CN110305972B - Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products - Google Patents
Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products Download PDFInfo
- Publication number
- CN110305972B CN110305972B CN201910709570.0A CN201910709570A CN110305972B CN 110305972 B CN110305972 B CN 110305972B CN 201910709570 A CN201910709570 A CN 201910709570A CN 110305972 B CN110305972 B CN 110305972B
- Authority
- CN
- China
- Prior art keywords
- seq
- chicken
- goose
- duck
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer, a probe and a kit for synchronously detecting chicken, duck and goose origins in meat products, wherein the sequences of the primer and the probe are as follows: the sequence of the three-source detection forward primer is shown as SEQ ID No. 1; the sequence of the chicken-derived detection reverse primer is shown as SEQ ID No. 2; the sequence of the duck source detection reverse primer is shown as SEQ ID No. 3; the goose-derived reverse sequence is shown as SEQ ID No. 4; the sequence of the primer chicken probe is shown as SEQ ID No. 5; the duck probe sequence is shown in SEQ ID No. 6; the goose probe sequence is shown in SEQ ID No. 7. The primer, the probe and the kit have good specificity and high sensitivity, can realize the chicken-derived, duck-derived and goose-derived simultaneous tube detection in meat products, and can carry out the quantitative detection of chicken-derived, duck-derived and goose-derived.
Description
Technical Field
The invention belongs to the technical field of food detection, and particularly relates to the field of animal source detection in meat products.
Background
Besides containing rich conventional nutritional ingredients, meat products have good sensory experience of color, aroma and taste and are endowed with the kernel of global food. However, with the increasing interest in profits resulting from the growing production and consumption and cost differences between meat, meat products are becoming a major target for adulteration in the food production, processing, distribution and catering fields. Some illegal enterprises and vendors use low-price meat to impersonate high-price meat, and low-price meat such as chicken, duck, goose and the like is added in high-price meat products such as sheep, cattle, deer and the like.
The research on the meat product authenticity identification technology in China is started late, and the research in the field is still in a preliminary stage. Therefore, the realization of a safe and efficient detection technology with the independent property right of China in the current research field of the meat product authenticity identification technology is a research subject which is full of opportunities and extremely challenging. The Xilin Guo league serving as a product base of sheep, cattle, horses and camels urgently needs to develop a truth identification technology and a detection standard of related meat products of chickens, ducks and geese with independent intellectual property rights so as to protect local characteristic mutton products and maintain legal rights and interests of consumers. At present, technical research, detection standards, invention patents and commercial kits related to meat product authenticity identification mainly focus on single-channel single-source detection and different-tube detection, and meanwhile, the reports of multi-channel multi-source detection and same-tube detection are few. The multi-channel through pipe detection can save time and reduce cost.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: how to provide a primer, a probe, a kit and a method for high-efficiency and strong-specificity homologous detection of chicken-origin, duck-origin and goose-origin in meat products, and solve the problem of qualitative and quantitative detection of chicken-origin, duck-origin and goose-origin components in meat products.
The technical scheme of the invention is as follows: the primers and probes for chicken-derived, duck-derived and goose-derived homologous detection in meat products have the following sequences:
three-source detection forward primers: 5'CAAAAGGCTTAAGCCCTTT3' (SEQ ID No. 1),
chicken source detection reverse primer: 5 'CACGGGCGATTAGGATGG 3' (SEQ ID No. 2),
duck source detection reverse primer: 5'ACGGCAATTAAGATTGGGA3' (SEQ ID No. 3),
goose-derived detection reverse primer: 5 'TACGGCAATGGATTGG 3' (SEQ ID No. 4),
chicken probing: 5 'ACCCCCGGACATGACCCTGC 3' (SEQ ID No. 5),
duck probe: 5 'TAGCTACACAACACACACATAAG 3' (SEQ ID No. 6),
and (3) goose probe: 5'CTTC (A/T) CCCATGATTCAAATAACAACC 3' (SEQ ID No. 7).
Furthermore, the 5 'end of the chicken probe, the duck probe and the goose probe is modified with a reporter group, the 3' end is modified with a quenching group, the reporter group is any one of FAM, HEX, ROX or CY5, and the quenching group is any one of TAMRA, BHQ1, BHQ2 or MGB.
As another object of the present invention, there is provided a kit for chicken-derived, duck-derived and goose-derived homeopathic detection in meat products, comprising:
the triple-source detection forward primer shown in SEQ ID No.1,
a chicken-derived detection reverse primer shown in SEQ ID No.2,
a duck source detection reverse primer shown in SEQ ID No.3,
a goose-origin detection reverse primer shown in SEQ ID No.4,
a chicken probe shown in SEQ ID No.5,
a duck probe shown in SEQ ID No.6,
a goose probe shown in SEQ ID No.7,
the pre-mixed solution of Probe qPCR is prepared,
a positive standard substance for chicken, which is a chicken,
a positive standard substance of a duck,
and (5) goose positive standard substance.
Certainly, the chicken source and the duck source can be detected, in order to save cost, only the goose source related reagents (the goose source detection reverse primer shown in SEQ ID No.4, the goose probe shown in SEQ ID No.7 and the goose positive standard substance) need to be removed, so that as another object of the invention, the invention also provides a kit for detecting the chicken and duck source in meat products, wherein the kit comprises:
a three-source detection forward primer shown in SEQ ID No.1,
a chicken-derived detection reverse primer shown in SEQ ID No.2,
a duck source detection reverse primer shown in SEQ ID No.3,
a chicken probe shown in SEQ ID No.5,
a duck probe shown in SEQ ID No.6,
the pre-mixed solution of Probe qPCR is prepared,
a positive standard substance for the chicken, wherein,
a duck positive standard.
Certainly, chicken-origin and goose-origin can be detected, in order to save cost, only duck-origin related reagents need to be removed (the duck-origin detection reverse primer shown in SEQ ID No.3, the duck probe shown in SEQ ID No.6 and the duck positive standard substance), so that as another object of the invention, a kit for detecting chicken-origin and goose-origin in meat products is also provided, and the kit contains:
a three-source detection forward primer shown in SEQ ID No.1,
a chicken-derived detection reverse primer shown in SEQ ID No.2,
a goose-origin detection reverse primer shown in SEQ ID No.4,
a chicken probe shown in SEQ ID No.5,
a goose probe shown in SEQ ID No.7,
the pre-mixed solution of Probe qPCR is prepared,
a positive standard substance for chicken, which is a chicken,
and (5) goose positive standard substance.
Certainly, duck source and goose source can be detected, in order to save cost, only the reagents related to chicken source (the chicken source detection reverse primer shown in SEQ ID No.2, the chicken probe shown in SEQ ID No.5 and the chicken positive standard substance) need to be removed, so that as another object of the invention, the invention also provides a kit for detecting duck and goose source in meat products, wherein the kit comprises:
the triple-source detection forward primer shown in SEQ ID No.1,
a duck source detection reverse primer shown in SEQ ID No.3,
a goose-origin detection reverse primer shown in SEQ ID No.4,
a duck probe shown in SEQ ID No.6,
a goose probe shown in SEQ ID No.7,
the pre-mixed solution of Probe qPCR is prepared,
a positive standard substance of a duck,
and (5) goose positive standard substance.
The method for detecting chicken-origin, duck-origin and goose-origin in meat products comprises the following steps:
(1) Extracting DNA of the meat product;
(2) Detecting the concentration and quality of the DNA, and diluting the concentration to 100-200 ng/. Mu.L;
(3) Performing multiplex fluorescence quantitative PCR amplification on the diluted DNA by using primers and probes of SEQ ID No. 1-SEQ ID No.7, taking positive standard substances of chicken, duck and goose as positive control, taking sterilized deionized water as negative control, and taking blank control of DNA extraction as a control group of the extraction method;
(4) Setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of corresponding probes of chickens, ducks and geese and Ct values of positive control, negative control and blank control; the judgment of the corresponding probe source result can be carried out only when the positive control Ct is less than or equal to 40 and the negative control Ct and the blank control Ct are 0; when the Ct of the corresponding probe is less than or equal to 40, the result is judged to have corresponding source, and the Ct of a plurality of probes is less than or equal to 40, and the result is judged to have corresponding three-source;
(5) Making a DNA quantitative standard curve by using positive standard substances of chicken, duck and goose;
(6) And (3) obtaining a quantitative detection result of the corresponding source in the meat product by utilizing the Ct value for detecting the corresponding source of the meat product and a formula in a standard curve.
Further, real-time PCR amplification parameters were: the pre-denaturation temperature is 94 ℃,30s, the denaturation temperature is 94 ℃,5s, the annealing extension temperature is 60 ℃,34s and 40 cycles.
Further, the Real-time PCR reaction system is as follows: 10 mu L of Probe qPCR premix solution and 1 mu L of triple-source detection forward primer shown in SEQ ID No.1, wherein the concentration is 10 mu M; the reverse primer for chicken source detection shown in SEQ ID No.2 is 0.33 mu L, and the concentration is 10 mu M; the duck source detection reverse primer shown in SEQ ID No.3 is 0.33 mu L, and the concentration is 10 mu M; the goose origin detection reverse primer shown in SEQ ID No.4 is 0.34 mu L, and the concentration is 10 mu M; the chicken probe shown in SEQ ID No.5 is 0.5 mu L, and the concentration is 10 mu M; 0.5 mu L of duck probe shown in SEQ ID No.6, 10 mu M of concentration and 0.5 mu L of goose probe shown in SEQ ID No.7, 10 mu M of concentration; DNA template 2. Mu.L, sterile deionized water 4.5. Mu.L, total volume 20. Mu.L.
The invention selects the mitochondrial genome sequence of 5 varieties or strains of each animal by comparing the mitochondrial genomes of 15 animals such as chicken, duck, goose, quail, pigeon, cattle, buffalo, yak, sheep, goat, pig, horse, donkey, camel, rabbit and the like. And comparing the 75 sequences by using biological information software, screening out conserved and specific sequences of the chicken, the duck and the goose, and designing primers and probes by using primer design software. The innovativeness of the design is that two ends of conserved and middle specific sequences need to be screened out on a 100-150bp sequence, primers are designed at the positions where the two ends are conserved, and probes are designed at the positions where the middle is specific. The conservative primers and the specific probes can effectively reduce the mismatch between the primers and the competition of multiple PCR reactions on reaction resources, and can ensure the multiple real-time fluorescent quantitative PCR reactions. The multiplex real-time fluorescent quantitative PCR reaction is the basis of the detection of multiple source components. The annealing temperatures of the primers and the probes are controlled at 55-60 ℃ and 65-70 ℃, secondary structures influencing the annealing efficiency are avoided, and the design ensures that the primers and the probes can be used for subsequent qualitative and quantitative detection to ensure that the primers and the probes have high specificity on mitochondrial genes.
The invention researches and develops 3-channel detection primers and probes for chickens, ducks, geese and the like, and optimizes the combination of the primers and the probes for multi-channel multi-source detection and same-tube detection. In the process, the problems of influence among various primers and probes in the same PCR reaction system and competition between the template and PCR reaction resources are solved, and the effect that the PCR reaction system can simultaneously carry out multiple real-time fluorescent PCR is achieved.
The chicken-derived probe can detect 0.25pg of chicken-derived DNA in the sample, the duck-derived probe can detect 2.5pg of duck-derived DNA in the sample, and the goose-derived probe can detect 1pg of goose-derived DNA in the sample. The detection limit of the primers and the probes for chicken, duck and goose of the invention reaches pg level, and the detection sensitivity is higher.
Both chicken and duck probes detected 0.1% level of the mixed sample. The mixed probes (chicken, duck and goose) are proved to have the chicken-origin, duck-origin and goose-origin simultaneous detection capability.
Compared with the prior art, the invention has the following beneficial effects:
the primer, the probe and the kit have strong specificity and high sensitivity, can realize qualitative and quantitative detection of chicken, duck and goose sources in meat products, can simultaneously detect chicken, duck and goose, saves working procedures and reduces cost.
Drawings
FIG. 1 shows that FAM and TAMRA modified probes are used for marking chicken-derived, HEX and TAMRA modified probes for marking duck-derived and ROX and MGB modified probes for marking goose-derived contrast to carry out real-time fluorescence quantitative PCR detection on muscle tissues (other meat) of 13 animals such as chicken, quail, pigeon, cattle, buffalo, yak, sheep, goat, pig, horse, donkey, camel and rabbit, an amplification curve appears in chicken, and no amplification curve appears in other meat, so that the specificity of chicken-derived primers and probes is shown.
FIG. 2 shows that FAM and TAMRA modified probes are used for marking chicken source, HEX and TAMRA modified probes for marking goose source and ROX and MGB modified probes for marking goose source to carry out real-time fluorescence quantitative PCR detection on muscle tissues (other meat) of 13 animals such as ducks, quails, pigeons, cattle, buffalos, yaks, sheep, goats, pigs, horses, donkeys, camels and rabbits, an amplification curve appears in duck meat, and no amplification curve appears in other meat, which indicates that duck source primers and probes have specificity.
FIG. 3 shows that FAM and TAMRA modified probes are used for marking chicken origin, HEX and TAMRA modified probes for marking goose origin and ROX and MGB modified probes for marking goose origin, and the real-time fluorescence quantitative PCR detection is carried out on 13 animal muscle tissues (other meat) such as geese, quail, pigeon, cattle, buffalo, yak, sheep, goat, pig, horse, donkey, camel and rabbit, an amplification curve appears in goose meat, and no amplification curve appears in other meat, so that the goose origin primers and probes have specificity.
FIG. 4 shows that FAM and TAMRA modified probes are used for marking chicken origin to carry out detection sensitivity amplification experiments on chicken DNA (100 ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0005ng, 0.00025ng, 0.0001ng and 0.00001 ng), and the chicken origin probes can detect 0.25pg of chicken origin DNA. The results show that the chicken probe has higher sensitivity in the aspect of source detection of meat products.
FIG. 5 shows that HEX and TAMRA modified probes are used for labeling duck-origin DNA (100 ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.005ng, 0.0025ng, 0.001ng, 0.0001ng and 0.00001 ng), and 2.5pg of duck-origin DNA can be detected by the duck-origin probes. The results show that the duck probe has higher sensitivity in the aspect of source detection of meat products.
FIG. 6 shows that goose-derived DNA (100 ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.005ng, 0.0025ng, 0.0001ng and 0.00001 ng) is amplified by detection sensitivity using ROX and MGB modified probes to label goose-derived DNA, and goose-derived probes can detect goose-derived DNA at 1 pg. The results show that the goose probe has higher sensitivity in the aspect of source detection of meat products.
FIG. 7 Chicken origin detection Standard Curve: the method is used for quantitatively detecting the chicken source in the meat products.
FIG. 8 shows standard curve of duck source detection: the method is used for quantitatively detecting the duck source in meat products.
FIG. 9 goose origin detection standard curve: the method is used for quantitative detection of goose origin in meat products.
FIG. 10 shows that the gradient mixed samples (0.1%, 1%, 10%, 30%, 40%, 80%, 98% and 99.8%) of chicken, duck and goose are simultaneously detected by labeling chicken-derived, HEX and TAMRA modified probes with FAM and TAMRA modified probes with chicken-derived, HEX and TAMRA modified probes with duck-derived and ROX and MGB modified probes with goose, and the results show that the mixed samples at the level of 0.1% can be detected by the chicken probe, the duck probe and the goose probe. The above results indicate that the mixed probes (chicken, duck and goose) have the simultaneous in-tube detection capability of chicken origin, duck origin and goose origin.
FIG. 11 shows that FAM and TAMRA modified probes are used for marking chicken origin, HEX and TAMRA modified probes for marking duck origin, and ROX and MGB modified probes for marking goose origin, and the amplification curves of chicken origin (chicken-FAM), duck origin (duck-HEX) and goose origin (goose-ROX) are shown when the chicken, duck and goose are simultaneously detected on a mixed sample (30% chicken, 30% duck and 40% goose). The results show that the mixed probes (chicken, duck and goose) have the simultaneous in-tube detection capability of chicken origin, duck origin and goose origin.
Detailed Description
1. The detection method comprises the following steps:
(1) Extracting DNA of meat products, and establishing an extraction blank control (a control group for subsequent extraction methods).
(2) The concentration and mass of the DNA were determined and the concentration was diluted to 100-200 ng/. Mu.L.
(3) The diluted DNA is subjected to amplification detection by using multiple fluorescent quantitative PCR primers and probes, positive standards of chicken, ducks and geese are used as positive controls, sterilized deionized water is used as negative controls, a blank control for DNA extraction is used as a control group of the extraction method, a Real-time PCR reaction system is shown in table 1, and Real-time PCR amplification parameters are shown in table 5.
TABLE 1 Real-time PCR reaction System (Simultaneous detection of Chicken, duck and goose)
| Composition (I) | Volume (microliter) |
| Probe |
10 |
| Three-source detection forward |
1 |
| Reverse primer for chicken-derived detection | 0.33 |
| Duck source detection reverse primer | 0.33 |
| Goose-derived detection reverse primer | 0.34 |
| Chicken probe | 0.5 |
| Duck probe | 0.5 |
| Goose probe | 0.5 |
| |
2 |
| Sterilized deionized water | 4.5 |
| |
20 |
TABLE 2 Real-time PCR reaction System (detection of Chicken and Duck simultaneously)
| Composition (A) | Volume (microliter) |
| |
10 |
| Three-source detection forward |
1 |
| Reverse primer for chicken-derived detection | 0.5 |
| Duck source detection reverse primer | 0.5 |
| Chicken probe | 0.5 |
| Duck probe | 0.5 |
| |
2 |
| Sterilized deionized |
5 |
| |
20 |
TABLE 3 Real-time PCR reaction System (Chicken and goose simultaneously)
| Composition (A) | Volume (microliter) |
| Probe |
10 |
| Three-source detection forward |
1 |
| Reverse primer for chicken-derived detection | 0.5 |
| Goose-origin detection reverse primer | 0.5 |
| Chicken probe | 0.5 |
| Goose probe | 0.5 |
| |
2 |
| Sterilized deionized |
5 |
| |
20 |
TABLE 4 Real-time PCR reaction System (Simultaneous detection of Duck and goose)
TABLE 5 Real-time PCR amplification parameters
(4) Setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of corresponding probes of chickens, ducks and geese and Ct values of positive control, negative control and blank control; the corresponding judgment of the probe source result can be carried out only when the Ct of the positive control is less than or equal to 40 and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 40, the result is judged to have corresponding source, and the Ct of the probes is less than or equal to 40, and the result is judged to have corresponding three-source.
(5) Positive standards of chicken, duck and goose (dilution 10) 1 To 10 7 Fold) to make a standard curve for DNA quantification.
(6) And (3) obtaining a quantitative detection result of the corresponding source in the meat product by utilizing the Ct value for detecting the corresponding source of the meat product and a formula in a standard curve.
2. Design of primer and Probe sequences
Mitochondrial genes were chosen to design primers and probes for chicken, duck and goose detection due to their high copy number in tissues and relative stability in meat products. The synthesis method of the primer and the probe comprises the following steps: beijing Rui Boxing biology company was entrusted with the synthesis and purification according to the sequence of the invention.
Three-source detection forward primers: 5'CAAAAGGCTTAAGCCCTTT3' (SEQ ID No. 1),
chicken origin detection reverse primer: 5 'CACGGGCGATTAGGATGG 3' (SEQ ID No. 2),
duck source detection reverse primer: 5 'ACGGCAATTAAGATTGGGGA 3' (SEQ ID No. 3),
goose-derived detection reverse primer: 5'TACGGCAATCAGGATTGG 3' (SEQ ID No. 4),
chicken probe: 5 'ACCCCGGACATGACCCTGCC 3' (SEQ ID No. 5),
duck probe: 5 'TAGCTACACAACACATAAG 3' (SEQ ID No. 6),
and (3) goose probe: 5'CTTC (A/T) CCCATGATTCAATAACAACC 3' (SEQ ID No. 7);
the probe sequence of chicken, duck and goose is characterized in that the 5 'end of the probe sequence of chicken, duck and goose is modified with a reporter group, the 3' end of the probe sequence of chicken, duck and goose is modified with a quenching group, wherein the reporter group is any one of FAM, HEX, ROX or CY5, and the quenching group is any one of TAMRA, BHQ1, BHQ2 or MGB.
3. Specific detection of primers and probes
The reaction system of the single-source detection Real-time PCR is shown in the following table
| Composition (A) | Volume (microliter) |
| Probe |
10 |
| Three-source detection forward |
1 |
| Reverse primer for chicken, duck or |
1 |
| Probes of |
1 |
| |
2 |
| Sterilized deionized |
5 |
| |
20 |
QPCR detection is carried out on chicken, duck, goose, quail, pigeon, cattle, buffalo, yak, sheep, goat, pig, horse, donkey, camel and rabbit by utilizing FAM and TAMRA modified probes to mark chicken source, HEX and TAMRA modified probes to mark duck source and ROX and MGB modified probes to mark goose source.
The detection results are as follows:
ct value: mean (three groups of data) ± standard deviation; no signal detected
The results show that: ct less than 40 (not 0) indicates that the corresponding source is present in the sample. The detection result accords with the animal source of the sample. Chicken-derived in chicken, duck-derived in duck, goose-derived in goose, and chicken, duck and goose-derived in other meat were detected.
4. Detection limit experiment of primers and probes for corresponding source detection
The chicken genomic DNA was diluted 10 times respectively 1 To 10 7 Fold and 0.0005 and 0.00025 (total 10 template concentration gradients), respectively diluting the genomic DNA of the duck by 10 1 To 10 7 Doubling and 0.005 and 0.0025 (total 10 template concentration gradients), diluting goose genomic DNA 10 respectively 1 To 10 7 The primer and probe detection limit amplification experiments were performed at double and 0.0005 and 0.00025 (total 10 template concentration gradients). As can be seen from the following results, the chicken-derived probe detected 0.25pg of chicken-derived DNA in the sample, and the duck-derived probe detected the sample2.5pg of duck-derived DNA in the product, and 1pg of goose-derived DNA in the sample can be detected by the goose-derived probe. The results show that the detection limit of the independently developed primers and probes for chicken, duck and goose reaches fg level, and the detection sensitivity is higher.
The detection results are as follows:
ct value: mean (three groups of data) ± standard deviation; N/A is not suitable for detection; no signal detected
5. Chicken, duck and goose gradient mixed samples (0.1%, 1%, 10%, 30%, 40%, 80%, 98% and 99.8%) are simultaneously detected by using FAM and TAMRA modified probes to mark chicken source, HEX and TAMRA modified probes to mark duck source and ROX and MGB modified probes to mark goose source.
The detection results are as follows:
ct value: mean value (three data) ± standard deviation
The results show that: a Ct less than 40 (not 0) indicates the corresponding fluorescence correspondences in the sample. The results showed that both chicken and duck probes detected 0.1% level of mixed samples. The above results indicate that the mixed probes (chicken, duck and goose) have chicken-derived, duck-derived and goose-derived homologous detection capability.
6. Manufacture of kit
(1) The reagent of the chicken-derived, duck-derived and goose-derived synchronous detection kit is shown in the following table:
(2) The reagent of the chicken-derived and duck-derived synchronous detection kit is shown in the following table:
| reagent | Description of the preferred embodiment |
| Probe qPCR premix solution | Reaction System (enzyme, dNTP, mg) 2+ ) |
| Three-source detection forward primer | The concentration is 10. Mu.M |
| Reverse primer for chicken-derived detection | The concentration is 10 μ M |
| Duck source detection reverse primer | The concentration is 10. Mu.M |
| Chicken probe | The concentration is 10. Mu.M |
| Duck probe | The concentration is 10 μ M |
| Chicken positive standard substance | The concentration is 100 ng/. Mu.L, and the method is used for chicken positive control and standard curve |
| Duck positive standard | The concentration is 100 ng/mu L, and the method is used for duck positive control and standard curve |
| Sterilized deionized water | Complementary reaction system |
(3) The reagents of the chicken-derived and goose-derived synchronous detection kit are shown in the following table:
(4) The reagents of the duck-origin and goose-origin synchronous detection kit are shown in the following table:
| reagent | Description of the preferred embodiment |
| Probe qPCR premix solution | Reaction System (enzyme, dNTP, mg) 2+ ) |
| Three-source detection forward primer | The concentration is 10. Mu.M |
| Duck source detection reverse primer | The concentration is 10. Mu.M |
| Goose-origin detection reverse primer | The concentration is 10 μ M |
| Duck probe | The concentration is 10. Mu.M |
| Goose probe | The concentration is 10 μ M |
| Duck positive standard | The concentration is 100 ng/. Mu.L, and the method is used for chicken positive control and standard curve |
| Goose positive standard substance | The concentration is 100 ng/mu L, and the method is used for duck positive control and standard curve |
| Sterilized deionized water | Complementary reaction system |
。
Claims (9)
1. The primers and probes for chicken-origin, duck-origin and goose-origin simultaneous tube detection in meat products are characterized in that the sequences of the primers and the probes are as follows:
the sequence of the three-source detection forward primer is shown as SEQ ID No.1,
the sequence of the chicken-derived detection reverse primer is shown as SEQ ID No.2,
the sequence of the duck-origin detection reverse primer is shown in SEQ ID No.3,
the sequence of the goose-derived detection reverse primer is shown as SEQ ID No.4
The sequence of the chicken probe is shown as SEQ ID No.5,
the duck probe sequence is shown in SEQ ID No.6,
the goose probe sequence is shown in SEQ ID No. 7.
2. The primers and probes for chicken-origin, duck-origin and goose-origin syntaxis detection in meat products of claim 1, wherein 5 'ends of sequences of the chicken probe, the duck probe and the goose probe are modified with a reporter group, 3' ends of sequences of the duck probe and the goose probe are modified with a quenching group, the reporter group is any one of FAM, HEX, ROX or CY5, and the quenching group is any one of TAMRA, BHQ1, BHQ2 or MGB.
3. The kit for chicken-origin, duck-origin and goose-origin simultaneous detection in meat products is characterized by comprising the following components in parts by weight:
a three-source detection forward primer shown in SEQ ID No.1,
a chicken-derived detection reverse primer shown in SEQ ID No.2,
a duck source detection reverse primer shown in SEQ ID No.3,
goose-origin detection reverse primer shown as SEQ ID No.4
A chicken probe shown in SEQ ID No.5,
a duck probe shown in SEQ ID No.6,
a goose probe shown in SEQ ID No.7,
the pre-mixed solution of the Probe qPCR is prepared,
a positive standard substance for the chicken, wherein,
a positive standard substance of a duck,
and (5) goose positive standard substance.
4. The kit for the same-tube detection of chicken origin and duck origin in meat products is characterized by comprising the following components in parts by weight:
a three-source detection forward primer shown in SEQ ID No.1,
a chicken-derived detection reverse primer shown in SEQ ID No.2,
a duck source detection reverse primer shown in SEQ ID No.3,
a chicken probe shown in SEQ ID No.5,
a duck probe shown in SEQ ID No.6,
the pre-mixed solution of Probe qPCR is prepared,
a positive standard substance for chicken, which is a chicken,
a duck positive standard substance.
5. The reagent kit for chicken-origin and goose-origin simultaneous detection in meat products is characterized by comprising the following components in parts by weight:
the triple-source detection forward primer shown in SEQ ID No.1,
a chicken-derived detection reverse primer shown in SEQ ID No.2,
goose-origin detection reverse primer shown as SEQ ID No.4
A chicken probe shown in SEQ ID No.5,
a goose probe shown in SEQ ID No.7,
the pre-mixed solution of the Probe qPCR is prepared,
a positive standard substance for chicken, which is a chicken,
and (5) goose positive standard substance.
6. The kit for the duck-origin and goose-origin simultaneous detection in meat products is characterized by comprising the following components in parts by weight:
the triple-source detection forward primer shown in SEQ ID No.1,
a duck source detection reverse primer shown in SEQ ID No.3,
goose-origin detection reverse primer shown as SEQ ID No.4
A duck probe shown in SEQ ID No.6,
a goose probe shown in SEQ ID No.7,
the pre-mixed solution of the Probe qPCR is prepared,
a positive standard substance of a duck,
and (5) goose positive standard substance.
7. The method for synchronously detecting chicken-origin, duck-origin and goose-origin in meat products is characterized by comprising the following steps:
(1) Extracting DNA of meat products;
(2) Detecting the concentration and the quality of the DNA, and diluting the concentration to 100-200 ng/. Mu.L;
(3) Performing multiplex fluorescence quantitative PCR amplification on the DNA diluent by using primers and probes of SEQ ID No. 1-SEQ ID No.7, taking positive standard substances of chickens, ducks and geese as positive controls, taking sterilized deionized water as negative controls, and taking a blank control of DNA extraction as a control group of the extraction method;
(4) Setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of corresponding probes of chickens, ducks and geese and Ct values of positive control, negative control and blank control; the corresponding judgment of the probe source result can be carried out only when the Ct of the positive control is less than or equal to 40 and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 40, the result is judged to have corresponding source, and the Ct of a plurality of probes is less than or equal to 40, and the result is judged to have corresponding three-source;
(5) Making a DNA quantitative standard curve by using positive standard substances of chicken, duck and goose;
(6) And (3) obtaining a quantitative detection result of the corresponding source in the meat product by utilizing the Ct value for detecting the corresponding source of the meat product and a formula in a standard curve.
8. The method for chicken-derived, duck-derived and goose-derived syntopic detection in meat products of claim 7, wherein Real-time PCR amplification parameters are as follows: the pre-denaturation temperature is 94 ℃,30s, the denaturation temperature is 94 ℃,5s, the annealing extension temperature is 60 ℃,34s and 40 cycles.
9. The method for detecting chicken-derived, duck-derived and goose-derived sources in meat product of claim 7, wherein Real-time PCR reaction system is as follows: 10 mu L of Probe qPCR premix and 1 mu L of three-source detection forward primer shown in SEQ ID No.1, wherein the concentration is 10 mu M; the chicken source detection reverse primer shown in SEQ ID No.2 is 0.33 mu L, and the concentration is 10 mu M; the duck source detection reverse primer shown in SEQ ID No.3 is 0.33 mu L, and the concentration is 10 mu M; the goose origin detection reverse primer shown in SEQ ID No.4 is 0.34 mu L, and the concentration is 10 mu M; the chicken probe shown in SEQ ID No.5 is 0.5 mu L, and the concentration is 10 mu M; 0.5 mu L of duck probe shown in SEQ ID No.6, 10 mu M in concentration and 0.5 mu L of goose probe shown in SEQ ID No.7, 10 mu M in concentration; DNA template 2. Mu.L, sterile deionized water 4.5. Mu.L, total volume 20. Mu.L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910709570.0A CN110305972B (en) | 2019-08-02 | 2019-08-02 | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910709570.0A CN110305972B (en) | 2019-08-02 | 2019-08-02 | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110305972A CN110305972A (en) | 2019-10-08 |
| CN110305972B true CN110305972B (en) | 2022-12-27 |
Family
ID=68082818
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910709570.0A Active CN110305972B (en) | 2019-08-02 | 2019-08-02 | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110305972B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745707A (en) * | 2015-04-08 | 2015-07-01 | 苏州红冠庄国药股份有限公司 | Primer system for PCR identification of rabbits, chicken, ducks, gooses, cattle, sheep, donkeys, horses, pigs and deer |
| WO2015097030A1 (en) * | 2013-12-27 | 2015-07-02 | Universite De Liege | Detection methods |
| CN107663543A (en) * | 2017-11-09 | 2018-02-06 | 贵州省产品质量监督检验院 | Detect triple fluorescent PCR primer probe groups, kit and the method for six kinds of avian compositions |
-
2019
- 2019-08-02 CN CN201910709570.0A patent/CN110305972B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015097030A1 (en) * | 2013-12-27 | 2015-07-02 | Universite De Liege | Detection methods |
| CN104745707A (en) * | 2015-04-08 | 2015-07-01 | 苏州红冠庄国药股份有限公司 | Primer system for PCR identification of rabbits, chicken, ducks, gooses, cattle, sheep, donkeys, horses, pigs and deer |
| CN107663543A (en) * | 2017-11-09 | 2018-02-06 | 贵州省产品质量监督检验院 | Detect triple fluorescent PCR primer probe groups, kit and the method for six kinds of avian compositions |
Non-Patent Citations (3)
| Title |
|---|
| Development of a sensitive and specific multiplex PCR method for the simultaneous detection of chicken, duck and goose DNA in meat products;Hou Bo等;《Meat Science》;20141122;第101卷;90-94 * |
| Improved triplex real-time PCR with endogenous control for synchronous identification of DNA from chicken, duck, and goose meat;Guo-Qiang等;《Food Sci. Nutr.》;20210402;第9卷(第6期);2030-2041 * |
| 应用PCR 技术检测禽类源性成分;张慧霞等;《中国畜牧杂志》;20081231;第44卷(第11期);46-49 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110305972A (en) | 2019-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Girish et al. | A rapid method for authentication of Buffalo (Bubalus bubalis) meat by Alkaline Lysis method of DNA extraction and species specific polymerase chain reaction | |
| US11306365B1 (en) | Molecular marker C42257 for rapidly identifying genetic sex of Marsupenaeus japonicus and applications thereof | |
| CN108342495A (en) | Sheep and goat source property synchronizes the primer and probe and kit of detection in meat products | |
| CN108467895B (en) | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk | |
| CN110079615B (en) | Method for detecting CNV (CNV) marker of KMT2D gene of tea kayak sheep and application of CNV marker | |
| CN108060238B (en) | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk | |
| CN107400729A (en) | A kind of kit and detection method for detecting many animals derived component | |
| CN106868188A (en) | Deer in a kind of deer horn glue, ox source property multiple fluorescence PCR detection primer, probe, kit and detection method and application | |
| CN107858443B (en) | Primer, probe and kit for quantitatively detecting sources of sheep, cattle and pigs in meat products | |
| CN113462787B (en) | Male molecular marker of optical barb cheilus and application thereof | |
| CN110029172B (en) | Double PCR detection kit for equine and donkey-derived components | |
| CN113430279A (en) | DNA (deoxyribonucleic acid) macro-barcode detection target sequence, detection kit and detection method for screening animal provenance components in meat products | |
| CN110305972B (en) | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products | |
| CN114045349B (en) | Primer, probe and kit for synchronously detecting source of sika deer and red deer | |
| CN113151489B (en) | Molecular diagnosis method for evaluating growth traits based on cow ZNF146 gene CNV marker and application thereof | |
| KR100646825B1 (en) | Selection techniques of bovine weight trait by using the genetic marker of Hanwoo growth hormone gene | |
| CN106811534A (en) | A kind of detection primer for disposably detecting various meat derived components, method and kit | |
| Girish et al. | Authentication of sheep (Ovisaries) and goat (Capra hircus) meat species using species-specific polymerase chain reaction | |
| JP5564738B2 (en) | Primer sequence | |
| CN115927665A (en) | Primer probe combination and kit for non-target 8 animal source detection based on real-time fluorescent PCR | |
| CN114350822A (en) | Primer and probe for synchronously detecting cattle, buffalo and yak in milk meat and quality control | |
| CN114990227A (en) | Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder | |
| CN113755607B (en) | Universal primer for specifically identifying donkey, horse and mule source components in donkey-hide gelatin and raw materials thereof, detection method and application | |
| CN117286262B (en) | Fluorescent PCR detection kit and method for detecting authenticity of dairy product by using same | |
| CN114836523B (en) | Real-time fluorescence PCR detection method for detecting turkey-derived components in foods and feeds by utilizing single copy nuclear genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |