CN110073898A - A kind of ladder rib hickory chick strain the factorial production and northern facility cultivation technique - Google Patents
A kind of ladder rib hickory chick strain the factorial production and northern facility cultivation technique Download PDFInfo
- Publication number
- CN110073898A CN110073898A CN201910475042.3A CN201910475042A CN110073898A CN 110073898 A CN110073898 A CN 110073898A CN 201910475042 A CN201910475042 A CN 201910475042A CN 110073898 A CN110073898 A CN 110073898A
- Authority
- CN
- China
- Prior art keywords
- hickory chick
- strain
- mushroom
- rib hickory
- terraced
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G18/00—Cultivation of mushrooms
Abstract
A kind of ladder rib hickory chick strain the factorial production and northern facility cultivation technique, terraced rib hickory chick strain are terraced rib hickory chick HS-YDJ07, deposit number are as follows: CGMCC No.14347；It is cultivated using terraced rib hickory chick HS-YDJ07 as parent species, bacterium germination, terraced rib hickory chick strain factory production technique flow is: female parent selection, Mother culture, parent species purification, detoxification, parent species preservation, original seed inoculation and culture, cultivar inoculation and being cultivated etc.；Carry out management of producing mushroom and harvesting by parent species of terraced rib hickory chick HS-YDJ07, terraced rib hickory chick northern facility cultivation technique process flow is: canopy room preparations, strain preparation, sowing, earthing, germicidal management, nutrient bag put, management of producing mushroom, regrowth hair mushroom manage etc..The invention is at low cost, process is simple, the period is short, reproducible, both promotes increasing peasant income, is conducive to ecological protection, provides a new cultivated strains for hickory chick industrialized development.
Description
Technical field
The present invention relates to the terraced rib hickory chick strain the factorial production in one of technology field of Edible Fungi and
The batch production of northern facility cultivation technique, in particular to edible fungus species is bottled and the preparation of packed strain and facilityization cultivation side
Method.
Background technique
Terraced rib hickory chick (scientific name: Morchella importuna), Chinese is according to the cap feature of this kind, because vertically
Tabula between ridge and ridge and ridge is named as " terraced rib hickory chick ", and also someone is referred to as scalariform hickory chick.
Terraced rib hickory chick is the important hickory chick kind that China scientific research personnel successfully tames in recent years, because of the kind
The cap surface tabula between sharp crest and ridge and ridge from top to bottom, makes it gain the name as ladder.The kind is in China
Sichuan, Yunnan, South-western Hubei distribution.The kind belongs to black hickory chick direct line in classification, is current Chinese hickory chick people
The main lines of work cultivation.The ladder in the north insults hickory chick strain the factorial production and facility cultivation technique is in rapid development
Stage.
Biomorph feature: ascocarp 6.0-20.0cm high, cap 3.0-15.0cm high, the widest part 2.0-9.0cm, circular cone
Shape is conical to width, accidental oval；The backbone of 12-20 vertical direction, and a large amount of staggered transverse ridges, show ladder one
Sample it is ladder-like；There are 2-5mm depth, the recess of 2-5mm wide in stem and cap junction；Ridge is smooth or has slight villus, when children is tender
Pale asphyxia is to Dark grey, as maturation gradually becomes dark-grey brown to near-black；Ridge blunt rounded on the whole when children is tender, after mature
Become sharp keen or corrodes shape；Pit extends on each stage of development in vertical direction, and the smooth or slight villus of tool is in after aging
Crack shape, from grey of children when tender to Dark grey as maturation gradually becomes taupe, olive colour or brown color；Stem 3.0-
10.0cm high, 2.0-6.0cm wide, usual base portion is at rodlike to close rodlike, and surface is smooth or accidental white powder particle, mature mistake
Gradually development has longitudinal ridge and chamber in journey, especially in the position of stem base portion；For stem white to light brown, bacterial context is white
Hollow to water soaking mode brown, 1-3mm is thick, and stem base portion is in stacked chamber sometimes；The internal layer surface white of infertility, has villus；Eight
Sporangiospore, 18-24 × 10-13 μm, ellipse, smooth, homogeneity；125-300 × 10-30 μm of ascus；Cylindrical tip is blunt
Circle, it is colourless；150-250 × 7-15 μm of lateral filament, cylinder tool it is round to nearly rodlike, close taper or closely fusoid top have every,
It is in colourless to sepia for adding 2% KOH；125-300 × 10-35 μm of bristle on sterile ridge, have every, add 2% KOH in colourless or
Brown is to sepia, the cylindric tool circular top of apical cell, nearly head, head, nearly coniform or close fusiform.
Growing environment: Chang Fasheng is in garden, villa garden, timber mill and the city of Pacific Northwest and California the north
Under afforestation forest, annual March to May occurs, this kind is also considered as apparent saprophytic form hickory chick kind, even on a small quantity
Sample once report there is certain relationship to related trees, be once considered as one of the hickory chick kind of " most easily successfully cultivate ".
The patent No. 00112812.4 discloses a kind of cultural method of hickory chick, the cultural method the problem is that: only
There is cultivation technique, is not related to strain production technology；Cultivation technique narration is not detailed；The field production hickory chick technology that it is provided is not
It is suitble to the north to use.
The patent No. 201510362273.5 discloses stuff cultivation method of building up one's health after a kind of hickory chick batch production, the cultivation side
Method the problem is that: only cultivation technique, be not related to strain production technology；Its cultivation technique is only applicable in pergola system, needs
It sterilized, disinfected to compost using pasteurization, consumed energy larger, a large amount of compost source is more difficult.
The patent No. 201610049355.9 discloses liquid spawn mating system and the factory culture side of a kind of hickory chick
Method, the cultural method the problem is that: the production technology for the hickory chick liquid spawn that the patent provides, liquid spawn is not easy to store up
It deposits and transports；The bag that the patent provides plants technology, needs to dig cultivation pit in canopy room, the amount of labour used is larger.The technology is not suitable for north
The hickory chick production of side, only refers only to hickory chick cultivation technique, does not refer to the cultivation technique of terraced rib hickory chick.
The cultural method of the terraced rib hickory chick in the north in the prior art: in terraced rib hickory chick strain production, hydration-treated, cultivation
Step is planted and is managed and protected in bag production, and terraced rib hickory chick Spawn incubation, culture material use, solid spawn is broadcasted sowing, hydration-treated, guarantor
Holding the preparation of soil moisture etc. and using above there is also some problems.Production cycle is long, and product price is high.Therefore, it develops
Developing a kind of terraced rib hickory chick strain the factorial production and northern facility cultivation technique is always project anxious to be resolved.
Summary of the invention
The purpose of the present invention is to provide a kind of terraced rib hickory chick strain the factorial production and northern facility cultivation technique,
It solves the problems, such as exist, realizes that terraced rib hickory chick strain carries out the bottled and packed production of batch production, for hickory chick after cultivation
Facility metaplasia produces.
Terraced rib hickory chick (Morchella importuna) HS-YDJ07 of the invention is protected on June 30th, 2017
China Committee for Culture Collection of Microorganisms's common micro-organisms center, abbreviation CGMCC are ensconced, address is Chaoyang District, Beijing City north
The institute 3 of occasion West Road 1.Deposit number are as follows: CGMCC No.14347.
Terraced rib hickory chick (Morchella importuna) HS-YDJ07 of the invention, through institute of microbiology, the Chinese Academy of Sciences
The experimental datas comprehensive analysis such as cultural characteristic, microscopic features and rRNA gene order, confirm the qualification result of HS-YDJ07
For Morchella importunas ladder rib hickory chick.
The object of the present invention is achieved like this: a kind of ladder rib hickory chick strain, the terraced rib hickory chick strain are ladder
Rib hickory chick HS-YDJ07, deposit number are as follows: CGMCC No. 14347；
A kind of rRNA gene order of terraced rib hickory chick strain is:
3’-ATGCTAGGCCACGAGGGTCCTGAAAAAAGGGCTCCAATTTACGCCCGCAACTGCGACCGGTGTGCCATC
GGCGTATGGAGAAAGGTGAGCATTTTACTGCAAGCCTATATATCCCATAACTCCACGGTTGATGGCCTCGGTGCTG
TCGCATCTGGAGGCGGGTCTACGTCTATTTAGGACATTGGGAAACTAATTGCCAATCGCTATCCCATTAGGCCAAA
ACCCCCCAACGATAGTAATCAAACCCGATGGGGGAGGAGGTTTTTATGACGCTCGAACAGGCATGCCCCCCGGAAT
ACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCG
CTGCGTTCTTCATCGATGTGGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTTTTTGTTTTGTTATGATTCTG
ACGTCGGCTTGTTCACAAAGAGTTTTGGTTGTTGTTCCTCCCCCCAGCGGGTAGCCGGGGGAAGCAAGGCGGGACA
GGTACGCAGAGGGTTTAGATGGGGGCGGCTCCGGGTCCGGCCAGGACGTTCAACAACGTAAAGCTACTAGCCCTGG
TGGCCCCTCGGCTGCCCTTTTCTGTGTGGTTCTTGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTT-
5’。
A kind of terraced rib hickory chick strain the factorial production is trained using terraced rib hickory chick HS-YDJ07 as parent species
It educates, bacterium germination, terraced rib hickory chick strain factory production technique flow is:
(1) female parent selection:
Before early morning waters not yet, 6-7 points of ripe Morchella esculenta (L.) Pers sporophores of picking, disease-free infection, the Healthy Sheep of insect pest bite
Tripe bacterium is as kind of a mushroom, and the higher the better for mushroom shape and its maternal mode of appearance similarity, after adopting mushroom, cuts the root with soil, is packed into
In swatch pouches after sterilizing, label is carried out；
(2) Mother culture:
Mother culture media: PDA is prepared in proportion, boils thawing, is dispensed at test tube 1/3, sterilizing: 121 DEG C, 20 minutes；It takes out,
Inclined-plane is put, is cooled to room temperature；It carries out disinfection under super-clean bench to fructification, it is disconnected by being broken at hickory chick mushroom cap and stem, by mushroom cap
Part places on one side, and only with stem part, one piece of hickory chick of 5mm square is taken to organize, in the middle part of access test tube slant culture medium, plug
Good tampon, is cultivated 3-4 days, pays attention to observing growing way daily by 18-20 DEG C, and miscellaneous bacteria infection is serious to be chosen in time；
(3) parent species purify:
During separation, inevitably there is miscellaneous bacteria infection, according to the fast feature of the Morciiella Esculeuta Mycelia speed of growth, even if there is hickory chick
Mycelia and the common germination and growth of miscellaneous bacteria were cultivated by 3 days, and Morciiella Esculeuta Mycelia growing way can be more than that miscellaneous bacteria one cuts greatly, encountered this feelings
It can be carried out purification processes when condition；
It will be inoculated with hook cleaning disinfection, then the strain test tube tampon to be purified such as remove in alcolhol burner flame downwind, with inoculation
It is hooked at alcolhol burner flame after calcination disinfection treatment, by the culture medium at the tissue block position for having infected miscellaneous bacteria accessed originally
Hook goes out test tube together, does not infect miscellaneous bacteria with the culture medium of Morciiella Esculeuta Mycelia and retains 1-2cm；Notice that being inoculated with hook tries not to connect
Contact the part of miscellaneous bacteria infection；Then it is pure that the hickory chick that can be gone bail for and stay after row thorough disinfection processing is carefully hooked into inoculation
Mycelia is accessed in new PDA culture medium, and size is advisable with one piece of 5mm square, and the test tube after purification is then posted label, is carried out
Record, then it is put into 18-20 DEG C of progress constant temperature incubation；
(4) detoxification:
The bacterial strain being separated to is screened and bottomless test tube detoxicity method is taken to handle；1000g culture medium is prepared: sawdust
435g, lime 10g, urea 5g, water 550g；One, bottomless test tube；It takes above-mentioned culture medium to be divided into two small disconnected to be fitted into bottomless test tube；
Specific method: a little bit smaller test tube of charging Shi Xianyong diameter is inserted into bottomless test tube at 4cm, is then compacted after 2 centimetres of charging；It connects
The dressing other end, is held agglomerating with hand handle compost, and test tube mouth is then inserted 2cm against culture dough, then other end is straight
A little bit smaller tube hold-down of diameter is pushed in from this first compost to centre, at the other end compost 1cm, last two
Head is sealed with tampon；Note: test tube wants traverse when pressure cooker sterilizes, and cannot place vertically, and other operations are routinely；Parent species when inoculation
It is connected to any one end, after waiting Morciiella Esculeuta Mycelias to overgrow with one end culture medium, other end culture medium can be grown to every sky by climbing wall mycelia
On, after covering with the other end, take another front end mycelium inoculation；
(5) parent species preservation: parent species number saves, and prepares parallel strain, and -80 DEG C of ultra low temperature freezers save 3 years；
(6) original seed inoculation and culture: according to Primary spawn material formula；Each bottled 100 g of can, plastic foil sealing, sterilizing 121
DEG C, 1 hour, cooling, each tubes Sterile operation 15 cans of inoculation；It 18-20 DEG C, cultivates 7-10 days；
(7) cultivar inoculation and culture: according to plant formulation；Each 500 g of plastic bag, sealing sterilize 121 DEG C, and 3 is small
When；Cooling, each original seed can sterile working is inoculated with 60 polybags, 18-20 DEG C, cultivates 15-20 days；
(8) prepared by nutrient bag: according to nutrient bag formula；Each polybag, 12 × 24cm fill 500 g, and sealing sterilizes 121 DEG C, and 3
Hour, it is cooling；
(9) it is put in storage: cultivation strain and 4 DEG C of nutrient bag preservations；
A kind of northern facility cultivation technique of terraced rib hickory chick strain is using terraced rib hickory chick HS-YDJ07 as parent species
Management of producing mushroom and harvesting are carried out, terraced rib hickory chick northern facility cultivation technique process flow is:
(1) canopy room prepares:
Canopy room processing: closing canopy room the 7-9 month every year, and high temperature 3 days, close plastic shed, weeding, sterilization, deinsectization；
Soil property requirement: good air permeability, no ratchel, pH value 7-8；
Fertilising: first 7 days of sowing applies the farmyard manure fermented, based on the needle mushroom mushroom bran fermented or cow dung；
Rotation ground: fertilising, water spray back spin, depth 25-35cm；
Sunshade: the sunshade net of sunshade rate 75% is laid in canopy；
Water injector: ground drip irrigation pipe band and space fine-spraying belt are laid with；
Make ridge-up bed: ridge-up bed wide 80cm, height 15-20cm；
(2) strain prepares:
Sowing time: in the annual September in the north, the last ten-days period, temperature is to 15-18 DEG C；
Strain dosage: per acre with strain amount 150-180 Kg；
Strain is selected: strain aging, rejecting that is too weak, having miscellaneous bacteria infection select surface and bag wall to have the bacterium of yellow sclerotium
Kind；
Seed dressing: strain block is crumbed, and is put into clean basin plus 10% clear water is mixed thoroughly, equal in the soil stirring that equivalent is added
It is even；
(3) it sows: strain being uniformly spread in furrow face, canopy temperature control system is at 15-18 DEG C；
(4) earthing: thickness of earth covering 2-3cm, artificial or ditching machine；
(5) germicidal management:
Temperature: the soil moisture maintains 10-15 DEG C；
Humidity: after planting 3-5 days, a heavy water is sprayed, soil moisture is usually maintained；
Ventilation: ventilation is primary daily in canopy, and 30 minutes every time；
Illumination: natural；
Mulching straw: bed surface can be covered tightly with straw；
(6) nutrient bag is put:
When Morciiella Esculeuta Mycelia is grown on bed surface, start to put nutrient bag；Before putting, 3-4 round is beaten on nutrition pocket facing ground；
Nutrient bag will put the place of white hypha as far as possible, use nutrient bag 1700 per acre；Line up triangle disposition, nutrient bag from
Bedside distance 15cm；When bed surface is dry, spray water before putting nutrient bag, swing bag after 1 day；It cannot spray water within 3 days after putting nutrient bag,
Surface temperature is no more than 15 DEG C；
(7) management of producing mushroom:
Mushroom flower bud is formed: nutrient bag is loose, and earth's surface mycelia is thin out, and former base is formed；The soil moisture is at 6 ± 2 DEG C, heavy water sprinkling irrigation,
Mushroom flower bud occurs；
Temperature: 6-10 DEG C of the soil moisture, 2-18 DEG C of surface temperature；
Humidity: relative air humidity 75-85%, micro- spray 2-3 times, 3-5 minutes each daily；
Illumination: natural；
Ventilation: ventilation is primary daily, 0.5-1 hours each；
Points for attention: mushroom flower bud phase does not spray heavy water；
(8) regrowth hair mushroom manages:
When first batch of mushroom is completely complete out, cut off the water 5-7 days, increases the ventilatory capacity in canopy；Water spray waits the growth of regrowth hair mushroom；
(9) it harvests:
When the honeycomb of mushroom cap is opened, start to harvest；
First-class mushroom: mushroom cap length 5-7cm；
Second-class mushroom: mushroom cap length 4-5cm；
Third mushroom: mushroom cap length 2-4.5cm；
A kind of Primary spawn material formula of the factorial production of terraced rib hickory chick strain is matched by following composition weight
1000g compost: wheat 140g, sawdust 105g, soil 70g, rice husk 24.5g, lime 7g, gypsum 3.5g, water 650g is made；
A kind of cultivar culture material formula of the factorial production of terraced rib hickory chick strain is matched by following composition weight
Than 1000g compost: wheat 140g, sawdust 105g, soil 70g, rice husk 24.5g, lime 7g, gypsum 3.5g, water 650g is made；
A kind of nutrient bag formula of the factorial production of terraced rib hickory chick strain is made of following composition weight proportion
1000g compost: wheat 140g, sawdust 105g, soil 70g, rice husk 24.5g, lime 7g, gypsum 3.5g, water 650g.
Beneficial effects of the present invention: the cultural method of terraced rib hickory chick (Morchella importuna) HS-YDJ07 is
It is a kind of it is at low cost, process is simple, the period is short, reproducible, the hickory chick cultural method that is easy to manage and protect, both promote increasing peasant income,
Be conducive to the non-Foresty industry development model of ecological protection again, while providing a new cultivation bacterium for hickory chick industrialized development
Strain.
Detailed description of the invention
The following describes the present invention in detail with reference to the accompanying drawings and embodiments.
Fig. 1 is terraced rib hickory chick strain factory production technique flow figure of the invention.
Fig. 2 is terraced rib hickory chick northern facility cultivation technique process flow chart of the invention.
Fig. 3 is present invention mycelia situation map under the microscope.
Fig. 4 is strain Mother culture figure one of the invention.
Fig. 5 is strain Mother culture figure two of the invention.
Fig. 6 is strain Mother culture figure three of the invention.
Fig. 7 is bacterial initial species culture figure of the invention.
Fig. 8 is cultivating bacterial spawn kind culture figure of the invention.
Fig. 9 is strain seed dressing culture figure of the invention.
Figure 10 is fermenting microbe culture figure of the invention.
Figure 11 is of the invention to put nutrient bag culture figure.
Figure 12 is cultivation fruiting situation map of the invention.
Figure 13 is cultivation mature condition figure one of the invention.
Figure 14 is cultivation mature condition figure two of the invention.
Figure 15 is harvesting ladder rib hickory chick figure one of the invention.
Figure 16 is harvesting ladder rib hickory chick figure two of the invention.
Figure 17 is harvesting ladder rib hickory chick weighing figure of the invention.
Figure 18 is cultivation regrowth hair mushroom fruiting situation map of the invention.
Specific embodiment
Terraced rib hickory chick (Morchella importuna) HS-YDJ07 of the invention is protected on June 30th, 2017
China Committee for Culture Collection of Microorganisms's common micro-organisms center, abbreviation CGMCC are ensconced, address is Chaoyang District, Beijing City north
The institute 3 of occasion West Road 1.Deposit number are as follows: CGMCC No.14347.
Terraced rib hickory chick (Morchella importuna) HS-YDJ07 of the invention, through institute of microbiology, the Chinese Academy of Sciences
The experimental datas comprehensive analysis such as cultural characteristic, microscopic features and rRNA gene order, confirm the qualification result of HS-YDJ07
For Morchella importunas ladder rib hickory chick.
Embodiment one
A kind of ladder rib hickory chick strain, the terraced rib hickory chick strain are terraced rib hickory chick HS-YDJ07, deposit number are as follows:
CGMCC No. 14347。
A kind of rRNA gene order of terraced rib hickory chick strain is:
3’-ATGCTAGGCCACGAGGGTCCTGAAAAAAGGGCTCCAATTTACGCCCGCAACTGCGACCGGTGTGCCATC
GGCGTATGGAGAAAGGTGAGCATTTTACTGCAAGCCTATATATCCCATAACTCCACGGTTGATGGCCTCGGTGCTG
TCGCATCTGGAGGCGGGTCTACGTCTATTTAGGACATTGGGAAACTAATTGCCAATCGCTATCCCATTAGGCCAAA
ACCCCCCAACGATAGTAATCAAACCCGATGGGGGAGGAGGTTTTTATGACGCTCGAACAGGCATGCCCCCCGGAAT
ACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCG
CTGCGTTCTTCATCGATGTGGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTTTTTGTTTTGTTATGATTCTG
ACGTCGGCTTGTTCACAAAGAGTTTTGGTTGTTGTTCCTCCCCCCAGCGGGTAGCCGGGGGAAGCAAGGCGGGACA
GGTACGCAGAGGGTTTAGATGGGGGCGGCTCCGGGTCCGGCCAGGACGTTCAACAACGTAAAGCTACTAGCCCTGG
TGGCCCCTCGGCTGCCCTTTTCTGTGTGGTTCTTGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTT-
5’。
A kind of terraced rib hickory chick strain the factorial production is trained using terraced rib hickory chick HS-YDJ07 as parent species
It educates, bacterium germination, terraced rib hickory chick strain factory production technique flow is (being detailed in attached drawing 1):
(1) female parent selection:
Before early morning waters not yet, 7 points of ripe Morchella esculenta (L.) Pers sporophores, disease-free infection, the Healthy Sheep tripe of insect pest bite are picked
Bacterium is as kind of a mushroom, and the higher the better for mushroom shape and its maternal mode of appearance similarity, after adopting mushroom, cuts the root with soil, loading is gone out
In swatch pouches after bacterium, label is carried out；
(2) Mother culture:
Mother culture media: PDA is prepared in proportion, boils thawing, is dispensed at test tube 1/3 (or being dispensed into triangular flask), is gone out
Bacterium: 121 DEG C, 20 minutes；It takes out, puts inclined-plane (or sterile working is poured at sterilized plate 1/3), be cooled to room temperature；Super
It carries out disinfection under net platform to fructification, it is disconnected by being broken at hickory chick mushroom cap and stem, mushroom cap portion is placed on one side, stem portion is only used
Point, it takes one piece of hickory chick of 5mm square to organize, in the middle part of access test tube slant (or plate) culture medium, is stoppered tampon, 19 DEG C, trains
It supports 4 days, pays attention to observing growing way daily, miscellaneous bacteria infection is serious to be chosen in time；
(3) parent species purify:
During separation, inevitably there is miscellaneous bacteria infection, according to the fast feature of the Morciiella Esculeuta Mycelia speed of growth, even if there is hickory chick
Mycelia and the common germination and growth of miscellaneous bacteria were cultivated by 3 days, and Morciiella Esculeuta Mycelia growing way can be more than that miscellaneous bacteria one cuts greatly, encountered this feelings
It can be carried out purification processes when condition；
It will be inoculated with hook cleaning disinfection, then the strain test tube tampon to be purified such as remove in alcolhol burner flame downwind, with inoculation
It is hooked at alcolhol burner flame after calcination disinfection treatment, by the culture medium at the tissue block position for having infected miscellaneous bacteria accessed originally
Hook goes out test tube (plate) together, does not infect miscellaneous bacteria with the culture medium of Morciiella Esculeuta Mycelia and retains 1.5cm；Pay attention to being inoculated with hook as far as possible
The part of miscellaneous bacteria infection is not touched；Then the sheep stayed that can go bail for carefully is hooked into after row thorough disinfection processing to inoculation
The pure mycelia of tripe bacterium is accessed in new PDA culture medium, and size is advisable with one piece of 5mm square, and the test tube after purification is then posted mark
Label, make a record, then be put into 19 DEG C of progress constant temperature incubations；
(4) detoxification:
The bacterial strain being separated to is screened and bottomless test tube detoxicity method is taken to handle；1000g culture medium is prepared: sawdust
435g, lime 10g, urea 5g, water 550g；One, bottomless test tube (bottomless test tube diameter is 20mm)；Above-mentioned culture medium is taken to be divided into
Two small disconnected are fitted into bottomless test tube；Specific method: a little bit smaller test tube of charging Shi Xianyong diameter is inserted into bottomless test tube at 4cm,
Then it is compacted after 2 centimetres of charging；Then fill the other end, held with hand handle compost it is agglomerating, then test tube mouth against culture dough
Insert 2cm, then diameter a little bit smaller tube hold-down in other end is pushed in from this first compost to centre, distance is another
At the compost 1cm of one end, last both ends are sealed with tampon；Note: test tube wants traverse when pressure cooker sterilizes, and cannot place vertically, other
Operation is routinely；Parent species are connected to any one end when inoculation, after waiting Morciiella Esculeuta Mycelias to overgrow with one end culture medium, climb wall mycelia
It can be grown on other end culture medium every sky, after covering with the other end, take another front end mycelium inoculation；
(5) parent species preservation: parent species number saves, and prepares parallel strain, and -80 DEG C of ultra low temperature freezers save 3 years；
(6) 1000g compost original seed inoculation and culture: is made by following composition weight proportion according to Primary spawn material formula:
Wheat 140g, sawdust 105g, soil 70g, rice husk 24.5g, lime 7g, gypsum 3.5g, water 650g.Each bottled 100 g of can,
Plastic foil sealing, sterilizes 121 DEG C, 1 hour, cooling, and each test tube (plate) sterile working is inoculated with 15(30) a can；19
DEG C, it cultivates 8 days；
(7) cultivar inoculation and culture: 1000g compost is made by following composition weight proportion according to plant formulation: small
Wheat 140g, sawdust 105g, soil 70g, rice husk 24.5g, lime 7g, gypsum 3.5g, water 650g.Each 500 g of plastic bag, envelope
Mouthful, it sterilizes 121 DEG C, 3 hours；Cooling, each original seed can sterile working is inoculated with 60 polybags, 19 DEG C, cultivates 17 days；
(8) prepared by nutrient bag: 1000g compost: wheat 140g is made by following composition weight proportion according to nutrient bag formula,
Sawdust 105g, soil 70g, rice husk 24.5g, lime 7g, gypsum 3.5g, water 650g.Each polybag (12 × 24cm) fills 500
G, sealing sterilize 121 DEG C, 3 hours (100 DEG C, 12 hours), cooling.
(9) it is put in storage: cultivation strain and 4 DEG C of nutrient bag preservations；
A kind of northern facility cultivation technique of terraced rib hickory chick strain is using terraced rib hickory chick HS-YDJ07 as parent species
Management of producing mushroom and harvesting are carried out, terraced rib hickory chick northern facility cultivation technique process flow is (being detailed in attached drawing 2):
(1) canopy room prepares:
Canopy room processing: closing canopy room the 7-9 month every year, and high temperature 3 days, close plastic shed, weeding, sterilization, deinsectization；
Soil property requirement: good air permeability, no ratchel, pH value 7；
Fertilising: first 7 days of sowing applies the farmyard manure fermented, based on the needle mushroom mushroom bran fermented or cow dung；
Rotation ground: fertilising, water spray back spin, depth 30cm；
Sunshade: the sunshade net of sunshade rate 75% is laid in canopy；
Water injector: ground drip irrigation pipe band and space fine-spraying belt are laid with；
Make ridge-up bed: ridge-up bed wide 80cm, height 17cm；
(2) strain prepares:
Sowing time: in the annual September in the north, the last ten-days period, temperature is to 16 DEG C；
Strain dosage: per acre with strain amount 150-180 Kg；
Strain is selected: strain aging, rejecting that is too weak, having miscellaneous bacteria infection select surface and bag wall to have the bacterium of yellow sclerotium
Kind；
Seed dressing: strain block is crumbed, and is put into clean basin plus 10% clear water is mixed thoroughly, equal in the soil stirring that equivalent is added
It is even；
(3) it sows: strain being uniformly spread in furrow face, canopy temperature control system is at 16 DEG C；
(4) earthing: thickness of earth covering 2.5cm, artificial or ditching machine；
(5) germicidal management:
Temperature: the soil moisture maintains 13 DEG C；
Humidity: after planting 4 days, a heavy water is sprayed, soil moisture is usually maintained；
Ventilation: ventilation is primary daily in canopy, and 30 minutes every time；
Illumination: natural；
Mulching straw: bed surface can be covered tightly with straw；
(6) nutrient bag is put:
When Morciiella Esculeuta Mycelia is grown on bed surface, start to put nutrient bag；Before putting, 3 rounds are made a call on nutrition pocket facing ground；Battalion
Feeding bag will put the place of white hypha as far as possible, use nutrient bag 1700 per acre；Triangle disposition is lined up, nutrient bag is from bed
Back gauge 15cm；When bed surface is dry, spray water before putting nutrient bag, swing bag after 1 day；It cannot spray water within 3 days after putting nutrient bag, ground
Table temperature is no more than 15 DEG C；
(7) management of producing mushroom:
Mushroom flower bud is formed: nutrient bag is loose, and earth's surface mycelia is thin out, and former base is formed；The soil moisture is at 6 DEG C, heavy water sprinkling irrigation, mushroom
Flower bud occurs；
Temperature: 8 DEG C of the soil moisture, 10 DEG C of surface temperature；
Humidity: relative air humidity 75-85%, daily micro- spray 3 times, every time 4 minutes；
Illumination: natural；
Ventilation: ventilation is primary daily, and 0.8 hour every time；
Points for attention: mushroom flower bud phase does not spray heavy water；
(8) regrowth hair mushroom manages:
When first batch of mushroom is completely complete out, cut off the water 6 days, increases the ventilatory capacity in canopy；Water spray waits the growth of regrowth hair mushroom；
(9) it harvests:
When the honeycomb of mushroom cap is opened, start to harvest；
First-class mushroom: mushroom cap length 6cm；
Second-class mushroom: mushroom cap length 4cm；
Third mushroom: mushroom cap length 3cm.
Sequence table
<110>agricultural development Co., Ltd, Shenyang Hang Seng, biotechnology Development Co., Ltd, Shenyang Hang Seng
<120>a kind of the factorial production and northern facility cultivation technique of terraced rib hickory chick strain
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 39
<212> DNA
<213>terraced rib hickory chick (Morchella importuna)
<400> 1
ttgttccaaa ggcatccact tggacgcctt cctagtaat 39
<210> 2
<211> 215
<212> DNA
<213>terraced rib hickory chick (Morchella importuna)
<400> 2
ggttcttggt gtgtcttttc ccgtcggctc cccggtggtc ccgatcatcg aaatgcaaca 60
acttgcagga ccggcctggg cctcggcggg ggtagatttg ggagacgcat ggacagggcg 120
gaacgaaggg ggccgatggg cgacccccct ccttgttgtt ggttttgaga aacacttgtt 180
cggctgcagt cttagtattg ttttgttttt tcaat 215
<210> 3
<211> 156
<212> DNA
<213>terraced rib hickory chick (Morchella importuna)
<400> 3
tttgaaagtt gttgcctaga gaaccaaggg tgtagctact tcttgcgtcg ctttacgcta 60
ttcattacac ttaacgtctt aagtcactta gtagcttaga aacttgcgtg taacgcgggg 120
gaccataagg ccccccgtac ggacaagctc gcagta 156
<210> 4
<211> 266
<212> DNA
<213>terraced rib hickory chick (Morchella importuna)
<400> 4
tttttggagg agggggtagc ccaaactaat gatagcaacc ccccaaaacc ggattaccct 60
atcgctaacc gttaatcaaa gggttacagg atttatctgc atctgggcgg aggtctacgc 120
tgtcgtggct ccggtagttg gcacctcaat accctatata tccgaacgtc attttacgag 180
tggaaagagg tatgcggcta ccgtgtggcc agcgtcaacg cccgcattta acctcgggaa 240
aaaagtcctg ggagcaccgg atcgta 266
Claims (7)
1. a kind of ladder rib hickory chick strain, it is characterised in that: the terraced rib hickory chick strain is terraced rib hickory chick HS-YDJ07,
Deposit number are as follows: CGMCC No. 14347.
2. a kind of terraced rib hickory chick strain as described in claim 1, it is characterised in that: a kind of terraced rib hickory chick strain
RRNA gene order be:
3’-ATGCTAGGCCACGAGGGTCCTGAAAAAAGGGCTCCAATTTACGCCCGCAACTGCGACCGGTGTGCCATC
GGCGTATGGAGAAAGGTGAGCATTTTACTGCAAGCCTATATATCCCATAACTCCACGGTTGATGGCCTCGGTGCTG
TCGCATCTGGAGGCGGGTCTACGTCTATTTAGGACATTGGGAAACTAATTGCCAATCGCTATCCCATTAGGCCAAA
ACCCCCCAACGATAGTAATCAAACCCGATGGGGGAGGAGGTTTTTATGACGCTCGAACAGGCATGCCCCCCGGAAT
ACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCG
CTGCGTTCTTCATCGATGTGGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTTTTTGTTTTGTTATGATTCTG
ACGTCGGCTTGTTCACAAAGAGTTTTGGTTGTTGTTCCTCCCCCCAGCGGGTAGCCGGGGGAAGCAAGGCGGGACA
GGTACGCAGAGGGTTTAGATGGGGGCGGCTCCGGGTCCGGCCAGGACGTTCAACAACGTAAAGCTACTAGCCCTGG
TGGCCCCTCGGCTGCCCTTTTCTGTGTGGTTCTTGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTT-
5’。
3. a kind of the factorial production of terraced rib hickory chick strain as claimed in claim 1 or 2, it is characterised in that: described one
Kind of terraced rib hickory chick strain the factorial production be cultivated using terraced rib hickory chick HS-YDJ07 as parent species, bacterium germination, ladder rib
Hickory chick strain factory production technique flow is:
(1) female parent selection:
Before early morning waters not yet, 6-7 points of ripe Morchella esculenta (L.) Pers sporophores of picking, disease-free infection, the Healthy Sheep of insect pest bite
Tripe bacterium is as kind of a mushroom, and the higher the better for mushroom shape and its maternal mode of appearance similarity, after adopting mushroom, cuts the root with soil, is packed into
In swatch pouches after sterilizing, label is carried out；
(2) Mother culture:
Mother culture media: PDA is prepared in proportion, boils thawing, is dispensed at test tube 1/3, sterilizing: 121 DEG C, 20 minutes；It takes
Out, inclined-plane is put, is cooled to room temperature；It carries out disinfection under super-clean bench to fructification, it is disconnected by being broken at hickory chick mushroom cap and stem, by mushroom
Cap portion places on one side, and only with stem part, one piece of hickory chick of 5mm square is taken to organize, in the middle part of access test tube slant culture medium,
It is stoppered tampon, 18-20 DEG C, cultivates 3-4 days, pays attention to observing growing way daily, miscellaneous bacteria infection is serious to be chosen in time；
(3) parent species purify:
During separation, inevitably there is miscellaneous bacteria infection, according to the fast feature of the Morciiella Esculeuta Mycelia speed of growth, even if there is hickory chick
Mycelia and the common germination and growth of miscellaneous bacteria were cultivated by 3 days, and Morciiella Esculeuta Mycelia growing way can be more than that miscellaneous bacteria one cuts greatly, encountered this feelings
It can be carried out purification processes when condition；
It will be inoculated with hook cleaning disinfection, then the strain test tube tampon to be purified such as remove in alcolhol burner flame downwind, with inoculation
It is hooked at alcolhol burner flame after calcination disinfection treatment, by the culture medium at the tissue block position for having infected miscellaneous bacteria accessed originally
Hook goes out test tube together, does not infect miscellaneous bacteria with the culture medium of Morciiella Esculeuta Mycelia and retains 1-2cm；Notice that being inoculated with hook tries not to connect
Contact the part of miscellaneous bacteria infection；Then it is pure that the hickory chick that can be gone bail for and stay after row thorough disinfection processing is carefully hooked into inoculation
Mycelia is accessed in new PDA culture medium, and size is advisable with one piece of 5mm square, and the test tube after purification is then posted label, is carried out
Record, then it is put into 18-20 DEG C of progress constant temperature incubation；
(4) detoxification:
The bacterial strain being separated to is screened and bottomless test tube detoxicity method is taken to handle；1000g culture medium is prepared: sawdust
435g, lime 10g, urea 5g, water 550g；One, bottomless test tube；It takes above-mentioned culture medium to be divided into two small disconnected to be fitted into bottomless test tube；
Specific method: a little bit smaller test tube of charging Shi Xianyong diameter is inserted into bottomless test tube at 4cm, is then compacted after 2 centimetres of charging；It connects
The dressing other end, is held agglomerating with hand handle compost, and test tube mouth is then inserted 2cm against culture dough, then other end is straight
A little bit smaller tube hold-down of diameter is pushed in from this first compost to centre, at the other end compost 1cm, last two
Head is sealed with tampon；Note: test tube wants traverse when pressure cooker sterilizes, and cannot place vertically, and other operations are routinely；Parent species when inoculation
It is connected to any one end, after waiting Morciiella Esculeuta Mycelias to overgrow with one end culture medium, other end culture medium can be grown to every sky by climbing wall mycelia
On, after covering with the other end, take another front end mycelium inoculation；
(5) parent species preservation: parent species number saves, and prepares parallel strain, and -80 DEG C of ultra low temperature freezers save 3 years；
(6) original seed inoculation and culture: according to Primary spawn material formula；Each bottled 100 g of can, plastic foil sealing, sterilizing 121
DEG C, 1 hour, cooling, each tubes Sterile operation 15 cans of inoculation；It 18-20 DEG C, cultivates 7-10 days；
(7) cultivar inoculation and culture: according to plant formulation；Each 500 g of plastic bag, sealing sterilize 121 DEG C, and 3 is small
When；Cooling, each original seed can sterile working is inoculated with 60 polybags, 18-20 DEG C, cultivates 15-20 days；
(8) prepared by nutrient bag: according to nutrient bag formula；Each polybag, 12 × 24cm fill 500 g, and sealing sterilizes 121 DEG C, and 3
Hour, it is cooling.
(9) it is put in storage: cultivation strain and 4 DEG C of nutrient bag preservations.
4. a kind of northern facility cultivation technique of terraced rib hickory chick strain as claimed in claim 1 or 2, it is characterised in that:
A kind of northern facility cultivation technique of terraced rib hickory chick strain is carried out by parent species of terraced rib hickory chick HS-YDJ07
Management of producing mushroom and harvesting, terraced rib hickory chick northern facility cultivation technique process flow is:
(1) canopy room prepares:
Canopy room processing: closing canopy room the 7-9 month every year, and high temperature 3 days, close plastic shed, weeding, sterilization, deinsectization；
Soil property requirement: good air permeability, no ratchel, pH value 7-8；
Fertilising: first 7 days of sowing applies the farmyard manure fermented, based on the needle mushroom mushroom bran fermented or cow dung；
Rotation ground: fertilising, water spray back spin, depth 25-35cm；
Sunshade: the sunshade net of sunshade rate 75% is laid in canopy；
Water injector: ground drip irrigation pipe band and space fine-spraying belt are laid with；
Make ridge-up bed: ridge-up bed wide 80cm, height 15-20cm；
(2) strain prepares:
Sowing time: in the annual September in the north, the last ten-days period, temperature is to 15-18 DEG C；
Strain dosage: per acre with strain amount 150-180 Kg；
Strain is selected: strain aging, rejecting that is too weak, having miscellaneous bacteria infection select surface and bag wall to have the strain of yellow sclerotium；
Seed dressing: strain block is crumbed, and is put into clean basin plus 10% clear water is mixed thoroughly, stirs evenly in the soil that equivalent is added；
(3) it sows: strain being uniformly spread in furrow face, canopy temperature control system is at 15-18 DEG C；
(4) earthing: thickness of earth covering 2-3cm, artificial or ditching machine；
(5) germicidal management:
Temperature: the soil moisture maintains 10-15 DEG C；
Humidity: after planting 3-5 days, a heavy water is sprayed, soil moisture is usually maintained；
Ventilation: ventilation is primary daily in canopy, and 30 minutes every time；
Illumination: natural；
Mulching straw: bed surface can be covered tightly with straw；
(6) nutrient bag is put:
When Morciiella Esculeuta Mycelia is grown on bed surface, start to put nutrient bag；Before putting, 3-4 round is beaten on nutrition pocket facing ground；
Nutrient bag will put the place of white hypha as far as possible, use nutrient bag 1700 per acre；Line up triangle disposition, nutrient bag from
Bedside distance 15cm；When bed surface is dry, spray water before putting nutrient bag, swing bag after 1 day；It cannot spray water within 3 days after putting nutrient bag,
Surface temperature is no more than 15 DEG C；
(7) management of producing mushroom:
Mushroom flower bud is formed: nutrient bag is loose, and earth's surface mycelia is thin out, and former base is formed；The soil moisture is at 6 ± 2 DEG C, heavy water sprinkling irrigation,
Mushroom flower bud occurs；
Temperature: 6-10 DEG C of the soil moisture, 2-18 DEG C of surface temperature；
Humidity: relative air humidity 75-85%, micro- spray 2-3 times, 3-5 minutes each daily；
Illumination: natural；
Ventilation: ventilation is primary daily, 0.5-1 hours each；
Points for attention: mushroom flower bud phase does not spray heavy water；
(8) regrowth hair mushroom manages:
When first batch of mushroom is completely complete out, cut off the water 5-7 days, increases the ventilatory capacity in canopy；Water spray waits the growth of regrowth hair mushroom；
(9) it harvests:
When the honeycomb of mushroom cap is opened, start to harvest；
First-class mushroom: mushroom cap length 5-7cm；
Second-class mushroom: mushroom cap length 4-5cm；
Third mushroom: mushroom cap length 2-4.5cm.
5. a kind of the factorial production of the terraced rib hickory chick strain as described in claims 1 or 2 or 3, it is characterised in that: described
1000g training is made by following composition weight proportion in a kind of Primary spawn material formula of the factorial production of ladder rib hickory chick strain
Nutriment: wheat 140g, sawdust 105g, soil 70g, rice husk 24.5g, lime 7g, gypsum 3.5g, water 650g.
6. a kind of the factorial production of the terraced rib hickory chick strain as described in claims 1 or 2 or 3, it is characterised in that: described
1000g is made by following composition weight proportion in a kind of cultivar culture material formula of the factorial production of ladder rib hickory chick strain
Compost: wheat 140g, sawdust 105g, soil 70g, rice husk 24.5g, lime 7g, gypsum 3.5g, water 650g.
7. a kind of the factorial production of the terraced rib hickory chick strain as described in claims 1 or 2 or 3, it is characterised in that: described
1000g culture is made by following composition weight proportion in a kind of nutrient bag formula of the factorial production of ladder rib hickory chick strain
Material: wheat 140g, sawdust 105g, soil 70g, rice husk 24.5g, lime 7g, gypsum 3.5g, water 650g.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910475042.3A CN110073898A (en) | 2019-06-03 | 2019-06-03 | A kind of ladder rib hickory chick strain the factorial production and northern facility cultivation technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910475042.3A CN110073898A (en) | 2019-06-03 | 2019-06-03 | A kind of ladder rib hickory chick strain the factorial production and northern facility cultivation technique |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110073898A true CN110073898A (en) | 2019-08-02 |
Family
ID=67423185
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910475042.3A Pending CN110073898A (en) | 2019-06-03 | 2019-06-03 | A kind of ladder rib hickory chick strain the factorial production and northern facility cultivation technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110073898A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113875493A (en) * | 2021-10-17 | 2022-01-04 | 西南林业大学 | Breeding and stable-yield cultivation method for black-vein strain morchella strain |
| CN116606743A (en) * | 2023-04-27 | 2023-08-18 | 四川菌益侬农业科技有限公司 | Morchella conica single-spore hybrid strain JYN04, and breeding and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102027857A (en) * | 2010-09-17 | 2011-04-27 | 朱斗锡 | New method for commercial field cultivation of toadstool |
| CN105123259A (en) * | 2015-07-21 | 2015-12-09 | 石文刚 | Wild imitation cultivation method for toadstool |
| CN105993590A (en) * | 2016-05-19 | 2016-10-12 | 西南科技大学 | Culturing method for sporocarp of Morchella |
| CN106538241A (en) * | 2016-10-31 | 2017-03-29 | 郝哲 | A kind of Wind-sandy Area Morchella esculenta (L.) Perss artificial cultivation method |
| CN107660441A (en) * | 2016-07-27 | 2018-02-06 | 北京市农业技术推广站 | A kind of artificial cultivation method of hickory chick |
| CN108770597A (en) * | 2018-06-27 | 2018-11-09 | 延安新天然农业科技发展有限公司 | A kind of hickory chick culture material formula and its cultural method |
-
2019
- 2019-06-03 CN CN201910475042.3A patent/CN110073898A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102027857A (en) * | 2010-09-17 | 2011-04-27 | 朱斗锡 | New method for commercial field cultivation of toadstool |
| CN105123259A (en) * | 2015-07-21 | 2015-12-09 | 石文刚 | Wild imitation cultivation method for toadstool |
| CN105993590A (en) * | 2016-05-19 | 2016-10-12 | 西南科技大学 | Culturing method for sporocarp of Morchella |
| CN107660441A (en) * | 2016-07-27 | 2018-02-06 | 北京市农业技术推广站 | A kind of artificial cultivation method of hickory chick |
| CN106538241A (en) * | 2016-10-31 | 2017-03-29 | 郝哲 | A kind of Wind-sandy Area Morchella esculenta (L.) Perss artificial cultivation method |
| CN108770597A (en) * | 2018-06-27 | 2018-11-09 | 延安新天然农业科技发展有限公司 | A kind of hickory chick culture material formula and its cultural method |
Non-Patent Citations (2)
| Title |
|---|
| CHAI,H.M.，ZHAO,Y.C.: "《https://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_1108638677》", 1 September 2016 * |
| 李明等: "《食用菌高效栽培教材》", 30 April 2005, 金盾出版社 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113875493A (en) * | 2021-10-17 | 2022-01-04 | 西南林业大学 | Breeding and stable-yield cultivation method for black-vein strain morchella strain |
| CN116606743A (en) * | 2023-04-27 | 2023-08-18 | 四川菌益侬农业科技有限公司 | Morchella conica single-spore hybrid strain JYN04, and breeding and application thereof |
| CN116606743B (en) * | 2023-04-27 | 2024-01-23 | 四川菌益侬农业科技有限公司 | Morchella conica single-spore hybrid strain JYN04, and breeding and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105340514B (en) | A kind of drought lotus root volume increase improves the efficient cultivation method of content of starch | |
| CN102301882B (en) | Agricultural cultivation method of paddy-straw-goose ecology | |
| CN102613002B (en) | Method for using banana stalk and banana leave as raw materials to solidly culture pleurotus geesteranus under banana trees | |
| CN103947460A (en) | Field culture method of stropharia rugosoannulata farlow | |
| CN101696395B (en) | Antagonistic bacterium for preventing and killing off continuous cropping tobacco black shank and microbial organic fertilizer thereof | |
| CN103271095A (en) | Composite microbial agent for preventing and treating fruit tree replant disease and disease prevention method thereof | |
| CN107711891B (en) | A method of prevention matrimony vine root rot is extremely set | |
| CN105165513B (en) | A kind of production method of intercropping in garden mushroom | |
| CN102613000A (en) | Method for cultivating oyster mushrooms at bottoms of tea-oil trees by taking tea-oil tree nutshells as major raw materials | |
| CN104541906A (en) | Container nursery method for white bark pine seeds | |
| CN106258484A (en) | A kind of high altitudes and cold area efficient implantation methods of Delicious lactarius | |
| CN105493894A (en) | Cultivation method for implanting mulberry trees with straw mushroom | |
| CN111788989A (en) | Method for interplanting stropharia rugoso-annulata under apple forest | |
| CN109168952A (en) | A kind of method of the imitative wild cultivation Phellinus of hayashishita | |
| CN108432387A (en) | A kind of saliferous method of improvement soil | |
| CN105325149A (en) | Cuttage planting method of lignified arrowroots | |
| CN108575626A (en) | The implantation methods of sealwort | |
| CN107691105A (en) | The breeding method and its cultural method of a kind of hickory chick | |
| CN110073898A (en) | A kind of ladder rib hickory chick strain the factorial production and northern facility cultivation technique | |
| CN105265064B (en) | Fern protonema Liquid Culture method for culturing seedlings | |
| CN109819711A (en) | A method of improving greenhouse succession crop soil physical and chemical property | |
| CN105145042B (en) | Virus-free basic potato seed soil incubation method | |
| CN101444166A (en) | Easy and quick propagating method for lance asiabell root | |
| CN107964513B (en) | Noval strain grassland white mushroom No.1 of Mongolian tricholoma mongolicum and breeding method thereof | |
| CN102771350B (en) | Method for cultivating mycorrhizal seedlings |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20201225 Address after: 110001 6-3-109, Olympic Garden, 269 Shuangyuan Road, Hunnan New District, Shenyang City, Liaoning Province Applicant after: Huang Zhuqing Address before: 110500 Chaoyang Industrial Park, Kangping Economic Development Zone, Shenyang City, Liaoning Province Applicant before: SHENYANG HENGSHENG BIOTECHNOLOGY DEVELOPMENT Co.,Ltd. Applicant before: Shenyang Hengsheng Agricultural Development Co.,Ltd. |
|
| TA01 | Transfer of patent application right | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190802 |
|
| RJ01 | Rejection of invention patent application after publication |