CN114990227A - Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder - Google Patents
Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder Download PDFInfo
- Publication number
- CN114990227A CN114990227A CN202210605154.8A CN202210605154A CN114990227A CN 114990227 A CN114990227 A CN 114990227A CN 202210605154 A CN202210605154 A CN 202210605154A CN 114990227 A CN114990227 A CN 114990227A
- Authority
- CN
- China
- Prior art keywords
- camel
- probe
- seq
- quality control
- milk powder
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer and a probe for synchronously detecting sources of monomodal camel and bactrian camel in milk powder, which have the following sequences: the sequence of the forward primer is shown as SEQ ID No. 1; the reverse primer sequence is shown as SEQ ID No. 2; the unimodal camel probe sequence is shown as SEQ ID No. 3; the sequence of the Bactrian camel probe is shown as SEQ ID No. 4; the sequence of the quality control probe is shown in SEQ ID No. 5. The primer, the probe and the kit have good specificity and high sensitivity, and can realize the same-tube detection of single-humped camel source and bactrian camel source and quality control in milk powder.
Description
Technical Field
The invention belongs to the technical field of food detection, and particularly relates to the field of detection of sources of dromedary and bactrian camel in milk powder.
Background
The camel milk powder is milk powder processed from camel milk, is a dairy product with higher nutritional value than common animals, is a long-history tonic, and has the effects of strengthening physique, promoting bone development, stabilizing blood sugar and the like. The camel milk powder has higher nutrition than cow milk powder and goat milk powder, contains abundant proteins and fatty acids, can provide sufficient energy for organism, and can promote self protein synthesis and enhance body constitution. The camel milk powder contains rich calcium element, combines calcium, is easier to digest and absorb, can promote the growth and development of bones and relieve osteoporosis after being frequently drunk, and is suitable for old people and children. The camel milk powder contains insulin-like protein, has the effect of repairing pancreas, and can assist diabetic patients in reducing blood sugar and stabilizing blood sugar. The price of camel milk powder in the consumer market is ten times higher than that of milk powder, and the raw material of the camel milk powder is derived from monomodal camel or bactrian camel milk. The research on the milk powder authenticity identification technology is started late in China, and the research in the field is still in a preliminary stage. At present, no technical method for detecting the sources of a unimodal camel and a bimodal camel exists in the source detection field. Related technical research, detection standards, invention patents and commercial kits for identifying the authenticity of animal products mainly focus on single-channel single-source detection and different-tube quality control detection, and simultaneously, the reports of multi-channel multi-source detection and same-tube quality control detection are less.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: how to provide a primer, a probe, a kit and a method for high-efficiency and strong-specificity single-humped camel-derived and double-humped camel-derived quality control same-tube detection in milk powder, and solve the problem of qualitative and quantitative detection of single-humped camel-derived and double-humped camel-derived components in milk powder.
The technical scheme of the invention is as follows: the primers and probes for single-peak camel-derived and bactrian camel-derived and quality control same-tube detection in the milk powder have the following sequences:
the sequence of the forward primer is shown as SEQ ID No. 1;
the reverse primer sequence is shown as SEQ ID No. 2;
the unimodal camel probe sequence is shown as SEQ ID No. 3;
the bactrian camel probe sequence is shown in SEQ ID No. 4;
the quality control probe sequence is shown in SEQ ID No. 5.
Furthermore, the 5 'end of the unimodal camel probe, the bimodal camel probe and the quality control probe sequence is modified with a reporter group, the 3' end of the unimodal camel probe, the bimodal camel probe and the quality control probe sequence is modified with a quenching group, the reporter group is any one of FAM, HEX, ROX or CY5, and the quenching group is any one of TAMRA, BHQ1 or BHQ 2.
Application of the primer and the probe in single-humped camel and bactrian camel source detection in milk powder
As another object of the present invention, there is provided a kit for the same-tube detection of bactrian camel and bactrian camel in milk powder, comprising:
the forward primer shown in SEQ ID No.1,
a reverse primer shown in SEQ ID No.2,
a monomodal camel probe shown in SEQ ID No.3,
a bactrian camel probe shown in SEQ ID No.4,
a quality control probe shown in SEQ ID No.5,
the pre-mixed solution of Probe qPCR is prepared,
a monomodal camel-positive standard substance,
a bactrian camel positive standard.
Certainly, also can detect the camel origin of unimodal independently, in order to save cost, only need to remove the camel origin related reagent can (the camel probe and the camel positive standard substance of bimodal shown in SEQ ID No.4) therefore, as another purpose of the invention, also provide a kit for the same-tube detection of the camel origin and quality control in milk powder, the kit contains:
the forward primer shown in SEQ ID No.1,
a reverse primer shown in SEQ ID No.2,
a monomodal camel probe shown in SEQ ID No.3,
a quality control probe shown in SEQ ID No.5,
the pre-mixed solution of the Probe qPCR is prepared,
a dromedary positive standard.
Certainly, bactrian camel origin can be detected independently, in order to save cost, only reagents related to the bactrian camel origin (a monomodal camel probe and a monomodal camel positive standard shown in SEQ ID No.3) need to be removed, so that as another object of the invention, a kit for the same-tube detection of bactrian camel origin and quality control in milk powder is also provided, and the kit comprises:
the forward primer shown in SEQ ID No.1,
a reverse primer shown in SEQ ID No.3,
a bactrian camel probe shown in SEQ ID No.4,
a quality control probe shown in SEQ ID No.5,
the pre-mixed solution of the Probe qPCR is prepared,
a bactrian camel positive standard.
The method for detecting monomodal camel origin, bimodal camel origin and quality control in milk powder comprises the following steps:
(1) extracting DNA of milk powder;
(2) taking the DNA in the step (1) as a template, performing multiplex fluorescence quantitative PCR amplification by using primers and probes of SEQ ID No. 1-SEQ ID No.5, taking bactrian camel and monomodal camel positive standard products as positive controls, sterilized deionized water as negative controls, and taking a blank control of DNA extraction as a control group of the extraction method;
(3) setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of a unimodal camel, a bactrian camel and corresponding quality control probes and Ct values of a positive control, a negative control and a blank control; the judgment of the corresponding probe-derived result can be carried out only when the Ct of the quality control is less than or equal to 35, the Ct of the positive control is less than or equal to 35, and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 35, the result is judged to have corresponding source, and meanwhile, the Ct of a plurality of probes is less than or equal to 35, and the result is judged to have corresponding multi-source;
(4) using a monomodal camel positive standard substance and a bactrian camel positive standard substance to make a DNA quantitative standard curve;
(5) the quantitative detection result of the corresponding source in the milk powder can be obtained by utilizing the Ct value for detecting the corresponding source of the milk powder and a formula in a standard curve.
Further, Real-time PCR amplification parameters were: the pre-denaturation temperature is 94 ℃, 30s, the denaturation temperature is 94 ℃, 5s, the annealing extension temperature is 60 ℃, 31s and 40 cycles.
Further, the Real-time PCR reaction system is as follows: 10 mu L of Probe qPCR premix solution and 1 mu L of amphoteric detection forward primer shown in SEQ ID No.1, wherein the concentration is 10 mu mol/L; 1 mu L of the two-source detection reverse primer shown in SEQ ID No.2, and the concentration of the two-source detection reverse primer is 10 mu mol/L; the unimodal camel probe shown in SEQ ID No.3 is 0.5 mu L, and the concentration is 10 mu mol/L; 0.5 mu L of bactrian camel probe shown in SEQ ID No.4 with the concentration of 10 mu mol/L and 0.5 mu L of quality control probe shown in SEQ ID No.5 with the concentration of 10 mu mol/L; DNA template 2. mu.L, sterile deionized water 4.5. mu.L, total volume 20. mu.L.
The invention selects 10 varieties or strains of mitochondrial genome sequences of each animal by comparing the mitochondrial genomes of 16 animals such as dromedary, bactrian camel, cattle, buffalo, yak, donkey, horse, sheep, goat, pig, rabbit, camel, dog, chicken, duck, goose and the like. Comparing the 120 sequences by biological information software, screening out the conserved and specific sequences of the dromedary and the bactrian camel, and designing primers and probes by using primer design software. The innovativeness of the design is that two ends of conserved and middle specific sequences need to be screened out on a sequence of 100-150bp, primers are designed at the positions conserved at the two ends, and probes are designed at the positions specific in the middle. The conservative primers and the specific probes can effectively reduce the mismatch between the primers and the competition of a plurality of PCR reactions on reaction resources, and can ensure the progress of multiple real-time fluorescent quantitative PCR reactions. The multiplex real-time fluorescent quantitative PCR reaction is the basis of the detection of multiple source components. The annealing temperature of the primers and the probes is controlled at 55-60 ℃ and 65-70 ℃, and secondary structures influencing the annealing efficiency are avoided, and the design ensures that the primers and the probes can be used for subsequent qualitative and quantitative detection to ensure that the primers and the probes have high specificity on mitochondrial genes.
The invention researches and develops 3-channel detection primers and probes for dromedary, bactrian camel, quality control and the like, and optimizes the combination of the primers and the probes for multi-channel multi-source detection and quality control detection in the same tube. In the process, the problems of influence among various primers and probes in the same PCR reaction system and competition between the template and PCR reaction resources are solved, and the effect that the PCR reaction system can simultaneously carry out multiple real-time fluorescent PCR is achieved.
Compared with the prior art, the invention has the following beneficial effects:
the primer, the probe and the kit have strong specificity and high sensitivity, can realize qualitative and quantitative detection of sources of the dromedary and the bactrian in the milk powder, can simultaneously detect the dromedary, the bactrian and the quality control, saves working procedures and reduces cost.
Drawings
FIG. 1 shows that the primer and probe for detecting dromedary origin have specificity, the FAM and TAMRA modified probes mark dromedary origin, the ROX and BHQ2 modified probes mark quality control to detect dromedary (milk powder), cow, buffalo, yak, donkey, horse, sheep, goat, pig, rabbit, camel, dog, chicken, duck, goose and other 15 animal milk products and muscle tissues by real-time fluorescence quantitative PCR.
FIG. 2 shows that the HEX and TAMRA modified probes are used for marking dromedary source, FAM and TAMRA modified probes are used for marking dromedary source, ROX and BHQ2 modified probes are used for marking quality control contrast to detect the real-time fluorescent quantitative PCR of 15 animal dairy products and muscle tissues of dromedary (milk powder), cattle, buffalo, yak, donkey, horse, sheep, goat, pig, rabbit, camel, dog, chicken, duck, goose and the like, an amplification curve appears in the dromedary powder, and no amplification curve appears in other samples, which indicates that the primers and probes for detecting dromedary source have specificity.
FIG. 3 shows that when a detection sensitivity amplification experiment is carried out on dromedary DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0005ng, 0.00025ng, 0.0001ng and 0.00001ng), 0.001ng of dromedary DNA can be detected by using HEX and TAMRA modified probes to label the dromedary DNA. The results show that the monomodal camel probe has higher sensitivity in the aspect of source detection of milk powder.
FIG. 4 shows that the detection sensitivity amplification experiment of Bactrian camel DNA (100ng, 10ng, 1ng, 0.1ng, 0.05ng, 0.025ng, 0.01ng, 0.001ng, 0.0001ng and 0.00001ng) is carried out by using FAM and TAMRA modified probes to mark Bactrian camel origin, and the Bactrian camel origin DNA can be detected by using the Bactrian camel origin probes. The results show that the bactrian camel probe has higher sensitivity in the source detection of milk powder.
FIG. 5 shows a single-peak camel-origin detection standard curve: the method is used for the quantitative detection of the dromedary origin in the milk powder.
FIG. 6 is a bactrian camel origin detection standard curve: the method is used for quantitative detection of bactrian camel source in the milk powder.
Detailed Description
1. The detection method comprises the following steps:
(1) DNA of samples (milk powder and meat products) is extracted, and an extraction blank control (a control group for a subsequent extraction method) is set.
(2) The concentration and mass of DNA were determined and the concentration was diluted to 100-200 ng/. mu.L.
(3) The method comprises the steps of carrying out amplification detection on diluted DNA by using multiple fluorescent quantitative PCR primers and probes, using unimodal camel and bactrian camel positive standard substances as positive controls, using sterilized deionized water as negative controls, using a blank control of DNA extraction as a control group of an extraction method, wherein a Real-time PCR reaction system is shown in a table 1, and Real-time PCR amplification parameters are shown in a table 4.
TABLE 1 Real-time PCR reaction System (Simultaneous detection of dromedary, Bactrian and quality control)
| Composition (I) | Volume (microliter) |
| Probe |
10 |
| Forward primer | 1 |
| Reverse primer | 1 |
| Monomodal camel probe | 0.5 |
| Bactrian camel probe | 0.5 |
| Quality control probe | 0.5 |
| |
2 |
| Sterilized deionized water | 4.5 |
| |
20 |
TABLE 2 Real-time PCR reaction System (Simultaneous detection of dromedary origin and quality control)
| Composition (I) | Volume (microliter) |
| Probe |
10 |
| Forward primer | 1 |
| Reverse primer | 1 |
| Monomodal camel probe | 0.5 |
| Quality control probe | 0.5 |
| |
2 |
| Sterilized deionized water | 5 |
| |
20 |
TABLE 3 Real-time PCR reaction System (Bactrian camel-derived and quality control simultaneous detection)
TABLE 4 Real-time PCR amplification parameters
(4) Setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of a unimodal camel, a bactrian camel and corresponding quality control probes and Ct values of a positive control, a negative control and a blank control; the judgment of the corresponding probe source result can be carried out only when the Ct of the quality control is less than or equal to 35, the Ct of the positive control is less than or equal to 35, and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 35, the result is judged to have corresponding source, and the Ct of the probes is less than or equal to 35, and the result is judged to have corresponding multi-source.
(5) Using dromedary and bactrian camel positive standards (dilution 10) 1 To 10 7 Fold) to make a standard curve for DNA quantification.
(6) The quantitative detection result of the corresponding source of the milk powder can be obtained by utilizing the Ct value for detecting the corresponding source of the milk powder and a formula in a standard curve.
2. Design of primer and Probe sequences
Because mitochondria have high copy number in tissues and are relatively stable in animal products, mitochondrial genes are selected to design primers and probes for monomodal camel, bactrian camel and quality control detection. The synthesis method of the primer and the probe comprises the following steps: beijing Rui Boxing Biol.A.was entrusted with the synthesis and purification according to the invented sequence.
A forward primer: 5'TTGAACTAGGCCATG (G/A) AGC 3' (SEQ ID No.1),
reverse primer: 5'CTTACCTTGTTACGACTT (A/G) TCTC 3' (SEQ ID No.2),
unimodal camel probe: 5'ATGTTTTTTGCAGGCTCGTTGAACT 3' (SEQ ID No.3),
bactrian camel probe: 5'TATTTTCTTGCGGGCTCATTGGATT 3' (SEQ ID No.4),
quality control probe: 5'ACACACCGCCCGTCACCCT 3' (SEQ ID No. 5);
the 5 'end of the unimodal camel, the bactrian camel and the quality control probe sequence is modified with a reporter group, the 3' end is modified with a quenching group, wherein the reporter group is any one of FAM, HEX, ROX or CY5, and the quenching group is any one of TAMRA, BHQ1 or BHQ 2.
3. Specific detection of primers and probes
The reaction system of the single-source detection Real-time PCR is shown in the following table
| Composition (I) | Volume (microliter) |
| Probe |
10 |
| Forward primer | 1 |
| Reverse primer | 1 |
| Probes of corresponding origin | 0.5 |
| Quality control probe | 0.5 |
| |
2 |
| SterilizationDeionized water of | 4.5 |
| |
20 |
The FAM and TAMRA modified probes are used for marking monomodal camel source, HEX and TAMRA modified probes are used for marking bactrian camel source, ROX and BHQ2 modified probes are used for marking quality control, and qPCR detection is carried out on monomodal camel (milk powder), bactrian camel (milk powder), cattle, buffalo, yak, donkey, horse, sheep, goat, pig, rabbit, camel, dog, chicken, duck and goose.
The detection results are as follows:
ct value: mean (three groups of data) ± standard deviation; N/A not suitable for detection
The results show that: ct less than 35 (not 0) indicates that the corresponding source is present in the sample. The detection result accords with the source of the sample animal. Monomodal camel origin was detected in monomodal camel milk powder, bactrian camel origin was detected in bactrian camel milk powder, and unimodal and bactrian camel origin were not detected in the other samples.
4. Detection limit experiment of primers and probes for corresponding source detection
Diluting 10 the genome DNA of dromedary and bactrian camel separately 1 To 10 7 The primer and probe detection limit amplification experiments were performed in duplicate (8 template concentration gradients total). From the following results, it can be seen that the monomodal camelid probe can detect 0.001ng of monomodal camelid DNA in the sample, and the bactrian camelid probe can detect 0.025ng of bactrian camelid DNA in the sample. The above results illustrate autonomous research and developmentThe detection limit of the primers and the probes for the dromedary and the bactrian camel reaches ng level, and the detection sensitivity is higher.
The detection results are as follows:
ct value: mean (three groups of data) ± standard deviation; N/A not suitable for detection
5. Manufacture of kit
(1) The unimodal camel-derived and bactrian camel-derived synchronous detection kit reagents are shown in the following table:
(2) unimodal camel-derived detection kit reagents are shown in the following table:
| reagent | Description of the preferred embodiment |
| Probe qPCR premix | Reaction System (enzyme, dNTP, Mg) 2+ ) |
| Forward primer | The concentration is 10 mu mol/L |
| Reverse primer | The concentration is 10 mu mol/L |
| Monomodal camel probe | The concentration is 10 mu mol/L |
| Quality control probe | The concentration is 10 mu mol/L |
| Dromedary positive standard | Concentration of 100 ng/. mu.L, for monomodal camel positive control and standard curve |
| Sterilized deionized water | Complementary reaction system |
(3) The bactrian camel source detection kit reagents are shown in the following table:
sequence listing
<110> Stainer academy of occupational school
Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttgaactagg ccatgragc 19
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cttaccttgt tacgacttrt ctc 23
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atgttttttg caggctcgtt gaact 25
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tattttcttg cgggctcatt ggatt 25
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
acacaccgcc cgtcaccct 19
Claims (9)
1. The primers and probes for single-humped camel-origin and bactrian camel-origin quality control same-tube detection in milk powder are characterized in that the sequences of the primers and the probes are as follows:
the sequence of the forward primer is shown as SEQ ID No.1,
the reverse primer sequence is shown as SEQ ID No.2,
the unimodal camel probe sequence is shown as SEQ ID No.3,
the sequence of the Bactrian camel probe is shown as SEQ ID No.4,
the quality control probe sequence is shown in SEQ ID No. 5.
2. The primers and probes for single-humped camelid, double-humped camelid and quality control concordant detection in milk powder according to claim 1, wherein 5 'ends of the sequences of the single-humped camel probe, the double-humped camel probe and the quality control probe are modified with a reporter group, 3' ends of the sequences of the double-humped camel probe and the quality control probe are modified with a quenching group, the reporter group is any one of FAM, HEX, ROX or CY5, and the quenching group is any one of TAMRA, BHQ1 or BHQ 2.
3. Use of the primers and probes as claimed in claim 1 or 2 for the detection of bactrian camel and bactrian camel origin in milk powder.
4. The kit for single-humped camel-origin, double-humped camel-origin and quality control co-vessel detection in milk powder is characterized by comprising the following components in parts by weight:
the forward primer shown in SEQ ID No.1,
a reverse primer shown in SEQ ID No.2,
a monomodal camel probe shown in SEQ ID No.3,
a bactrian camel probe shown in SEQ ID No.4,
a quality control probe shown in SEQ ID No.5,
the pre-mixed solution of the Probe qPCR is prepared,
a monomodal camel-positive standard substance,
a bactrian camel positive standard.
5. The kit for single-peak camel-derived and quality control one-tube detection in milk powder is characterized by comprising the following components in parts by weight:
the forward primer shown in SEQ ID No.1,
a reverse primer shown in SEQ ID No.2,
a monomodal camel probe shown in SEQ ID No.3,
a quality control probe shown in SEQ ID No.5,
the pre-mixed solution of the Probe qPCR is prepared,
a dromedary positive standard.
6. The kit for bactrian camel source and quality control one-tube detection in milk powder is characterized by comprising the following components in part by weight:
the forward primer shown in SEQ ID No.1,
a reverse primer shown in SEQ ID No.2,
a bactrian camel probe shown in SEQ ID No.4,
a quality control probe shown in SEQ ID No.5,
the pre-mixed solution of Probe qPCR is prepared,
a bactrian camel positive standard.
7. The method for detecting single-peak camel-origin, bactrian camel-origin and quality control in milk powder is characterized by comprising the following steps:
(1) extracting DNA of milk powder;
(3) taking the DNA in the step (1) as a template, performing multiplex fluorescence quantitative PCR amplification by using primers and probes of SEQ ID No. 1-SEQ ID No.5, taking monomodal camel and bimodal camel positive standard substances as positive controls, sterilized deionized water as negative controls, and taking a blank control of DNA extraction as a control group of the extraction method;
(4) setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of a unimodal camel, a bactrian camel and corresponding quality control probes and Ct values of a positive control, a negative control and a blank control; the judgment of the corresponding probe source result can be carried out only when the Ct of the quality control is less than or equal to 35, the Ct of the positive control is less than or equal to 35, and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 35, the result is judged to have corresponding source, and meanwhile, the Ct of a plurality of probes is less than or equal to 35, and the result is judged to have corresponding multi-source;
(5) using a monomodal camel positive standard substance and a bactrian camel positive standard substance to make a DNA quantitative standard curve;
(6) the quantitative detection result of the corresponding source in the milk powder can be obtained by utilizing the Ct value for detecting the corresponding source of the milk powder and a formula in a standard curve.
8. The method for single-humped camelid and bactrian camelid and quality control same-tube detection in milk powder according to claim 7, wherein Real-time PCR amplification parameters are as follows: the pre-denaturation temperature is 94 ℃, 30s, the denaturation temperature is 94 ℃, 5s, the annealing extension temperature is 60 ℃, 31s, and 40 cycles.
9. The method for single-humped camelid and bactrian camelid and quality control same-tube detection in milk powder according to claim 7, wherein the Real-time PCR reaction system is as follows: 10 mu L of Probe qPCR premix solution and 1 mu L of forward primer shown in SEQ ID No.1, wherein the concentration is 10 mu mol/L; 1 mu L of reverse primer shown in SEQ ID No.2, with the concentration of 10 mu mol/L; the unimodal camel probe shown in SEQ ID No.3 is 0.5 mu L, and the concentration is 10 mu mol/L; 0.5 mu L of bactrian camel probe shown in SEQ ID No.4 with the concentration of 10 mu mol/L and 0.5 mu L of quality control probe shown in SEQ ID No.5 with the concentration of 10 mu mol/L; DNA template 2. mu.L, sterile deionized water 4.5. mu.L, total volume 20. mu.L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210605154.8A CN114990227A (en) | 2022-05-30 | 2022-05-30 | Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210605154.8A CN114990227A (en) | 2022-05-30 | 2022-05-30 | Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114990227A true CN114990227A (en) | 2022-09-02 |
Family
ID=83030362
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210605154.8A Pending CN114990227A (en) | 2022-05-30 | 2022-05-30 | Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114990227A (en) |
-
2022
- 2022-05-30 CN CN202210605154.8A patent/CN114990227A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11306365B1 (en) | Molecular marker C42257 for rapidly identifying genetic sex of Marsupenaeus japonicus and applications thereof | |
| CN108060238B (en) | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk | |
| CN108467895B (en) | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk | |
| CN108342495A (en) | Sheep and goat source property synchronizes the primer and probe and kit of detection in meat products | |
| CN106868188B (en) | Deer and bovine derived multiplex fluorescence PCR detection primer, probe, kit, detection method and application in deer-horn glue | |
| CN107858443B (en) | Primer, probe and kit for quantitatively detecting sources of sheep, cattle and pigs in meat products | |
| CN110157818B (en) | Molecular marker related to high-yield characteristics of porcine eye muscles and application thereof | |
| CN112921101A (en) | Molecular marker related to sheep remaining feed intake and application thereof | |
| CN114990227A (en) | Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder | |
| CN110804652A (en) | Additive, kit and reaction method for rapid detection of real-time quantitative PCR of DNA | |
| KR100487995B1 (en) | Early selection analysis method for gene of pigs with quality meat | |
| CN113403405B (en) | Method for evaluating backfat thickness and shearing force in quality characters of Sichuan yak meat | |
| CN114045349B (en) | Primer, probe and kit for synchronously detecting source of sika deer and red deer | |
| CN110305972B (en) | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products | |
| CN105969893B (en) | The method and special DNA bar shaped chip segment of a kind of elm mushroom bacterium identification | |
| JP4117370B2 (en) | Primer sequence | |
| KR100646825B1 (en) | Selection techniques of bovine weight trait by using the genetic marker of Hanwoo growth hormone gene | |
| CN107058543B (en) | Primer for distinguishing animal muscle protein TNNC1 gene and application thereof | |
| CN112029830A (en) | Method for improving sensitivity of PCR (polymerase chain reaction) for identifying pig, cattle and sheep derived components in protein biochemical raw material crude product | |
| CN111826449A (en) | Method for obtaining molecular marker related to gynogenesis bighead malformation character and application thereof | |
| CN114350822A (en) | Primer and probe for synchronously detecting cattle, buffalo and yak in milk meat and quality control | |
| CN115807105A (en) | 7 common animal derived non-targeted detection primer probe combination and kit | |
| CN115927665A (en) | Primer probe combination and kit for non-target 8 animal source detection based on real-time fluorescent PCR | |
| CN113755607B (en) | Universal primer for specifically identifying donkey, horse and mule source components in donkey-hide gelatin and raw materials thereof, detection method and application | |
| JP2013039130A (en) | Primer sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |