CN108060238B - Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk - Google Patents
Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk Download PDFInfo
- Publication number
- CN108060238B CN108060238B CN201810072479.8A CN201810072479A CN108060238B CN 108060238 B CN108060238 B CN 108060238B CN 201810072479 A CN201810072479 A CN 201810072479A CN 108060238 B CN108060238 B CN 108060238B
- Authority
- CN
- China
- Prior art keywords
- seq
- probe
- bovine
- derived
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer, a probe and a kit for bovine and equine derived detection in raw milk or fermented milk, wherein the sequences of the primer and the probe are as follows: the bovine-derived detection forward primer sequence is shown as SEQ ID No. 1; the sequence of the equine derived detection forward primer is shown as SEQ ID No. 2; the sequence of the two-source detection reverse primer is shown as SEQ ID No. 3; the sequence of the bovine probe is shown as SEQ ID No. 4; horse probe sequence is shown in SEQ ID No. 5; the quality control probe sequence is shown in SEQ ID No. 6. The primer, the probe and the kit have good specificity and high sensitivity, can realize bovine-derived, equine-derived and quality control one-tube detection in raw milk or fermented milk, and can carry out quantitative detection on bovine-derived and equine-derived.
Description
Technical Field
The invention belongs to the technical field of food detection, and particularly relates to the field of animal source detection in raw milk and fermented milk.
Background
The animal origin component refers to animal tissue, including meat and its products (including animal viscera). Animal origin detection refers to a method for detecting its origin components from food and feed. Due to the price difference of different animal tissues, illegal vendors and enterprises are driven to mix low-price meat such as pigs and ducks in high-price meat products such as cows and sheep and mix low-price milk such as milk in high-price milk such as mare milk and camel milk. The animal source detection not only effectively protects the legal rights, national benefits and religious belief of consumers, but also can prevent the spread of human and animal infectious diseases such as bovine spongiform encephalopathy, transmissible spongiform encephalopathy, mad cow disease, foot and mouth disease and the like. The Sino-Linguo union is taken as an important cattle, sheep and horse related livestock product base in the northern China, and the research and the development of an animal source detection kit with independent intellectual property rights are urgently needed.
Mare's milk is considered the food closest to human milk due to its nutritional composition and monogastric digestive system. The fermented mare milk is a dairy product naturally fermented by using mare milk. The fermented mare milk used as traditional Mongolian medicine has effects of treating dyspepsia, lowering blood pressure and reducing blood lipid. Because the price of mare's milk is relatively high compared to cow's milk, there is a phenomenon in the market that mare's milk and yoghurt are pretended with cow's milk or milk products (yoghurt and soups). The market urgently needs the technology capable of identifying bovine origin in the horse milk products. At present, the detection technology of animal-derived components mainly focuses on the specific detection and analysis of protein and DNA in samples. The related technical means comprise enzyme-linked immunosorbent assay (ELISA), Polymerase Chain Reaction (PCR), electrophoresis, chromatography and the like. The Real-time fluorescent quantitative PCR method (RT-PCR) has the advantages of high flux, high efficiency and the like. Saez et al established a DNA-based random primer amplification fingerprint technique capable of identifying pigs, cattle, sheep, chickens and turkeys. Walker et al developed a SYBR Green I fluorescent quantitative detection method designed specifically for satellite DNA that was capable of quantitatively detecting bovine, porcine, and chicken-derived components from mixed DNA samples that were not heat-treated. Zhang et al can detect bovine-derived components in fresh meat, meat products and dairy products by designing primers and probes through mitochondrial genes, and can detect bovine-derived DNA of 35pg level.
The present study project carried out the qualitative and quantitative detection of bovine-derived and equine-derived components based on fluorescent quantitative PCR by comparing, analyzing and screening specific primer and probe combinations for cattle and horses based on the mitochondrial genomes of 11 animals (cattle, horses, sheep, pigs, chickens, ducks, geese, dogs, rabbits, cats and fish). Develops primers and probes with high specificity and sensitivity suitable for detecting bovine and equine derived components in raw milk and fermented milk.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: how to provide a primer, a probe, a kit and a method for high-efficiency and strong-specificity bovine-derived, equine-derived and quality-control same-tube detection in raw milk or fermented milk, and solve the problem of qualitative and quantitative detection of bovine-derived and equine-derived components in the raw milk or fermented milk.
The technical scheme of the invention is as follows: the primer and probe for bovine-derived, equine-derived and quality control same-tube detection in raw milk or fermented milk have the following sequences:
the bovine-derived detection forward primer sequence is shown as SEQ ID No. 1;
the sequence of the equine derived detection forward primer is shown as SEQ ID No. 2;
the sequence of the two-source detection reverse primer is shown as SEQ ID No. 3;
the sequence of the bovine probe is shown as SEQ ID No. 4;
horse probe sequence is shown in SEQ ID No. 5;
the quality control probe sequence is shown in SEQ ID No. 6.
Furthermore, the 5 'end of the sequences of the bovine probe, the equine probe and the quality control probe is modified with a reporter group, the 3' end of the sequences is modified with a quenching group, the reporter group is any one of FAM, HEX, ROX or CY5, and the quenching group is any one of TAMRA, BHQ1 or BHQ 2.
As another object of the present invention, there is also provided a kit for cow-derived and horse-derived and quality control in raw milk or fermented milk, the kit comprising:
a bovine-derived detection forward primer shown as SEQ ID No.1,
the equine origin detection forward primer shown in SEQ ID No.2,
the two-source detection reverse primer shown in SEQ ID No.3,
a bovine probe shown as SEQ ID No.4,
the horse probe shown in SEQ ID No.5,
a quality control probe shown as SEQ ID No.6,
the pre-mixed solution of the Probe qPCR is prepared,
a positive standard substance of a cattle, a positive standard substance of the cattle,
horse positive standard substance.
Certainly, bovine source can be detected independently, and in order to save cost, only equine source related reagents need to be removed (equine source detection forward primer shown in SEQ ID No.2, equine probe shown in SEQ ID No.5 and equine positive standard substance), so that as another object of the present invention, a kit for bovine source and quality control homogeneous tube detection in raw milk or fermented milk is also provided, which comprises:
a bovine-derived detection forward primer shown as SEQ ID No.1,
the two-source detection reverse primer shown in SEQ ID No.3,
a bovine probe shown as SEQ ID No.4,
a quality control probe shown as SEQ ID No.6,
the pre-mixed solution of the Probe qPCR is prepared,
a positive bovine standard.
Certainly, equine origin can also be detected independently, and in order to save cost, only the reagents related to bovine origin (the bovine origin detection forward primer shown in SEQ ID No.1, the bovine probe shown in SEQ ID No.4 and the bovine positive standard) need to be removed, so that as another object of the invention, a kit for equine origin and quality control concordant detection of raw milk or fermented milk is also provided, and the kit contains:
the equine origin detection forward primer shown in SEQ ID No.2,
the two-source detection reverse primer shown in SEQ ID No.3,
the horse probe shown in SEQ ID No.5,
a quality control probe shown as SEQ ID No.6,
the pre-mixed solution of the Probe qPCR is prepared,
horse positive standard substance.
The method for detecting bovine-derived and equine-derived and quality control in raw milk or fermented milk in the same tube comprises the following steps:
(1) extracting DNA of raw milk or fermented milk;
(2) detecting the concentration and quality of the DNA, and diluting the concentration to 100-200 ng/. mu.L;
(3) carrying out multiplex fluorescence quantitative PCR amplification on the diluted DNA by using primers and probes of SEQ ID No. 1-SEQ ID No.6, taking cattle and horse positive standard substances as positive control, taking sterilized deionized water as negative control, and taking blank control of DNA extraction as a control group of the extraction method;
(4) setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of corresponding probes of cattle, horses and quality control and Ct values of positive control, negative control and blank control; the judgment of the corresponding probe source result can be carried out only when the Ct of the quality control is less than or equal to 35, the Ct of the positive control is less than or equal to 35, and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 35, the result is judged to have corresponding source, and the Ct of the plurality of probes is less than or equal to 35, and the result is judged to have corresponding two-source;
(5) making a DNA quantitative standard curve by using positive bovine and equine standards;
(6) the quantitative detection result of the corresponding source in the dairy product can be obtained by utilizing the Ct value for detecting the corresponding source of the dairy product and the formula in the standard curve.
Further, Real-time PCR amplification parameters were: the pre-denaturation temperature is 94 ℃, 30s, the denaturation temperature is 94 ℃, 5s, the annealing extension temperature is 60 ℃, 31s and 40 cycles.
Further, the Real-time PCR reaction system is as follows: 10 mu L of Probe qPCR premix solution and 0.5 mu L of bovine-derived detection forward primer shown in SEQ ID No.1, wherein the concentration is 10 mu mol/L; the equine origin detection forward primer shown in SEQ ID No.2 is 0.5 mu L, and the concentration is 10 mu mol/L; 1 mu L of the two-source detection reverse primer shown in SEQ ID No.3, and the concentration of the two-source detection reverse primer is 10 mu mol/L; 1 mu L of the cattle probe shown in SEQ ID No.4, and the concentration is 10 mu mol/L; 1 mu L of horse probe shown in SEQ ID No.5 with the concentration of 10 mu mol/L and 1 mu L of quality control probe shown in SEQ ID No.6 with the concentration of 10 mu mol/L; DNA 1. mu.L, sterilized deionized water 4. mu.L, total volume 20. mu.L.
The invention selects 10 varieties or strains of mitochondrial genome sequences of each animal by comparing the mitochondrial genomes of 11 animals such as cattle, horses, sheep, pigs, chickens, ducks, geese, dogs, rabbits, cats, fish and the like. Comparing the 110 sequences by biological information software, screening out conserved and specific sequences of the cattle and the horses, and designing primers and probes by using primer design software. The innovativeness of the design is that two ends of conserved and middle specific sequences need to be screened out on a sequence of 100-150bp, primers are designed at the positions conserved at the two ends, and probes are designed at the positions specific in the middle. The conservative primers and the specific probes can effectively reduce the mismatch between the primers and the competition of a plurality of PCR reactions on reaction resources, and can ensure the progress of multiple real-time fluorescent quantitative PCR reactions. The multiplex real-time fluorescent quantitative PCR reaction is the basis of the detection of multiple source components. The annealing temperatures of the primers and the probes are controlled at 55-60 ℃ and 65-70 ℃, secondary structures influencing the annealing efficiency are avoided, and the design ensures that the primers and the probes can be used for subsequent qualitative and quantitative detection to ensure that the primers and the probes have high specificity on mitochondrial genes.
Compared with the prior art, the invention has the following beneficial effects:
the primer, the probe and the kit have good specificity and high sensitivity, can realize qualitative and quantitative detection of the source of the horse and the cow in raw milk or fermented milk, can simultaneously detect the cow, the horse and the cow, saves working procedures and reduces cost.
Drawings
FIG. 1 shows that FAM and TAMRA modified probes are used for labeling bovine-derived real-time fluorescent quantitative PCR detection, and an amplification curve appears in beef, so that bovine-derived primers and probes have specificity (A); marking horse-derived real-time fluorescent quantitative PCR detection by using HEX and TAMRA modified probes, and showing that horse meat has an amplification curve, so that horse-derived primers and probes have specificity (B); no amplification curve is generated in the real-time fluorescent quantitative PCR detection of 9 animal muscle tissues (other meat) such as sheep, pigs, chickens, ducks, geese, dogs, rabbits, cats, fishes and the like, which indicates that the bovine-derived and equine-derived primers and probes have specificity (A and B).
FIG. 2 shows that FAM and TAMRA modified probes are used for labeling bovine origin, HEX and TAMRA modified probes are used for labeling horse origin and ROX and BHQ2 modified probes for labeling quality control to perform real-time fluorescence quantitative PCR detection on milk (A) and horse milk (B), the quality control (an amplification curve) and bovine origin (an amplification curve) are detected in the milk, the quality control (an amplification curve) and horse origin (an amplification curve) are detected in the horse milk, and the detection result accords with the animal source of a raw milk sample. The results show that the mixed probe has the simultaneous in-tube detection capability of bovine origin, equine origin and quality control.
FIG. 3 shows that FAM and TAMRA modified probes are used for marking bovine origin, HEX and TAMRA modified probes are used for marking equine origin, ROX and BHQ2 modified probes are used for marking quality control to carry out real-time fluorescent quantitative PCR detection on yoghurt (A), yoghurt (B) and sour soup (C) (by-products produced by Mongolian traditional milk curds), quality control (amplification curve) and bovine origin (amplification curve) are detected in the yoghurt and the sour soup, quality control (amplification curve) and equine origin (amplification curve) are detected in the yoghurt, and the detection result accords with the animal origin of fermented milk product samples. The results show that the mixed probe has the simultaneous in-tube detection capability of bovine origin, equine origin and quality control.
FIG. 4 shows the detection sensitivity amplification experiments (A and B) of milk DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0001ng and 0.00001ng) using FAM and TAMRA modified probes to label bovine origin, HEX and TAMRA modified probes to label equine origin, and ROX and BHQ2 modified probes to label quality control probes, wherein 10pg of bovine origin DNA (A) can be detected by the bovine origin probes, and 0.01pg of bovine origin DNA (B) can be detected by the quality control probes. The above results demonstrate that the mixed probes (bovine, equine and quality control controls) have a high sensitivity in the detection of the origin of milk.
FIG. 5 shows the detection sensitivity amplification experiments (A and B) of mare milk DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0001ng and 0.00001ng) by using FAM and TAMRA modified probes to label bovine origin, HEX and TAMRA modified probes to label equine origin and ROX and BHQ2 modified probes to label quality control probes, wherein 1pg of equine origin DNA (A) can be detected by the equine origin probes, and 0.01pg of equine origin DNA (B) can be detected by the quality control probes. The above results demonstrate that the mixed probes (bovine, equine and quality control) have a high sensitivity in the detection of mare's milk origin.
FIG. 6 shows the sensitivity of amplification of yoghurt DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0001ng and 0.00001ng) using FAM and TAMRA modified probes to label bovine-derived, HEX and TAMRA modified probes to label equine-derived and ROX and BHQ2 modified probes to label quality control (A and B), wherein 1ng of bovine-derived DNA (A) can be detected by the bovine-derived probes and 0.01pg of bovine-derived DNA (B) can be detected by the quality control probes. The above results demonstrate that the mixed probes (bovine, equine and quality control controls) have a high sensitivity in the detection of the source of the yoghurt.
FIG. 7 shows the detection sensitivity amplification experiments (A and B) of acid mare milk DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0001ng and 0.00001ng) using FAM and TAMRA modified probes to label bovine origin, HEX and TAMRA modified probes to label equine origin and ROX and BHQ2 modified probes to label quality control probes, wherein 1pg of equine origin DNA (A) can be detected by the equine origin probes, and 0.01pg of equine origin DNA (B) can be detected by the quality control probes. The above results demonstrate that the mixed probes (bovine, equine and quality control) have a high sensitivity in the detection of the source of the fermented mare's milk.
FIG. 8 shows the detection sensitivity amplification experiments (A and B) of the acid soup DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0001ng and 0.00001ng) using FAM and TAMRA modified probes to label bovine-derived, HEX and TAMRA modified probes to label equine-derived and ROX and BHQ2 modified probes to label quality control probes, wherein 10pg of bovine-derived DNA (A) can be detected by the bovine-derived probes, and 0.01pg of bovine-derived DNA (B) can be detected by the quality control probes. The above results demonstrate that the mixed probes (bovine, equine and quality control controls) have a high sensitivity in the detection of the source of the soups.
FIG. 9 bovine derived detection standard curve: the method is used for quantitative detection (A) of bovine origin in milk; horse derived detection standard curve: the method is used for quantitative detection (B) of equine origin in mare's milk; horse derived detection standard curve: the method is used for quantitative detection (C) of equine origin in the fermented mare milk; bovine-derived detection standard curve: the method is used for quantitative detection (D) of bovine origin in sour soup.
FIG. 10 is a graph showing simultaneous detection of cow, horse and quality control on a mixed sample of cow DNA and horse milk DNA gradient (1%, 5%, 10%, 20%, 30%, 40%, 50%, 80%, 90%, 95% and 99%) (A) and a mixed sample of sour soup DNA and sour horse milk DNA gradient (1%, 5%, 10%, 20%, 30%, 40%, 50%, 80%, 90%, 95% and 99%) (B) using FAM and TAMRA modified probes to label cow-derived, HEX and TAMRA modified probes and ROX and BHQ2 modified probes to label quality control, and the results show that both the cow and horse probes can detect mixed samples at a level of 1% -5%, and that the mixed probes have simultaneous in-line detection capabilities of cow-derived, horse-derived and quality control.
Detailed Description
1. The detection method comprises the following steps:
(1) DNA of raw milk and fermented milk is extracted, and an extraction blank control (a control group for subsequent extraction method) is set.
(2) The concentration and quality of the DNA were determined and the concentration was diluted to 100-200 ng/. mu.L.
(3) The diluted DNA is amplified and detected by using multiple fluorescent quantitative PCR primers and probes, positive standard substances of cattle and horses are used as positive controls, sterilized deionized water is used as negative controls, a blank control for DNA extraction is used as a control group of the extraction method, a Real-time PCR reaction system is shown in table 1, and Real-time PCR amplification parameters are shown in table 4.
TABLE 1 Real-time PCR reaction System (simultaneous detection of cattle, horse and quality control)
| Composition (I) | Volume (microliter) |
| Probe |
10 |
| Bovine-derived detection forward primer | 0.5 |
| Maltogenic detection forward primer | 0.5 |
| Two-source |
1 |
| |
1 |
| |
1 |
| |
1 |
| |
1 |
| Sterilized deionized |
4 |
| |
20 |
TABLE 2 Real-time PCR reaction System (bovine origin and quality control for independent detection)
TABLE 3 Real-time PCR reaction System (equine origin and quality control independent assay)
| Composition (I) | Volume (microliter) |
| Probe |
10 |
| Maltogenic detection forward |
1 |
| Two-source |
1 |
| |
1 |
| |
1 |
| |
1 |
| Sterilized deionized |
5 |
| |
20 |
TABLE 4 Real-time PCR amplification parameters
(4) Setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of corresponding probes of cattle, horses and quality control and Ct values of positive control, negative control and blank control; the judgment of the corresponding probe source result can be carried out only when the Ct of the quality control is less than or equal to 35, the Ct of the positive control is less than or equal to 35, and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 35, the result is judged to have corresponding source, and the Ct of the plurality of probes is less than or equal to 35, and the result is judged to have corresponding two-source.
(5) Cattle and horse positive standards (dilution 10)1To 107) A standard curve for DNA quantification was made (FIG. 4).
(6) The quantitative detection result of the corresponding source in the dairy product can be obtained by utilizing the Ct value for detecting the corresponding source of the dairy product and the formula in the standard curve.
Preferably, the DNA of the raw milk and the fermented milk is extracted by adopting an improved CTAB method: centrifuging fresh or thawed raw milk and fermented milk at 13000r/min at 4 deg.C for 10min in a super high speed low temperature centrifuge, scraping off milk fat on the upper layer of the centrifuge tube with a spoon, removing milk protein in the middle layer with a pipette, and leaving a layer of precipitate at the bottom. Add 600. mu.L of 1xPBS to the bottom of the centrifuge tube, beat the bottom precipitate into a suspension and transfer to a 1.5mL centrifuge tube, centrifuge at 13000r/min 4 ℃ for 10min, discard the supernatant and retain the bottom precipitate. Adding 60 μ L emulsifier and 540 μ L1 xPBS into the bottom sediment, oscillating with oscillator until the sediment is completely suspended, treating with 40 deg.C constant temperature water bath for 10min to remove milk fat around somatic cells, centrifuging at 13000r/min at 4 deg.C for 10min, discarding the supernatant, adding 1xPBS 500 μ L suspended sediment, centrifuging at 13000r/min at normal temperature for 10min to enrich the somatic cell sediment, and discarding the supernatant. Placing the milk obtained by the above process at 1.5mAdding 1000mL of DNA lysate into an L centrifugal tube, mixing uniformly by vortex, carrying out metal bath at 65 ℃ for 30min, and shaking uniformly at intervals; centrifuging at 13000rpm for 5min, transferring the supernatant into a clean centrifuge tube, adding an isovolumetric chloroform/isoamylol (24/1) mixed solution, fully and uniformly mixing, centrifuging at 13000rpm for 5min, taking the supernatant into a new centrifuge tube, adding isovolumetric isopropanol, fully and uniformly mixing, centrifuging at 13000rpm for 5min, discarding the supernatant, washing once with 75% ethanol, drying, adding a proper amount of ddH2O dissolved and its concentration was measured. Store at-20 ℃.
2. Design of primer and Probe sequences
Because mitochondria have high copy numbers in tissues and are relatively stable in raw milk and fermented dairy products, mitochondrial genes were chosen to design bovine, equine, and quality control detection primers and probes. The synthesis method of the primer and the probe comprises the following steps: beijing Rui Boxing Biol.A.was entrusted with the synthesis and purification according to the invented sequence.
Bovine-derived detection forward primer: 5'TTGAATTAGGCCATGAAGC 3' (SEQ ID No.1),
equine derived detection forward primer: 5'TTGAATCAGGCCATGAAGC 3' (SEQ ID No.2),
two-source detection reverse primer: 5'CTTACCTTGTTACGACTTGTCTC 3' (SEQ ID No.3),
and (3) probe of cattle: 5'CTCTCATGTAGCTAGTGCGTTTAAATAGGG 3' (SEQ ID No.4),
horse probe: 5'TTCATATGTTTGGGTCACGGTTTTATGT 3' (SEQ ID No.5),
quality control probe: 5'ACACACCGCCCGTCACCCT 3' (SEQ ID No. 6);
the 5 'end of the sequences of the cow, the sheep and the quality control probe is modified with a reporter group, and the 3' end is modified with a quenching group, wherein the reporter group is any one of FAM, HEX, ROX or CY5, and the quenching group is any one of TAMRA, BHQ1 or BHQ 2.
3. Specific detection of primers and probes
The reaction system of the single-source detection Real-time PCR is shown in the following table
3.1 labeling bovine-derived, HEX and TAMRA modified probes with FAM and TAMRA modified probes with horse-derived and ROX and BHQ2 modified probes with quality control to carry out qPCR detection on beef, horse meat, mutton, pork, chicken, duck meat, goose meat, dog meat, rabbit meat, cat meat and fish meat
The detection results are as follows:
ct value: mean (three data) + standard deviation; N/A not suitable for detection
The results show that: ct less than 35 (not 0) indicates that the corresponding source is present in the sample. The detection result accords with the animal source of the sample. Bovine origin was detected in beef, equine origin in horse meat, and no bovine and equine origin in other meats.
3.2 QPCR detection of milk, mare's milk, yoghurt, sour mare's milk and sour soup using FAM and TAMRA modified probes to label bovine origin, HEX and TAMRA modified probes to label equine origin and ROX and BHQ2 modified probe label quality control
The detection results are as follows:
ct value: mean (three data) + standard deviation
The results show that: ct less than 35 (not 0) indicates that the corresponding source is present in the sample. The detection result accords with the animal source of the raw milk and the dairy product sample. Quality control and bovine origin were detected in cow milk, yoghurt and soups, and quality control and equine origin were detected in mare milk and yoghurt.
4. Detection limit experiment of primers and probes for corresponding source detection
Diluting 10 genome DNA of cow milk, mare milk, sour mare milk and sour soup respectively1To 107(total of 8 template concentration gradients) primer and probe detection limit amplification experiments were performed. The following results show that 10pg of bovine-derived DNA in cow milk can be detected by the bovine-derived probe, 1pg of equine-derived DNA in horse milk can be detected by the equine-derived probe, 1ng of bovine-derived DNA in yoghurt can be detected by the bovine-derived probe, 1pg of equine-derived DNA in yoghurt can be detected by the equine-derived probe, 10pg of bovine-derived DNA in soups can be detected by the bovine-derived probe, and 0.01pg of bovine-derived or equine-derived DNA can be detected by the quality control probe in all five samples. The results show that the detection limit of the autonomously developed bovine and equine quality control primers and probes reaches the pg level, and the detection sensitivity is higher.
The detection results are as follows:
ct value: mean (three data) + standard deviation
5. Simultaneous detection of cow, horse and quality control was performed on a mixed sample of cow DNA and horse milk DNA gradient (1%, 5%, 10%, 20%, 30%, 40%, 50%, 80%, 90%, 95% and 99%) and a mixed sample of sourdough DNA and sourdough DNA gradient (1%, 5%, 10%, 20%, 30%, 40%, 50%, 80%, 90%, 95% and 99%) using FAM and TAMRA modified probe-labeled bovine-derived, HEX and TAMRA modified probe-labeled and ROX and BHQ2 modified probe-labeled quality control, which indicated that both the cow and horse probes could detect mixed samples at 1% -5% level (cow milk and horse milk and sourdough horse milk).
The detection results are as follows:
ct value: mean (three data) + standard deviation; N/A not suitable for detection
The results show that: a Ct less than 35 (not 0) indicates the corresponding fluorescence correspondences in the sample. Both the cow and horse probes detected mixed samples at levels of 1% -5% (cow and horse milks as well as soups and soups).
6. Manufacture of kit
(1) The bovine-derived and equine-derived simultaneous detection kit reagents are shown in the following table:
(2) the bovine-derived detection kit reagents are shown in the following table:
| reagent | Description of the invention |
| Probe qPCR premix solution | Reaction System (enzyme, dNTP, Mg)2+) |
| Bovine-derived detection forward primer | The concentration is 10 mu mol/L |
| Two-source detection reverse primer | The concentration is 10 mu mol/L |
| Cattle probe | The concentration is 10 mu mol/L |
| Quality control probe | The concentration is 10 mu mol/L |
| Cattle positive standard substance | Concentration of 100 ng/. mu.L, for cattle positive control and standard curve |
| Sterilized deionized water | Complementary reaction system |
(3) The equine derived test kit reagents are shown in the following table:
| reagent | Description of the invention |
| Probe qPCR premix solution | Reaction System (enzyme, dNTP, Mg)2+) |
| Maltogenic detection forward primer | The concentration is 10 mu mol/L |
| Two-source detection reverse primer | The concentration is 10 mu mol/L |
| Horse probe | The concentration is 10 mu mol/L |
| Quality control probe | The concentration is 10 mu mol/L |
| Horse positive standard substance | Concentration of 100 ng/. mu.L, for pig positive control and standard curve |
| Sterilized deionized water | Complementary reaction system |
Sequence listing
<110> Stainer academy of occupational school
<120> primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ttgaattagg ccatgaagc 19
<210>2
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ttgaatcagg ccatgaagc 19
<210>3
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
cttaccttgt tacgacttgt ctc 23
<210>4
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ctctcatgta gctagtgcgt ttaaataggg 30
<210>5
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ttcatatgtt tgggtcacgg ttttatgt 28
<210>6
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
acacaccgcc cgtcaccct 19
Claims (8)
1. The primers and probes for bovine-derived and equine-derived and quality control same-tube detection in raw milk or fermented milk are characterized in that the sequences of the primers and the probes are as follows:
the bovine-derived detection forward primer sequence is shown as SEQ ID No. 1;
the sequence of the equine derived detection forward primer is shown as SEQ ID No. 2;
the sequence of the two-source detection reverse primer is shown as SEQ ID No. 3;
the sequence of the bovine probe is shown as SEQ ID No. 4;
horse probe sequence is shown in SEQ ID No. 5;
the quality control probe sequence is shown in SEQ ID No. 6.
2. The primers and probes for bovine-derived and equine-derived and quality control syntube detection in raw milk or fermented milk according to claim 1, wherein the 5 'end of the sequences of the bovine probe, the equine probe and the quality control probe is modified with a reporter group, the 3' end of the sequences of the bovine probe, the equine probe and the quality control probe is modified with a quencher group, the reporter group is any one of FAM, HEX, ROX or CY5, and the quencher group is any one of TAMRA, BHQ1 or BHQ 2.
3. The kit for bovine-derived and equine-derived and quality control one-tube detection in raw milk or fermented milk is characterized by comprising the following components in parts by weight:
a bovine-derived detection forward primer shown as SEQ ID No.1,
the equine origin detection forward primer shown in SEQ ID No.2,
the two-source detection reverse primer shown in SEQ ID No.3,
a bovine probe shown as SEQ ID No.4,
the horse probe shown in SEQ ID No.5,
a quality control probe shown as SEQ ID No.6,
the pre-mixed solution of the Probe qPCR is prepared,
a positive standard substance of a cattle, a positive standard substance of the cattle,
horse positive standard substance.
4. The kit for bovine-derived and quality control one-tube detection in raw milk or fermented milk is characterized by comprising the following components in parts by weight:
a bovine-derived detection forward primer shown as SEQ ID No.1,
the two-source detection reverse primer shown in SEQ ID No.3,
a bovine probe shown as SEQ ID No.4,
a quality control probe shown as SEQ ID No.6,
the pre-mixed solution of the Probe qPCR is prepared,
a positive bovine standard.
5. The kit for equine origin and quality control one-tube detection in raw milk or fermented milk is characterized in that the kit contains:
the equine origin detection forward primer shown in SEQ ID No.2,
the two-source detection reverse primer shown in SEQ ID No.3,
the horse probe shown in SEQ ID No.5,
a quality control probe shown as SEQ ID No.6,
the pre-mixed solution of the Probe qPCR is prepared,
horse positive standard substance.
6. The method for detecting bovine-derived and equine-derived and quality control in raw milk or fermented milk in the same tube is characterized by comprising the following steps of:
(1) extracting DNA of raw milk or fermented milk;
(2) detecting the concentration and quality of the DNA, and diluting the concentration to 100-200 ng/. mu.L;
(3) carrying out multiplex fluorescence quantitative PCR amplification on the diluted DNA by using primers and probes of SEQ ID No. 1-SEQ ID No.6, taking cattle and horse positive standard substances as positive control, taking sterilized deionized water as negative control, and taking blank control of DNA extraction as a control group of the extraction method;
(4) setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of corresponding probes of cattle, horses and quality control and Ct values of positive control, negative control and blank control; the judgment of the corresponding probe source result can be carried out only when the Ct of the quality control is less than or equal to 35, the Ct of the positive control is less than or equal to 35, and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 35, the result is judged to have corresponding source, and the Ct of the plurality of probes is less than or equal to 35, and the result is judged to have corresponding two-source;
(5) making a DNA quantitative standard curve by using positive bovine and equine standards;
(6) the quantitative detection result of the corresponding source in the dairy product can be obtained by utilizing the Ct value for detecting the corresponding source of the dairy product and the formula in the standard curve.
7. The method for cow-derived and horse-derived and quality-control in raw milk or fermented milk according to claim 6, wherein Real-time PCR amplification parameters are: the pre-denaturation temperature is 94 ℃, 30s, the denaturation temperature is 94 ℃, 5s, the annealing extension temperature is 60 ℃, 31s and 40 cycles.
8. The method for cow-derived and horse-derived and quality-control in raw milk or fermented milk according to claim 6, wherein the Real-time PCR reaction system is: 10 mu L of Probe qPCR premix solution and 0.5 mu L of bovine-derived detection forward primer shown in SEQ ID No.1, wherein the concentration is 10 mu mol/L; the equine origin detection forward primer shown in SEQ ID No.2 is 0.5 mu L, and the concentration is 10 mu mol/L; 1 mu L of the two-source detection reverse primer shown in SEQ ID No.3, and the concentration of the two-source detection reverse primer is 10 mu mol/L; 1 mu L of the bovine probe shown in SEQ ID No.4, and the concentration of the bovine probe is 10 mu mol/L; 1 mu L of horse probe shown in SEQ ID No.5 with the concentration of 10 mu mol/L and 1 mu L of quality control probe shown in SEQ ID No.6 with the concentration of 10 mu mol/L; DNA 1. mu.L, sterilized deionized water 4. mu.L, total volume 20. mu.L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810072479.8A CN108060238B (en) | 2018-01-25 | 2018-01-25 | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810072479.8A CN108060238B (en) | 2018-01-25 | 2018-01-25 | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108060238A CN108060238A (en) | 2018-05-22 |
| CN108060238B true CN108060238B (en) | 2020-03-10 |
Family
ID=62141929
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810072479.8A Active CN108060238B (en) | 2018-01-25 | 2018-01-25 | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108060238B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110305973A (en) * | 2019-08-02 | 2019-10-08 | 锡林郭勒职业学院 | The primer and probe and kit of ox detection synchronous with donkey source property in fresh meat and product |
| CN110283918A (en) * | 2019-08-02 | 2019-09-27 | 锡林郭勒职业学院 | The primer and probe and kit of camel detection synchronous with milk cow source property in meat cream |
| CN114045349B (en) * | 2021-12-02 | 2023-08-01 | 锡林郭勒职业学院 | Primer, probe and kit for synchronously detecting source of sika deer and red deer |
| CN114350822A (en) * | 2022-01-21 | 2022-04-15 | 锡林郭勒职业学院 | Primer and probe for synchronously detecting cattle, buffalo and yak in milk meat and quality control |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1263559A (en) * | 1997-05-30 | 2000-08-16 | 猪改良英国有限公司 | Method for analyzing animal products |
| JP2009065939A (en) * | 2007-09-14 | 2009-04-02 | Aichi Prefecture | Primer set for animal discrimination, and the primer kit |
| CN102586436A (en) * | 2012-02-21 | 2012-07-18 | 山东省农业科学院畜牧兽医研究所 | Loop-mediated isothermal amplification (LAMP) detection method for identifying beef and mutton |
| CN103740805A (en) * | 2013-10-25 | 2014-04-23 | 刘武军 | SNP marker related to Yili horse milk traits and detection method thereof |
| CN105274099A (en) * | 2015-10-23 | 2016-01-27 | 山东省农业科学院生物技术研究中心 | Primers, probe composition and kit for rapid identification of nine animal origin ingredients in food or feed, detection method for identification of nine animal origin ingredients in food or feed and application of primers, probe composition, kit and detection method |
| CN105969839A (en) * | 2015-04-29 | 2016-09-28 | 汕头市检测检验学会 | Taqman-LNA multiplex quantitative PCR method for simultaneously detecting cattle and pig-derived ingredient in meat and meat product, primer probe and kit thereof |
| CN106048034A (en) * | 2016-07-01 | 2016-10-26 | 北京市食品安全监控和风险评估中心 | Method for scanning and analyzing animal-source components in food based on PCR-RLFP-DHPLC technology |
| CN107460248A (en) * | 2017-09-27 | 2017-12-12 | 黑龙江珍宝岛药业股份有限公司 | A kind of primer combination for detecting animal derived components and application, detection kit |
-
2018
- 2018-01-25 CN CN201810072479.8A patent/CN108060238B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1263559A (en) * | 1997-05-30 | 2000-08-16 | 猪改良英国有限公司 | Method for analyzing animal products |
| JP2009065939A (en) * | 2007-09-14 | 2009-04-02 | Aichi Prefecture | Primer set for animal discrimination, and the primer kit |
| CN102586436A (en) * | 2012-02-21 | 2012-07-18 | 山东省农业科学院畜牧兽医研究所 | Loop-mediated isothermal amplification (LAMP) detection method for identifying beef and mutton |
| CN103740805A (en) * | 2013-10-25 | 2014-04-23 | 刘武军 | SNP marker related to Yili horse milk traits and detection method thereof |
| CN105969839A (en) * | 2015-04-29 | 2016-09-28 | 汕头市检测检验学会 | Taqman-LNA multiplex quantitative PCR method for simultaneously detecting cattle and pig-derived ingredient in meat and meat product, primer probe and kit thereof |
| CN105274099A (en) * | 2015-10-23 | 2016-01-27 | 山东省农业科学院生物技术研究中心 | Primers, probe composition and kit for rapid identification of nine animal origin ingredients in food or feed, detection method for identification of nine animal origin ingredients in food or feed and application of primers, probe composition, kit and detection method |
| CN106048034A (en) * | 2016-07-01 | 2016-10-26 | 北京市食品安全监控和风险评估中心 | Method for scanning and analyzing animal-source components in food based on PCR-RLFP-DHPLC technology |
| CN107460248A (en) * | 2017-09-27 | 2017-12-12 | 黑龙江珍宝岛药业股份有限公司 | A kind of primer combination for detecting animal derived components and application, detection kit |
Non-Patent Citations (1)
| Title |
|---|
| New Method for the Simultaneous Identifi cation of Cow, Sheep, Goat, and Water Buffalo in Dairy Products by Analysis of Short Species-Specifi c Mitochondrial DNA Targets;Joana Goncalves等;《J. Agric. Food Chem.》;20121001;第60卷;摘要，表2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108060238A (en) | 2018-05-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108060238B (en) | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk | |
| CN109694916B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| CN108342495A (en) | Sheep and goat source property synchronizes the primer and probe and kit of detection in meat products | |
| KR101296221B1 (en) | Method of identifying animal species using polymerase chain reaction | |
| CN108467895B (en) | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk | |
| CN107858443B (en) | Primer, probe and kit for quantitatively detecting sources of sheep, cattle and pigs in meat products | |
| CN112921101A (en) | Molecular marker related to sheep remaining feed intake and application thereof | |
| CN114990227A (en) | Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder | |
| JP4117370B2 (en) | Primer sequence | |
| Susilorini et al. | Polymorphism of Growth Hormone Gene in Selecting Etawah Crossbred (PE) Goats | |
| KR100646825B1 (en) | Selection techniques of bovine weight trait by using the genetic marker of Hanwoo growth hormone gene | |
| JP5564739B2 (en) | Primer sequence | |
| CN107058543B (en) | Primer for distinguishing animal muscle protein TNNC1 gene and application thereof | |
| US20210207193A1 (en) | In vitro method for monitoring the pathogen load in an animal population | |
| CN110305972B (en) | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products | |
| JP4854211B2 (en) | Primer sequence | |
| CN110628918A (en) | Kit for detecting nutria-derived component in food and application thereof | |
| CN113755607B (en) | Universal primer for specifically identifying donkey, horse and mule source components in donkey-hide gelatin and raw materials thereof, detection method and application | |
| CN114045349B (en) | Primer, probe and kit for synchronously detecting source of sika deer and red deer | |
| CN115851974A (en) | Multiple PCR identification primer, kit and method for pheasant source components | |
| JP2011045383A6 (en) | Primer sequence | |
| CN115927665A (en) | Primer probe combination and kit for non-target 8 animal source detection based on real-time fluorescent PCR | |
| Hosseini et al. | Scanning genomic signatures of selection Turkoman and thoroughbred horse breeds | |
| Venkatesh et al. | Rapid DNA extraction from dried milk spots: application in non-invasive detection of the A1/A2 variants of beta casein in cow | |
| Demira et al. | Determination of Polymorphism in the Dopamine D2 Receptor (DRD2) Gene in Five White Layer Lines Using PCR-RFLP Method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |