CN108467895B - Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk - Google Patents
Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk Download PDFInfo
- Publication number
- CN108467895B CN108467895B CN201810477823.1A CN201810477823A CN108467895B CN 108467895 B CN108467895 B CN 108467895B CN 201810477823 A CN201810477823 A CN 201810477823A CN 108467895 B CN108467895 B CN 108467895B
- Authority
- CN
- China
- Prior art keywords
- goat
- seq
- cow
- probe
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention discloses a primer, a probe and a kit for synchronously detecting the source of a goat and a cow in raw milk, wherein the sequences of the primer and the probe are as follows: the sequence of the goat origin detection forward primer is shown as SEQ ID No. 1; the sequence of the cow source detection forward primer is shown as SEQ ID No. 2; the sequence of the goat origin detection reverse primer is shown in SEQ ID No. 3; the sequence of the cow source detection reverse primer is shown as SEQ ID No. 4; the goat probe sequence is shown in SEQ ID No. 5; the cow probe sequence is shown in SEQ ID No. 6; the quality control probe sequence is shown in SEQ ID No. 7. The primer, the probe and the kit have good specificity and high sensitivity, can realize the goat-derived, cow-derived and quality control same-tube detection in raw milk, and can carry out the quantitative detection of goat-derived and cow-derived.
Description
Technical Field
The invention belongs to the technical field of food detection, and particularly relates to the field of animal source detection in raw milk.
Background
Dairy products are an important component of the human dietary structure and are rich in nutrients such as protein, fat, carbohydrates, vitamins and minerals (including trace elements). These nutrients not only form the basis of macroscopic human body and microscopic cells, but also are the source of regulating and controlling human body's life activity and biochemical reaction in cells. Besides containing abundant conventional nutritional ingredients, the dairy product has good sensory experience of color, aroma and taste and is endowed with the inner core of global food. However, with increasing production and consumption, dairy products are becoming a major target for adulteration in the food production, processing, distribution and catering fields.
The research on the dairy product authenticity identification technology in China is started late, and the research in the field is still in a preliminary stage. Therefore, the realization of the safe and efficient detection technology with the independent property rights of China is a research subject which is full of opportunities and extremely challenging at the same time in the current research field of the dairy product authenticity identification technology. The establishment of a safe, efficient and rapid detection technology platform is a key problem to be solved urgently in the field of dairy product authenticity identification research. The Cenline Guo union as the base of sheep, horse, cattle and camel products (dairy products) urgently needs to develop the authenticity identification technology and the detection standard of goat milk and milk related dairy products with independent intellectual property rights so as to protect local characteristic dairy products and maintain the legal rights and interests of consumers. At present, the technical research, the detection standard, the invention patent and the commercial kit related to the authenticity identification of the dairy products mainly focus on single-channel single-source detection and different-tube quality control detection, and the reports of multi-channel multi-source detection and same-tube quality control detection are less. False negative always is a bottleneck which troubles the wide application of the PCR technology in the authenticity identification of the dairy products. The quality control detection can effectively prevent the occurrence of false negative.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: how to provide a primer, a probe, a kit and a method for efficiently and specifically detecting goat-derived, cow-derived and quality control in raw milk in the same tube, and solve the problem of qualitative and quantitative detection of goat-derived and cow-derived components in raw milk.
The technical scheme of the invention is as follows: the primer and probe for goat-derived, cow-derived and quality control same-tube detection in raw milk have the following sequences:
the sequence of the goat origin detection forward primer is shown as SEQ ID No. 1;
the sequence of the cow source detection forward primer is shown as SEQ ID No. 2;
the sequence of the goat origin detection reverse primer is shown in SEQ ID No. 3;
the sequence of the cow source detection reverse primer is shown as SEQ ID No. 4;
the goat probe sequence is shown in SEQ ID No. 5;
the cow probe sequence is shown in SEQ ID No. 6;
the quality control probe sequence is shown in SEQ ID No. 7.
Furthermore, the 5 'end of the goat probe, the cow probe and the quality control probe sequence is modified with a reporter group, the 3' end is modified with a quenching group, the reporter group is any one of FAM, HEX, ROX or CY5, and the quenching group is any one of TAMRA, BHQ1 or BHQ 2.
As another object of the present invention, there is provided a kit for goat-derived, cow-derived and quality control in raw milk for same-tube detection, comprising:
a goat origin detection forward primer shown in SEQ ID No.1,
a cow source detection forward primer shown in SEQ ID No.2,
a goat origin detection reverse primer shown in SEQ ID No.3,
a cow source detection reverse primer shown in SEQ ID No.4,
a goat probe shown as SEQ ID No.5,
a cow probe shown in SEQ ID No.6,
a quality control probe shown in SEQ ID No.7,
the pre-mixed solution of the Probe qPCR is prepared,
a positive standard substance of the goat, wherein,
and (4) cow positive standard substance.
Certainly, goat origin can be detected independently, and in order to save cost, only the reagents related to cow origin (the cow origin detection forward primer shown in SEQ ID No.2, the cow origin detection reverse primer shown in SEQ ID No.4, the cow probe shown in SEQ ID No.6 and the cow positive standard substance) need to be removed, so that as another object of the invention, a kit for goat origin and quality control simultaneous detection in raw milk is also provided, and the kit contains:
a goat origin detection forward primer shown in SEQ ID No.1,
a goat origin detection reverse primer shown in SEQ ID No.3,
a goat probe shown as SEQ ID No.5,
a quality control probe shown in SEQ ID No.7,
the pre-mixed solution of the Probe qPCR is prepared,
and (4) a goat positive standard substance.
Certainly, the source of the cow can be detected separately, and in order to save cost, only the reagents related to the source of the goat (the goat source detection forward primer shown in SEQ ID No.1, the goat source detection reverse primer shown in SEQ ID No.3, the goat probe shown in SEQ ID No.5 and the goat positive standard substance) need to be removed, so that as another object of the invention, a kit for the same-tube detection of the source and quality control of the cow in raw milk is also provided, and the kit comprises:
a cow source detection forward primer shown in SEQ ID No.2,
a cow source detection reverse primer shown in SEQ ID No.4,
a cow probe shown in SEQ ID No.6,
a quality control probe shown in SEQ ID No.7,
the pre-mixed solution of the Probe qPCR is prepared,
and (4) cow positive standard substance.
The method for detecting goat origin, cow origin and quality control in raw milk in the same tube comprises the following steps:
(1) extracting DNA of raw milk;
(2) detecting the concentration and quality of the DNA, and diluting the concentration to 100-200 ng/mu L;
(3) carrying out multiplex fluorescence quantitative PCR amplification on the diluted DNA by using primers and probes of SEQ ID No. 1-SEQ ID No.7, using goat and cow positive standard substances as positive controls, using sterilized deionized water as negative controls, and using a blank control of DNA extraction as a control group of the extraction method;
(4) setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of corresponding probes of goats, cows and quality control and Ct values of positive control, negative control and blank control; the judgment of the corresponding probe source result can be carried out only when the Ct of the quality control is less than or equal to 35, the Ct of the positive control is less than or equal to 35, and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 35, the result is judged to have corresponding source, and the Ct of the plurality of probes is less than or equal to 35, and the result is judged to have corresponding two-source;
(5) making a DNA quantitative standard curve by using positive standards of goats and cows;
(6) the quantitative detection result of the corresponding source in the raw milk can be obtained by utilizing the Ct value for detecting the corresponding source of the raw milk and a formula in a standard curve.
Further, Real-time PCR amplification parameters were: the pre-denaturation temperature is 94 ℃, 30s, the denaturation temperature is 94 ℃, 5s, the annealing extension temperature is 60 ℃, 31s and 40 cycles.
Furthermore, the Real-time PCR reaction system comprises a Probe qPCR premix 10 mu L, a goat origin detection forward primer 0.5 mu L shown in SEQ ID No.1 with a concentration of 10 mu mol/L0, a cow origin detection forward primer 0.5 mu L shown in SEQ ID No.2 with a concentration of 10 mu mol/L, a goat origin detection reverse primer 0.5 mu L3 shown in SEQ ID No.3 with a concentration of 10 mu mol/L, a cow origin detection reverse primer 0.5 mu L shown in SEQ ID No.4 with a concentration of 10 mu mol/L6, a goat Probe 1 mu L shown in SEQ ID No.5 with a concentration of 10 mu mol/L, a cow Probe 1 mu L shown in SEQ ID No.6 with a concentration of 10 mu mol/L, a quality control Probe 1 mu L shown in SEQ ID No.7 with a concentration of 10 mu mol/L, a concentration of 583948 mu mol/3926 mu mol/582, and a total volume of deionized water.
The invention selects mitochondrial genome sequences of a plurality of varieties or strains of each animal by comparing the mitochondrial genomes of 16 animals such as goats, cattle, sheep, buffalo, yak, pig, horse, camel, donkey, chicken, duck, turkey, rabbit, dog, pigeon, quail and the like. The sequences are compared through biological information software, conserved and specific sequences of the goats and the cows are screened, and primer design software is utilized to design primers and probes. The innovativeness of the design is that two ends of conserved and middle specific sequences need to be screened out on a sequence of 100-150bp, primers are designed at the positions conserved at the two ends, and probes are designed at the positions specific in the middle. The conservative primers and the specific probes can effectively reduce the mismatch between the primers and the competition of a plurality of PCR reactions on reaction resources, and can ensure the progress of multiple real-time fluorescent quantitative PCR reactions. The multiplex real-time fluorescent quantitative PCR reaction is the basis of the detection of multiple source components. The annealing temperatures of the primers and the probes are controlled at 55-60 ℃ and 65-70 ℃, secondary structures influencing the annealing efficiency are avoided, and the design ensures that the primers and the probes can be used for subsequent qualitative and quantitative detection to ensure that the primers and the probes have high specificity on mitochondrial genes.
The invention researches and develops 3-channel detection primers and probes for goats, cows, quality control and the like, and optimizes the combination of the primers and the probes for multi-channel multi-source detection and quality control detection in the same tube. In the process, the problems of influence among various primers and probes in the same PCR reaction system and competition between the template and PCR reaction resources are solved, and the effect that the PCR reaction system can simultaneously carry out multiple real-time fluorescence PCR is achieved.
Compared with the prior art, the invention has the following beneficial effects:
the primer, the probe and the kit have good specificity and high sensitivity, can realize qualitative and quantitative detection of the source of goats and cows in raw milk, can simultaneously detect the goat, the cows and the quality control, save the working procedures and reduce the cost.
Drawings
FIG. 1 shows that real-time fluorescence quantitative PCR detection is carried out on goat meat by using HEX and TAMRA modified probes to mark goat origin, FAM and TAMRA modified probes to mark cow origin, ROX and BHQ2 modified probes to mark quality control contrast, and a quality control amplification curve (quality control-ROX) and a goat origin amplification curve (goat-HEX) appear in the goat meat.
FIG. 2 shows that the quality control amplification curve (quality control-ROX) and the cattle origin amplification curve (cow-FAM) appear in the yellow beef through the real-time fluorescent quantitative PCR detection of the goat origin marked by the HEX and TAMRA modified probes, the cow origin marked by the FAM and TAMRA modified probes, and the ROX and BHQ2 modified probes.
FIG. 3 shows the real-time fluorescence quantitative PCR detection of 14 animal muscle tissues (other meat) such as sheep meat, buffalo meat, yak meat, pork, horse meat, camel meat, donkey meat, chicken meat, duck meat, turkey meat, rabbit meat, dog meat, pigeon meat and quail meat by using HEX and TAMRA modified probes to mark goat origin, FAM and TAMRA modified probes to mark milk cow origin and ROX and BHQ2 modified probes, and only a quality control amplification curve (quality control-ROX) appears in other meat (except goat meat and beef). The above results demonstrate that the goat and cow probes are highly specific in detecting the source in the meat.
FIG. 4 shows the real-time fluorescence quantitative PCR detection of goat, cow and horse milk by using HEX and TAMRA modified probes to label goat origin, FAM and TAMRA modified probes to label cow origin, ROX and BHQ2 modified probes to label quality control, and the quality control amplification curve (quality control-ROX) and goat origin amplification curve (goat-HEX) appear in the goat milk.
FIG. 5 shows the real-time fluorescence quantitative PCR detection of goat, cow and horse milk by using HEX and TAMRA modified probes to label goat origin, FAM and TAMRA modified probes to label cow origin, and ROX and BHQ2 modified probes to label quality control, and a quality control amplification curve (quality control-ROX) and a cow origin amplification curve (cow-HEX) appear in the milk.
FIG. 6 shows that real-time fluorescence quantitative PCR detection is carried out on goat milk, cow milk and horse milk by using HEX and TAMRA modified probes to mark goat source, FAM and TAMRA modified probes to mark cow source and ROX and BHQ2 modified probes to mark quality control, and only a quality control amplification curve (quality control-ROX) appears in horse milk. The above results indicate that goat and cow probes have high specificity in detecting the source in raw milk.
FIG. 7 shows that goat milk DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0001ng and 0.00001ng) is subjected to detection sensitivity amplification experiment by using HEX and TAMRA modified probes to mark goat origin, and goat origin DNA of 0.1pg can be detected by using the goat origin probes. The results show that the goat probe has higher sensitivity in the detection of the source of the raw milk.
FIG. 8 shows that 10pg of milk-derived DNA can be detected by using FAM and TAMRA modified probes to label milk-derived DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0001ng and 0.00001ng) for detection sensitivity amplification experiment. The results show that the cow probe has better sensitivity in the detection of the source of the raw milk.
FIG. 9 goat origin detection standard curve: the method is used for quantitative detection of goat origin in raw milk.
Fig. 10 standard curve for cow source detection: the method is used for quantitatively detecting the source of the dairy cow in the raw milk.
FIG. 11 shows that the HEX and TAMRA modified probes are used for labeling goat origin, FAM and TAMRA modified probes are used for labeling cow origin, ROX and BHQ2 modified probes are used for labeling quality control, goat milk and milk gradient mixed samples (1%, 5%, 10%, 30%, 70%, 90%, 95% and 99%) are subjected to simultaneous detection of goat, cow and quality control, and the results show that the goat probes can detect more than 10% of mixed samples at the level, and the cow probes can detect more than 5% of mixed samples at the level. The above results indicate that the mixed probes (goat, cow and quality control) have the capability of simultaneous in-line detection of goat origin, cow origin and quality control.
Detailed Description
1. The detection method comprises the following steps:
(1) extracting DNA of raw milk, and establishing extraction blank control (control group for subsequent extraction method).
(2) The concentration and quality of the DNA was determined and the concentration was diluted to 100-200 ng/. mu. L.
(3) The DNA diluent is amplified and detected by using multiple fluorescent quantitative PCR primers and probes, positive standards of goats and cows are used as positive controls, sterilized deionized water is used as a negative control, a blank control for DNA extraction is used as a control group of the extraction method, a Real-time PCR reaction system is shown in table 1, and Real-time PCR amplification parameters are shown in table 4.
TABLE 1 Real-time PCR reaction System (simultaneous detection of goat, cow and quality control)
| Composition (I) | Volume (microliter) |
| Probe |
10 |
| Goat source detection forward primer | 0.5 |
| Dairy cow source detection forward primer | 0.5 |
| Goat source detection reverse primer | 0.5 |
| Dairy cow source detection reverse primer | 0.5 |
| |
1 |
| |
1 |
| |
1 |
| |
1 |
| Sterilized deionized |
4 |
| |
20 |
TABLE 2 Real-time PCR reaction System (goat origin and quality control simultaneous detection)
| Composition (I) | Volume (microliter) |
| Probe |
10 |
| Goat source detection forward |
1 |
| Goat source |
1 |
| |
1 |
| |
1 |
| |
1 |
| |
5 |
| |
20 |
TABLE 3 Real-time PCR reaction System (simultaneous detection of Dairy cow source and quality control)
TABLE 4 Real-time PCR amplification parameters
(4) Setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of corresponding probes of goats, cows and quality control and Ct values of positive control, negative control and blank control; the judgment of the corresponding probe source result can be carried out only when the Ct of the quality control is less than or equal to 35, the Ct of the positive control is less than or equal to 35, and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 35, the result is judged to have corresponding source, and the Ct of the plurality of probes is less than or equal to 35, and the result is judged to have corresponding two-source.
(5) Using goat and cow positive standards (dilution 10)1To 107Fold) to make a standard curve for DNA quantification.
(6) The quantitative detection result of the corresponding source in the raw milk can be obtained by utilizing the Ct value for detecting the corresponding source of the raw milk and a formula in a standard curve.
2. Design of primer and Probe sequences
Because mitochondria have high copy number in tissues and are relatively stable in raw milk, mitochondrial genes are selected to design primers and probes for goat, dairy cow and quality control detection. The synthesis method of the primer and the probe comprises the following steps: beijing Rui Boxing Biol.A.was entrusted with the synthesis and purification according to the invented sequence.
Goat origin detection forward primer: 5'TTGAATCAGGCCATGAAGC 3' (SEQ ID No.1),
cow source detection forward primer: 5'TTGAATTAGGCCATGAAGC 3' (SEQ ID No.2),
goat origin detection reverse primer: 5'CTTACCTTGTTACGACTTATCTC 3' (SEQ ID No.3),
cow source detection reverse primer: 5'CTTACCTTGTTACGACTTGTCTC 3' (SEQ ID No.4),
goat probe: 5'TCTCATGTAGTTGATGCGTGTTAATAGGCT 3' (SEQ ID No.5),
a cow probe: 5'CTCTCATGTAGCTAGTGCGTTTAAATAGGG 3' (SEQ ID No.6),
quality control probe: 5'ACACACCGCCCGTCACCCT 3' (SEQ ID No. 7);
the 5 'end of the goat, cow and quality control probe sequence is modified with a reporter group, and the 3' end is modified with a quencher group, wherein the reporter group is any one of FAM, HEX, ROX or CY5, and the quencher group is any one of TAMRA, BHQ1 or BHQ 2.
3. Specific detection of primers and probes
The reaction system of the single-source detection Real-time PCR is shown in the following table
| Composition (I) | Volume (microliter) |
| Probe |
10 |
| Goat or cow source detection forward |
1 |
| Goat or cow source |
1 |
| Probes of |
1 |
| |
1 |
| |
1 |
| Sterilized deionized |
5 |
| |
20 |
qPCR detection of goat meat, beef, mutton, buffalo meat, water buffalo meat, yak meat, pork, horse meat, camel meat, donkey meat, chicken, duck meat, turkey meat, rabbit meat, dog meat, pigeon meat and quail meat by using HEX and TAMRA modified probes to mark goat origin, FAM and TAMRA modified probes to mark cow origin and ROX and BHQ2 modified probes to mark quality control contrast
The detection results are as follows:
ct value: mean (three data) ± standard deviation
The results show that: ct less than 35 (not 0) indicates that the corresponding source is present in the sample. The detection result accords with the animal source of the sample. Goat origin was detected in goat meat, cow origin in beef, and neither goat nor cow origin in the other meats.
qPCR detection of goat milk, cow milk and horse milk by using HEX and TAMRA modified probe to mark goat source, FAM and TAMRA modified probe to mark cow source and ROX and BHQ2 modified probe to mark quality control
The detection results are as follows:
ct value: mean (three data) ± standard deviation
The results show that: ct less than 35 (not 0) indicates that the corresponding source is present in the sample. The detection result accords with the animal source of the sample. Goat and cow sources were detected in goat milk, whereas goat and cow sources were not detected in horse milk.
4. Detection limit experiment of primers and probes for corresponding source detection
Diluting the genomic DNA of goat milk and cow milk respectively 101To 107The primer and probe detection limit amplification experiments were performed in duplicate (8 template concentration gradients total). The following results show that the goat-derived probe can detect 0.1pg of goat-derived DNA in the sample, and the cow-derived probe can detect 10pg of cow-derived DNA in the sample. The results show that the detection limit of the primers and probes of the goats and the cows which are researched and developed by the owner reaches the pg level, and the detection sensitivity is higher.
The detection results are as follows:
ct value: mean (three groups of data) ± standard deviation; N/A not suitable for detection
5. And (3) marking goat source by using HEX and TAMRA modified probes, marking cow source by using FAM and TAMRA modified probes, and marking quality control by using ROX and BHQ2 modified probes to simultaneously detect goat, cow and quality control of goat milk and milk gradient mixed samples (1%, 5%, 10%, 30%, 70%, 90%, 95% and 99%).
The detection results are as follows:
ct value: mean (three data) ± standard deviation
The results show that: a Ct less than 35 (not 0) indicates the corresponding fluorescence correspondences in the sample. The results show that the goat probes can detect more than 10% of the horizontal mixed samples, and the cow probes can detect more than 5% of the horizontal mixed samples. The above results indicate that the mixed probes (goat, cow and quality control) have goat-derived, cow-derived and quality control concordant detection capabilities.
6. Manufacture of kit
(1) The simultaneous detection kit reagents for goat origin and cow origin are shown in the following table:
| reagent | Description of the invention |
| Probe qPCR premix solution | Reaction System (enzyme, dNTP, Mg)2+) |
| Goat source detection forward primer | The concentration was 10. mu. mol/L |
| Dairy cow source detection forward primer | The concentration was 10. mu. mol/L |
| Of goat originDetection of reverse primer | The concentration was 10. mu. mol/L |
| Dairy cow source detection reverse primer | The concentration was 10. mu. mol/L |
| Goat probe | The concentration was 10. mu. mol/L |
| Dairy cow probe | The concentration was 10. mu. mol/L |
| Quality control probe | The concentration was 10. mu. mol/L |
| Goat positive standard substance | The concentration is 100 ng/mu L, and the method is used for positive control and standard curve of goat |
| Cow positive standard substance | The concentration is 100 ng/mu L, and the preparation can be used for cow positive control and standard curve |
| Sterilized deionized water | Complementary reaction system |
(2) The goat derived detection kit reagents are shown in the following table:
| reagent | Description of the invention |
| Probe qPCR premix solution | Reaction System (enzyme, dNTP, Mg)2+) |
| Goat source detection forward primer | The concentration was 10. mu. mol/L |
| Goat source detection reverse primer | The concentration was 10. mu. mol/L |
| Goat probe | The concentration was 10. mu. mol/L |
| Quality control probe | The concentration was 10. mu. mol/L |
| Goat positive standard substance | The concentration is 100 ng/mu L, and the method is used for positive control and standard curve of goat |
| Sterilized deionized water | Complementary reaction system |
(3) The cow source detection kit reagents are shown in the following table:
sequence listing
<110> Applicant's name, Stainer academy of occupational school
<120> primer, probe and kit for synchronously detecting sources of goats and cows in raw milk
<160>7
<170>SIPOSequenceListing 1.0
<210>1
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ttgaatcagg ccatgaagc 19
<210>2
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ttgaattagg ccatgaagc 19
<210>3
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
cttaccttgt tacgacttat ctc 23
<210>4
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cttaccttgt tacgacttgt ctc 23
<210>5
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
tctcatgtag ttgatgcgtg ttaataggct 30
<210>6
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ctctcatgta gctagtgcgt ttaaataggg 30
<210>7
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
acacaccgcc cgtcaccct 19
Claims (6)
1. The primer and the probe for goat-derived, cow-derived and quality control same-tube detection in raw milk are characterized in that the sequences of the primer and the probe are as follows:
the goat origin detection forward primer sequence is shown in SEQ ID No.1,
the sequence of the cow source detection forward primer is shown as SEQ ID No.2,
the sequence of the goat origin detection reverse primer is shown in SEQ ID No.3,
the sequence of the cow source detection reverse primer is shown as SEQ ID No.4,
the goat probe sequence is shown in SEQ ID No.5,
the cow probe sequence is shown in SEQ ID No.6,
the quality control probe sequence is shown in SEQ ID No. 7.
2. The primers and probes for goat-, cow-and quality-control concordant testing in raw milk according to claim 1, wherein 5 'ends of the goat, cow and quality-control probe sequences are modified with a reporter group, 3' ends are modified with a quencher group, the reporter group is any one of FAM, HEX, ROX or CY5, and the quencher group is any one of TAMRA, BHQ1 or BHQ 2.
3. The kit for goat-derived, cow-derived and quality control co-tube detection in raw milk is characterized by comprising the following components in part by weight:
a goat origin detection forward primer shown in SEQ ID No.1,
a cow source detection forward primer shown in SEQ ID No.2,
a goat origin detection reverse primer shown in SEQ ID No.3,
a cow source detection reverse primer shown in SEQ ID No.4,
a goat probe shown as SEQ ID No.5,
a cow probe shown in SEQ ID No.6,
a quality control probe shown in SEQ ID No.7,
the pre-mixed solution of the Probe qPCR is prepared,
a positive standard substance of the goat, wherein,
and (4) cow positive standard substance.
4. The method for goat-derived, cow-derived and quality control co-management detection in raw milk is characterized by comprising the following steps:
(1) extracting DNA of raw milk;
(2) detecting the concentration and quality of the DNA, and diluting the concentration to 100-200 ng/mu L;
(3) carrying out multiplex fluorescence quantitative PCR amplification on the diluted DNA by using primers and probes of SEQ ID No. 1-SEQ ID No.7, using goat and cow positive standard substances as positive controls, using sterilized deionized water as negative controls, and using a blank control of DNA extraction as a control group of the extraction method;
(4) setting Threshold as automatic after the Real-time PCR reaction is finished, and reading Ct values of corresponding probes of goats, cows and quality control and Ct values of positive control, negative control and blank control; the judgment of the corresponding probe source result can be carried out only when the Ct of the quality control is less than or equal to 35, the Ct of the positive control is less than or equal to 35, and the Ct of the negative control and the Ct of the blank control are 0; when the Ct of the corresponding probe is less than or equal to 35, the result is judged to have corresponding source, and the Ct of the plurality of probes is less than or equal to 35, and the result is judged to have corresponding two-source;
(5) making a DNA quantitative standard curve by using positive standards of goats and cows;
(6) the quantitative detection result of the corresponding source in the raw milk can be obtained by utilizing the Ct value for detecting the corresponding source of the raw milk and a formula in a standard curve.
5. The method of in-raw-milk goat-, cow-and quality-control-in-the-same-tube detection as claimed in claim 4, wherein Real-time PCR amplification parameters are: the pre-denaturation temperature is 94 ℃, 30s, the denaturation temperature is 94 ℃, 5s, the annealing extension temperature is 60 ℃, 31s and 40 cycles.
6. The method for goat-, cow-and quality-control syntube detection in raw milk according to claim 4, wherein the Real-time PCR reaction system comprises Probe qPCR premix 10 μ L, goat-derived detection forward primer 0.5 μ L shown in SEQ ID No.1 at a concentration of 10 μmol/L, cow-derived detection forward primer 0.5 μ L shown in SEQ ID No.2 at a concentration of 10 μmol/L, goat-derived detection reverse primer 0.5 μ L shown in SEQ ID No.3 at a concentration of 10 μmol/L, cow-derived detection reverse primer 0.5 μ 7375 shown in SEQ ID No.4 at a concentration of 10 μmol/856, goat Probe 1 μ L shown in SEQ ID No.5 at a concentration of 10 μmol/L, goat-derived detection reverse primer 1 μ L shown in SEQ ID No.6 at a concentration of 10 μmol/L, goat Probe 1 μ L shown in SEQ ID No.5 at a concentration of 10 μmol/L, goat-derived detection Probe 3985 at a concentration of 10 μmol/825967, and a total volume of deionized water containing L and sterile probes 3970 μmol/3 and L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810477823.1A CN108467895B (en) | 2018-05-18 | 2018-05-18 | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810477823.1A CN108467895B (en) | 2018-05-18 | 2018-05-18 | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108467895A CN108467895A (en) | 2018-08-31 |
| CN108467895B true CN108467895B (en) | 2020-08-04 |
Family
ID=63260394
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810477823.1A Active CN108467895B (en) | 2018-05-18 | 2018-05-18 | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108467895B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880918A (en) * | 2019-04-17 | 2019-06-14 | 锡林郭勒职业学院 | The primer and probe and detection method of sheep detection synchronous with pig source property in meat products |
| CN110305973A (en) * | 2019-08-02 | 2019-10-08 | 锡林郭勒职业学院 | The primer and probe and kit of ox detection synchronous with donkey source property in fresh meat and product |
| CN110283918A (en) * | 2019-08-02 | 2019-09-27 | 锡林郭勒职业学院 | The primer and probe and kit of camel detection synchronous with milk cow source property in meat cream |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101659996A (en) * | 2009-07-27 | 2010-03-03 | 花群义 | Fluorescence PCR detection reagent capable of discriminating source components of ruminant animal, preparation method and application thereof |
| CN102534035A (en) * | 2012-02-21 | 2012-07-04 | 山东省农业科学院畜牧兽医研究所 | Kit for fast identifying beef and mutton and use method thereof |
| CN103882012A (en) * | 2014-04-21 | 2014-06-25 | 山东省农业科学院生物技术研究中心 | Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder |
| CN104894227A (en) * | 2014-09-29 | 2015-09-09 | 山东省农业科学院生物技术研究中心 | Quick detection reagent box for goat milk mixed with cow milk or soybean milk |
| CN107475365A (en) * | 2017-07-03 | 2017-12-15 | 中国检验检疫科学研究院 | Fluorescent PCR differentiates composition, kit and the method for sheep Niu Chengfen in sheep breast |
-
2018
- 2018-05-18 CN CN201810477823.1A patent/CN108467895B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101659996A (en) * | 2009-07-27 | 2010-03-03 | 花群义 | Fluorescence PCR detection reagent capable of discriminating source components of ruminant animal, preparation method and application thereof |
| CN102534035A (en) * | 2012-02-21 | 2012-07-04 | 山东省农业科学院畜牧兽医研究所 | Kit for fast identifying beef and mutton and use method thereof |
| CN103882012A (en) * | 2014-04-21 | 2014-06-25 | 山东省农业科学院生物技术研究中心 | Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder |
| CN104894227A (en) * | 2014-09-29 | 2015-09-09 | 山东省农业科学院生物技术研究中心 | Quick detection reagent box for goat milk mixed with cow milk or soybean milk |
| CN107475365A (en) * | 2017-07-03 | 2017-12-15 | 中国检验检疫科学研究院 | Fluorescent PCR differentiates composition, kit and the method for sheep Niu Chengfen in sheep breast |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108467895A (en) | 2018-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108467895B (en) | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk | |
| CN105838795B (en) | The molecular labeling and its application of fat thickness at back of pig and intramuscular fat trait related gene SVEP1 | |
| CN108342495A (en) | Sheep and goat source property synchronizes the primer and probe and kit of detection in meat products | |
| CN108060238B (en) | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk | |
| CN111748609B (en) | Primer and method for identifying fish-derived components | |
| CN106868188B (en) | Deer and bovine derived multiplex fluorescence PCR detection primer, probe, kit, detection method and application in deer-horn glue | |
| CN104946788A (en) | PCR primer and kit for identifying eight kinds of animal-derived components | |
| CN107400729A (en) | A kind of kit and detection method for detecting many animals derived component | |
| CN109694916B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| CN111334585B (en) | Primer and kit for simultaneously detecting 8 animal components, detection method and application | |
| KR101296221B1 (en) | Method of identifying animal species using polymerase chain reaction | |
| CN107858443B (en) | Primer, probe and kit for quantitatively detecting sources of sheep, cattle and pigs in meat products | |
| CN113584182A (en) | Genetic marker of SLC27A5 gene related to meat color redness character of Sichuan yak beef | |
| CN102643912B (en) | Amplification primer for detecting mink derived ingredients | |
| Mukhitdinov et al. | The Role Of Biologically Active Substances In The Blood In Increasing The Productivity Of Sheep | |
| CN110305972B (en) | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products | |
| CN114045349B (en) | Primer, probe and kit for synchronously detecting source of sika deer and red deer | |
| CN105969839B (en) | Taqman-LNA (low-noise amplifier) multiple fluorescence quantitative PCR (polymerase chain reaction) method for simultaneously detecting bovine and porcine derived components in meat and meat products, primer probe and kit | |
| CN114990227A (en) | Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder | |
| CN105734157A (en) | Fluorogenic quantitative PCR primer, probe combination, kit and detecting method for fast identifying camel source ingredients | |
| CN102559919A (en) | Real-time PCR (Polymerase Chain Reaction) detection method of buffalo components in food and feed | |
| KR20060058968A (en) | Selection techniques of bovine weight trait by using the genetic marker of hanwoo growth hormone gene | |
| CN107058543B (en) | Primer for distinguishing animal muscle protein TNNC1 gene and application thereof | |
| CN115927665A (en) | Primer probe combination and kit for non-target 8 animal source detection based on real-time fluorescent PCR | |
| CN110305973A (en) | The primer and probe and kit of ox detection synchronous with donkey source property in fresh meat and product |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |