and the spore production amount can be increased to 11.2×10 9 Each/g. LC (liquid Crystal) device 50 The value was 3.3X10 6 The spore production time is shortened from 9 days to 5 days, and the spore production amount can be increased to 10.2X10 after each mL and the treatment is combined with 11 9 Each/g. LC (liquid Crystal) device 50 The value was 3.5X10 6 And each mL.
Therefore, after the optimized component proportions such as zinc sulfate, ferrous sulfate and spodoptera frugiperda freeze-dried powder are added, the starting time of the spore production of the Metarhizium anisopliae Mr006 is shortened, the spore production is improved, and the toxicity to spodoptera frugiperda is improved.
Metarhizium anisopliae Mr006 spore infection rate results
From the results in table 3, it can be seen that: along with the increase of the concentration of the spores of the Metarhizium anisopliae Mr006, the infection rate is correspondingly increased. When the concentration of the spores of the Metarhizium anisopliae Mr006 is higher than 1 multiplied by 10 5 The infection rate of spores obtained by optimal combination culture (adding zinc sulfate, ferrous sulfate and spodoptera frugiperda freeze-dried powder) is higher than that of the common combination (without the additives). Therefore, the addition of zinc sulfate, ferrous sulfate and spodoptera frugiperda lyophilized powder is beneficial to improving the infection rate of the destruximab Mr006 spores of the Metarhizium anisopliae on spodoptera frugiperda larvae.
TABLE 3 relationship between the infection rate of Metarhizium anisopliae Mr006 to Spodoptera frugiperda larvae and spore concentration level
Results of the experiment on the potted destruxins of Metarhizium anisopliae Mr006 spores
From the results in table 4, it can be seen that: the 10 hundred million spores/milliliter of the beauveria bassiana Mr006 dispersible oil suspension agent has better control effect on spodoptera frugiperda in a potting test. At the same time after the medicine, the control effect of the spore processed 10 hundred million spores/milliliter of the destruximab Mr006 dispersible oil suspending agent obtained by optimal combination culture (adding zinc sulfate, ferrous sulfate and spodoptera frugiperda freeze-dried powder) is higher than that of the common combination (without the additives). Therefore, the addition of the zinc sulfate, the ferrous sulfate and the spodoptera frugiperda lyophilized powder is beneficial to improving the control effect of the Metarhizium anisopliae Mr006 spores on spodoptera frugiperda larvae.
Table 4 application effect of Metarhizium anisopliae Mr006 spores in spodoptera frugiperda control
Conclusion: 40% of rice, 15% of rice husk, 0.3% of maltose, 15% of soybean meal, 5% of yeast powder, 23.5% of water, 1.5% of spodoptera frugiperda lyophilized powder, 0.15% of zinc phosphate and 0.1% of ferrous sulfate; is the optimal combination of the destruxin Mr006 solid fermentation matrixes; after the evenly mixed raw materials are kept stand and soaked for 4 hours, the raw materials are packed into bags and sterilized for 50 minutes at 121 ℃, the liquid seed bacterial liquid of the Metarhizium anisopliae Mr006 is inoculated after the temperature is reduced to 30 ℃, the inoculum size is 10 percent, and after the evenly mixed raw materials are stirred, the raw materials are firstly cultured in a 28 ℃ illumination incubator (16L/8D, alternate light and dark) and are cultured for 3 days; the temperature was adjusted to 24℃and the fermentation was stopped after culturing was continued by adjusting the temperature to 24℃and light (23L/1D, alternate light and dark).
After the optimized component proportions of zinc sulfate, ferrous sulfate, spodoptera frugiperda freeze-dried powder and the like are added, the starting time of the spore production of the Metarhizium anisopliae Mr006 is shortened, the spore production is improved, and the toxicity of spodoptera frugiperda is improved. At present, no relevant report is found in the literature report.
Claims (2)
1. A culture medium for promoting the production of spores of Metarhizium anisopliae Mr006 is characterized in that:
the culture medium comprises the following components in percentage by mass,
40% of rice;
15% of rice hulls;
maltose 0.3%;
15% of soybean powder;
5% of yeast powder;
23.5% of water;
1.5% of insect freeze-dried powder;
0.15% of zinc phosphate;
ferrous sulfate 0.1%;
the insect body freeze-dried powder is spodoptera frugiperda insect body freeze-dried powder;
the preservation number of the destruxin Mr006 is CGMCC NO.40171, and the destruxin is preserved in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) at 5 and 9 days 2022;
the application method of the culture medium in promoting spore production is as follows:
standing and soaking the raw materials of the culture medium after uniform mixing for 4 hours, bagging, sterilizing at 121 ℃ for 50 minutes under high pressure, inoculating the destruxia armeniacae Mr006 liquid seed bacterial liquid after the temperature is reduced to 30 ℃, stirring and uniformly mixing, and culturing in a 28 ℃ illumination incubator under the culture condition of 16L/8D and alternate light and dark for 3 days; the temperature is regulated to be 24 ℃, the illumination is 23L/1D, the light and the dark are alternated, the culture is continued, the fermentation is stopped after 14D of culture, and the sampling inspection is carried out at regular time.
2. A preparation of metarhizium anisopliae Mr006, which is characterized in that: prepared by culturing the culture medium according to claim 1 and adding auxiliary agents, wherein the preparation is a dispersible oil suspending agent; the preservation number of the Metarhizium anisopliae Mr006 is CGMCC NO.40171, and the Metarhizium anisopliae Mr006 is preserved in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) at 5 and 9 days.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210572361.8A CN115747130B (en) | 2022-05-25 | 2022-05-25 | Culture medium for promoting destruxin Mr006 to produce spores, preparation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210572361.8A CN115747130B (en) | 2022-05-25 | 2022-05-25 | Culture medium for promoting destruxin Mr006 to produce spores, preparation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115747130A CN115747130A (en) | 2023-03-07 |
| CN115747130B true CN115747130B (en) | 2023-07-07 |
Family
ID=85349479
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210572361.8A Active CN115747130B (en) | 2022-05-25 | 2022-05-25 | Culture medium for promoting destruxin Mr006 to produce spores, preparation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115747130B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116555050B (en) * | 2023-06-05 | 2024-01-05 | 安徽省农业科学院植物保护与农产品质量安全研究所 | Method for propagating Metarhizium anisopliae Mr006 and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009035925A2 (en) * | 2007-09-13 | 2009-03-19 | The United States Of America, As Represented By The Secretary Of Agriculture | Composition of entomopathogenic fungus and method of production and application for insect control |
| CN111471600A (en) * | 2020-05-08 | 2020-07-31 | 北京化工大学 | Culture medium for preparing metarhizium anisopliae spore powder and preparation method of metarhizium anisopliae high spore powder |
| CN111662828A (en) * | 2020-06-30 | 2020-09-15 | 福建省农业科学院植物保护研究所 | Metarhizium leylanicum and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050095259A1 (en) * | 2003-11-04 | 2005-05-05 | Liu Chien Y. | Manufacturing method for entomopathogenic fungi |
| CN103087924A (en) * | 2012-11-27 | 2013-05-08 | 河南省农业科学院 | Entomogenous fungus Nomuraearileyi, as well as culture method and application thereof |
| CN104673740B (en) * | 2015-03-10 | 2017-07-18 | 聊城大学 | Promote the culture medium and preparation method of Nomuraea rileyi production spore |
| CN111235039B (en) * | 2020-03-04 | 2020-09-22 | 安徽省农业科学院植物保护与农产品质量安全研究所 | Culture medium for culturing metarhizium anisopliae with high toxicity, preparation and application thereof |
-
2022
- 2022-05-25 CN CN202210572361.8A patent/CN115747130B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009035925A2 (en) * | 2007-09-13 | 2009-03-19 | The United States Of America, As Represented By The Secretary Of Agriculture | Composition of entomopathogenic fungus and method of production and application for insect control |
| CN111471600A (en) * | 2020-05-08 | 2020-07-31 | 北京化工大学 | Culture medium for preparing metarhizium anisopliae spore powder and preparation method of metarhizium anisopliae high spore powder |
| CN111662828A (en) * | 2020-06-30 | 2020-09-15 | 福建省农业科学院植物保护研究所 | Metarhizium leylanicum and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115747130A (en) | 2023-03-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108277177B (en) | Streptomyces microflavus solid fermentation medium, preparation method and fermentation method thereof, fermentation product, biocontrol product and application | |
| CN113215016B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN110295129B (en) | Biocontrol bacterium for preventing and treating gray mold and powdery mildew of cucumber and application thereof | |
| CN111235039B (en) | Culture medium for culturing metarhizium anisopliae with high toxicity, preparation and application thereof | |
| CN115261283A (en) | Bacillus cereus and application thereof in prevention and control of dry farming potato diseases | |
| CN115747130B (en) | Culture medium for promoting destruxin Mr006 to produce spores, preparation and application thereof | |
| CN109749953B (en) | Bacillus cereus, microbial inoculum and preparation method and application thereof | |
| CN111808778B (en) | Bacillus wegener for preventing and treating verticillium wilt and culture method thereof, microbial inoculum and preparation method and application thereof | |
| CN116555050B (en) | Method for propagating Metarhizium anisopliae Mr006 and application thereof | |
| CN108913625A (en) | Salt tolerant streptomycete, its microbial inoculum and its microbial inoculum are promoting the application in plant growth | |
| CN110184197B (en) | Beauveria bassiana oil suspending agent | |
| CN116064284B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN115806880A (en) | Beauveria bassiana, separation and screening method thereof and application of beauveria bassiana in controlling bitter orange insect damage | |
| CN115747082A (en) | Beauveria bassiana solid culture medium and application thereof | |
| CN113278541B (en) | Rice endophytic bacillus beijerinus and application thereof | |
| CN115725419A (en) | Phosphorus-dissolving blueberry endophytic trichoderma and application thereof | |
| CN112063554B (en) | Biological control bacterium Pantoea jilinensis D25 and application thereof | |
| CN111088186A (en) | Bacillus, microbial agent and application thereof | |
| CN111394259B (en) | Preparation method of DSE dry microbial inoculum capable of promoting plant growth and easy to store and transport | |
| CN111808785B (en) | Honghuadan endophytic Bacillus belgii and application thereof | |
| CN111139199B (en) | Bacillus amyloliquefaciens CGMCC No.17843 and application thereof | |
| CN117363489B (en) | Sphaerotheca longifolia with cucumber growth promoting and disease resisting functions and application thereof | |
| CN118345014B (en) | Bacillus belicus and application thereof | |
| CN116218742B (en) | Bacillus licheniformis for antagonizing phytophthora digger and application thereof | |
| CN110218684B (en) | Streptomyces TJ561, product for preventing and treating soil continuous cropping obstacle, preparation method and application thereof, and application of eugenol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |