CN108467895A - The primer and probe and kit of goat detection synchronous with milk cow source property in former milk - Google Patents
The primer and probe and kit of goat detection synchronous with milk cow source property in former milk Download PDFInfo
- Publication number
- CN108467895A CN108467895A CN201810477823.1A CN201810477823A CN108467895A CN 108467895 A CN108467895 A CN 108467895A CN 201810477823 A CN201810477823 A CN 201810477823A CN 108467895 A CN108467895 A CN 108467895A
- Authority
- CN
- China
- Prior art keywords
- source property
- goat
- probe
- seq
- milk
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the primer and probe and kit of goat detection synchronous with milk cow source property in a kind of former milk, primer and probe sequence is as follows：Goat source property detects forward primer sequence as shown in SEQ ID No.1；Milk cow source property detects forward primer sequence as shown in SEQ ID No.2；Goat source property detects reverse primer sequences as shown in SEQ ID No.3；Milk cow source property detects reverse primer sequences as shown in SEQ ID No.4；Goat probe sequence is as shown in SEQ ID No.5；Milk cow probe sequence is as shown in SEQ ID No.6；Quality Control probe sequence is as shown in SEQ ID No.7.The primer of the present invention, the specific good, high sensitivity of probe and kit, may be implemented goat source property in former milk, milk cow source property and Quality Control and are detected with pipe, and can carry out the quantitative detection of goat source property and milk cow source property.
Description
Technical field
The invention belongs to animal derived detection fields in technical field of food detection, more particularly to former milk.
Background technology
Dairy products are the important components of human diet structure, rich in protein, fat, carbohydrate, vitamin
With the nutriments such as minerals (including trace element).These nutritional ingredients are not only to form macroscopical human body and micro-cell
Basis, and regulate and control the source of human life activity and intracellular biological chemical reaction.Dairy products are in addition to containing abundant routine
Except nutritional ingredient, the sensory experience of excellent in color is more to confer to the kernel of its global cuisines.However, along with increasingly
The output and consumption figure of growth, dairy products are adulterated as faking in food production, processing, circulation and catering field
Main target.
China starts to walk evening for the research in terms of dairy products true and false authentication technique, and the research in this field is also in preliminary
Stage.It can be seen that the current research field in terms of dairy products true and false authentication technique, realize it is with the autonomous property right in China,
Safe and efficient detection technique is a research topic full of opportunity great challenge simultaneously.It establishes safe, efficient, fast
Detection technique platform is that the dairy products true and false differentiates research field critical problem urgently to be resolved hurrily.As sheep, horse, ox, hunchbacked product
The Xilinguole League in (dairy products) base is true there is an urgent need to research and develop the dairy products related to milk of the goat milk with independent intellectual property right
Pseudo- authentication technique and examination criteria thereby protect local characteristic dairy products and safeguard the legitimate rights and interests of consumer.Currently, breast system
The product true and false differentiates that relevant technical research, examination criteria, patent of invention and commercial reagents box are concentrated mainly on single channel list
The detection of one source property and different pipe Quality Control detection, while multichannel polyphyly is detected and is reported with pipe Quality Control detection less.False negative one
It is directly puzzlement round pcr widely applied bottleneck in the discriminating of the dairy products true and false.Vacation is can effectively prevent with pipe Quality Control detection
Negative generation.
Invention content
The technical problems to be solved by the invention are：How to provide it is a kind of efficiently and the former milk of high specificity in goat source
Property, milk cow source property and Quality Control primer, probe and the kit and method that are detected with pipe, solve goat and milk cow source in former milk
Property the qualitative and quantitative test problems of ingredient.
The technical scheme is that：The primer and spy that goat source property, milk cow source property and Quality Control are detected with pipe in former milk
Needle, primer and probe sequence are as follows：
Goat source property detects forward primer sequence as shown in SEQ ID No.1；
Milk cow source property detects forward primer sequence as shown in SEQ ID No.2；
Goat source property detects reverse primer sequences as shown in SEQ ID No.3；
Milk cow source property detects reverse primer sequences as shown in SEQ ID No.4；
Goat probe sequence is as shown in SEQ ID No.5；
Milk cow probe sequence is as shown in SEQ ID No.6；
Quality Control probe sequence is as shown in SEQ ID No.7.
Further, the 5' of goat probe, milk cow probe and Quality Control probe sequence is terminal modified has reporter group, 3' terminal modified
Have quenching group, any one in reporter group FAM, HEX, ROX or CY5, quenching group TAMRA, BHQ1 or
Any one in BHQ2.
As another object of the present invention, provides goat source property, milk cow source property and Quality Control in a kind of former milk and examined with pipe
The kit of survey contains in the kit：
Goat source property shown in SEQ ID No.1 detects forward primer,
Milk cow source property shown in SEQ ID No.2 detects forward primer,
Goat source property shown in SEQ ID No.3 detects reverse primer,
Milk cow source property shown in SEQ ID No.4 detects reverse primer,
Goat probe shown in SEQ ID No.5,
Milk cow probe shown in SEQ ID No.6,
Quality Control probe shown in SEQ ID No.7,
Probe qPCR premixed liquids,
Goat positive criteria product,
Milk cow positive criteria product.
It is of course also possible to goat source property individually be detected, in order to save cost, it is only necessary to remove the relevant reagent of milk cow source property
It can (milk cow source property detection forward primer, property detection in milk cow source shown in SEQ ID No.4 shown in SEQ ID No.2 be reversed
Milk cow probe and milk cow positive criteria product shown in primer, SEQ ID No.6) therefore, as another object of the present invention, also
The kit that goat source property and Quality Control are detected with pipe in a kind of former milk is provided, is contained in the kit：
Goat source property shown in SEQ ID No.1 detects forward primer,
Goat source property shown in SEQ ID No.3 detects reverse primer,
Goat probe shown in SEQ ID No.5,
Quality Control probe shown in SEQ ID No.7,
Probe qPCR premixed liquids,
Goat positive criteria product.
It is of course also possible to milk cow source property individually be detected, in order to save cost, it is only necessary to remove the relevant reagent of goat source property
It can (goat source property detection forward primer, property detection in goat source shown in SEQ ID No.3 shown in SEQ ID No.1 be reversed
Goat probe and goat positive criteria product shown in primer, SEQ ID No.5) therefore, as another object of the present invention, also
The kit that milk cow source property and Quality Control are detected with pipe in a kind of former milk is provided, is contained in the kit：
Milk cow source property shown in SEQ ID No.2 detects forward primer,
Milk cow source property shown in SEQ ID No.4 detects reverse primer,
Milk cow probe shown in SEQ ID No.6,
Quality Control probe shown in SEQ ID No.7,
Probe qPCR premixed liquids,
Milk cow positive criteria product.
The method that goat source property, milk cow source property and Quality Control are detected with pipe in former milk, steps are as follows：
(1) DNA of former milk is extracted；
(2) concentration and quality of DNA are detected, and by concentration dilution to 100-200ng/ μ L；
(3) multiple fluorescence quantitative is carried out to dilution DNA using the primer and probe of SEQ ID No.1~SEQ ID No.7
PCR amplification, positive control is done using goat and milk cow positive criteria product, and negative control is done using the deionized water of sterilizing, is utilized
The control group of extracting method is done in the blank control of DNA extractions；
(4) after reaction, setting Threshold is automatic to Real-time PCR, reads goat, milk cow and Quality Control phase
Answer the Ct values and positive control of probe, the Ct of negative control and blank control；Only when Quality Control Ct≤35 and positive control
Ct≤35, negative control and blank control Ct can just carry out the judgement of correspondent probe source property result when being 0；When correspondent probe
Ct≤35, result judgement are while to have Ct≤35 of multiple probes with respective sources, and result judgement is with corresponding two source
Property；
(5) the quantitative standard curves of DNA are done using goat and milk cow positive criteria product；
(6) respective sources in former milk can be obtained using the formula in the Ct values and standard curve of the respective sources of the former milk of detection
The quantitative testing result of property.
Further, Real-time PCR amplifications parameter is：94 DEG C, 30s of denaturation temperature, 94 DEG C, 5s of denaturation temperature,
60 DEG C, 31s of elongating temperature of annealing, 40 cycles.
Further, Real-time PCR reaction systems are：Shown in 10 μ L of Probe qPCR premixed liquids, SEQ ID No.1
Goat source property detection forward primer 0.5 μ L, a concentration of 10 μm of ol/L；Property detection in milk cow source shown in SEQ ID No.2 is positive
Primer 0.5 μ L, a concentration of 10 μm of ol/L；0.5 μ L of goat source property detection reverse primer, a concentration of shown in SEQ ID No.3
10μmol/L；0.5 μ L, a concentration of 10 μm of ol/L of milk cow source property detection reverse primer shown in SEQ ID No.4；SEQ ID
1 μ L, a concentration of 10 μm of ol/L of goat probe shown in No.5；, milk cow probe 1 μ L, a concentration of 10 μ shown in SEQ ID No.6
1 μ L, a concentration of 10 μm of ol/L of Quality Control probe shown in mol/L and SEQ ID No.7；1 μ L of DNA profiling, the deionized water of sterilizing
4 μ L, 20 μ L of total volume.
The present invention by compare goat, ox, sheep, buffalo, yak, pig, horse, camel, donkey, chicken, duck, turkey, rabbit,
The mitochondrial genomes of 16 kinds of animals such as dog, pigeon and quail, each animal choose the chondriogen of multiple kinds or strain
Group sequence.Above-mentioned sequence is compared by bioinformatics software, filters out the conservative and special sequence of goat and milk cow, using drawing
Object design software carries out the design of primer and probe.The novelty of design is to need to filter out in the sequence of 100-150bp
The conservative and intermediate special sequence in both ends, the conservative Position Design primer in both ends, intermediate special Position Design probe.Conservative
Primer and special probe can effectively reduce the competition of mispairing and multiple PCR reactions to reaction resource between primer,
It can ensure the progress of multiple real time fluorescence quantifying PCR reaction.Multiple real time fluorescence quantifying PCR reaction is polyphyly into sorting
The basis of survey.The annealing temperature of primer and probe is controlled in 55-60 DEG C and 65-70 DEG C, and two without influencing annealing efficiency
Level structure, and to ensure primer and probe specificity with height on chondriogen, above-mentioned design ensure primer and
Probe can be used for subsequent qualitative and quantitative detection.
The present invention has developed the 3 Air conduct measurement primer and probe such as goat, milk cow and Quality Control, optimization multichannel polyphyly detection
With the primer and probe combination of same pipe Quality Control detection.A variety of primers and spy in same PCR reaction systems are overcome in the process
Influence between needle and the problem of react the competition of resource to template and PCR, reach PCR reaction systems can simultaneously into
The effect of row multiple real time fluorescence PCR.
Compared with prior art, the invention has the advantages that：
The primer of the present invention, the specific good, high sensitivity of probe and kit, may be implemented goat and milk cow in former milk
The qualitative and quantitative detection of source property, and can carry out detecting while goat, milk cow and Quality Control, process is saved, is reduced
Cost.
Description of the drawings
Fig. 1 utilizes HEX and TAMRA modification probe label goats source property, FAM and TAMRA modification probe label milk cows source property
And the detection of real-time fluorescence quantitative PCR that ROX and BHQ2 modification probe label Quality Control controls carry out chevon, in chevon
There is Quality Control amplification curve (Quality Control-ROX) and goat source property amplification curve (goat-HEX).
Fig. 2 utilizes HEX and TAMRA modification probe label goats source property, FAM and TAMRA modification probe label milk cows source property
And the detection of real-time fluorescence quantitative PCR that ROX and BHQ2 modification probe label Quality Control controls carry out Carnis Bovis seu Bubali, in Carnis Bovis seu Bubali
There is Quality Control amplification curve (Quality Control-ROX) and ox source property amplification curve (milk cow-FAM).
Fig. 3 utilizes HEX and TAMRA modification probe label goats source property, FAM and TAMRA modification probe label milk cows source property
And ROX and BHQ2 modification probe label Quality Control control to meat of a sheep, buffalo meat, yak meat, pork, horseflesh, bactrian camel meat, donkey meat,
The reality that 14 kinds of animal muscle tissues such as chicken, duck, turkey meat, rabbit meat, dog meats, pigeon meat and quail meat (other meat) carry out
When quantitative fluorescent PCR detection, only there is Quality Control amplification curve (Quality Control-ROX) in other meat (in addition to chevon and beef).
It these results suggest that the source property context of detection of goat and milk cow probe in meat has the specificity of height.
Fig. 4 utilizes HEX and TAMRA modification probe label goats source property, FAM and TAMRA modification probe label milk cows source property
And ROX and BHQ2 modification probe label Quality Control controls are to the real-time fluorescence quantitative PCR that is carried out to Goat Milk, milk and mare's milk
It detects, Quality Control amplification curve (Quality Control-ROX) and goat source property amplification curve (goat-HEX) occurs in Goat Milk.
Fig. 5 utilizes HEX and TAMRA modification probe label goats source property, FAM and TAMRA modification probe label milk cows source property
And ROX and BHQ2 modification probe label Quality Control controls are to the real-time fluorescence quantitative PCR that is carried out to Goat Milk, milk and mare's milk
It detects, Quality Control amplification curve (Quality Control-ROX) and milk cow source property amplification curve (milk cow-HEX) occurs in milk.
Fig. 6 utilizes HEX and TAMRA modification probe label goats source property, FAM and TAMRA modification probe label milk cows source property
And ROX and BHQ2 modification probe label Quality Control controls are to the real-time fluorescence quantitative PCR that is carried out to Goat Milk, milk and mare's milk
It detects, Quality Control amplification curve (Quality Control-ROX) only occurs in mare's milk.It these results suggest that goat and milk cow probe in former milk
Property context of detection in source has higher specificity.
Fig. 7 using HEX and TAMRA modification probe label goat source property to Goat Milk DNA (100ng, 10ng, 1ng,
0.1ng, 0.01ng, 0.001ng, 0.0001ng and 0.00001ng) it is detected sensitive amplification experiment, goat source property probe
It can detect the goat source property DNA of 0.1pg.These results suggest that goat probe former milk source property context of detection have compared with
High sensitivity.
Fig. 8 using FAM and TAMRA modification probe label milk cow source property to milk DNA (100ng, 10ng, 1ng, 0.1ng,
0.01ng, 0.001ng, 0.0001ng and 0.00001ng) it is detected sensitive amplification experiment, milk cow source property probe can be examined
Measure the milk cow source property DNA of 10pg.It is preferable sensitive to these results suggest that milk cow probe has in the source property context of detection of former milk
Degree.
Fig. 9 goats source property examination criteria curve：Quantitative detection for goat source property in former milk.
Figure 10 milk cows source property examination criteria curve：Quantitative detection for milk cow source property in former milk.
Figure 11 utilizes HEX and TAMRA modification probe label goats source property, FAM and TAMRA modification probe label milk cows source
Property and ROX and BHQ2 modification probe label Quality Control control to Goat Milk and milk gradient mixing sample (1%, 5%, 10%,
30%, it 70%, 90%, 95% and 99%) carries out goat, milk cow and Quality Control while and detects, as a result show that goat probe all may be used
To detect that 10% level above mixes sample, milk cow probe may detect that 5% level above mixes sample.The above knot
Fruit illustrates that mixed probe (goat, milk cow and Quality Control control) has goat source property, milk cow source property and Quality Control control same simultaneously
Pipe detectability.
Specific implementation mode
1, detection method：
(1) DNA for extracting former milk, sets up extraction blank control (control group for subsequently doing extracting method).
(2) concentration and quality of DNA are detected, and by concentration dilution to 100-200ng/ μ L.
(3) augmentation detection is carried out to DNA dilutions using multiple fluorescence quantitative PCR primer and probe, utilizes goat and milk
Ox positive criteria product does positive control, and negative control is done using the deionized water of sterilizing, is done using the DNA blank controls extracted
The control group of extracting method, Real-time PCR reaction systems are as shown in table 1, Real-time PCR amplifications parameter such as 4 institute of table
Show.
1 Real-time PCR reaction systems (being detected while goat, milk cow and Quality Control) of table
| Ingredient | Volume (microlitre) |
| Probe qPCR premixed liquids | 10 |
| Goat source property detects forward primer | 0.5 |
| Milk cow source property detects forward primer | 0.5 |
| Goat source property detects reverse primer | 0.5 |
| Milk cow source property detects reverse primer | 0.5 |
| Goat probe | 1 |
| Milk cow probe | 1 |
| Quality Control probe | 1 |
| DNA | 1 |
| The deionized water of sterilizing | 4 |
| Total volume | 20 |
2 Real-time PCR reaction systems of table (goat source property and Quality Control detect simultaneously)
| Ingredient | Volume (microlitre) |
| Probe qPCR premixed liquids | 10 |
| Goat source property detects forward primer | 1 |
| Goat source property detects reverse primer | 1 |
| Goat probe | 1 |
| Quality Control probe | 1 |
| DNA | 1 |
| The deionized water of sterilizing | 5 |
| Total volume | 20 |
3 Real-time PCR reaction systems of table (milk cow source property and Quality Control detect simultaneously)
4 Real-time PCR amplification parameters of table
(4) after reaction, setting Threshold is automatic to Real-time PCR, reads goat, milk cow and Quality Control phase
Answer the Ct values and positive control of probe, the Ct of negative control and blank control；Only when Quality Control Ct≤35 and positive control
Ct≤35, negative control and blank control Ct can just carry out the judgement of correspondent probe source property result when being 0；When correspondent probe
Ct≤35, result judgement are while to have Ct≤35 of multiple probes with respective sources, and result judgement is with corresponding two source
Property.
(5) goat and the (dilution 10 of milk cow positive criteria product are utilized1To 107Times) do the quantitative standard curves of DNA.
(6) respective sources in former milk can be obtained using the formula in the Ct values and standard curve of the respective sources of the former milk of detection
The quantitative testing result of property.
2, the design of primer and probe sequence
Since the copy number of mitochondria in the tissue is high, and stablize relatively in former milk, so selection chondriogen
Design goat, milk cow and Quality Control detection primer and probe.The synthetic method of primer and probe：Entrust the farsighted Boxing section biology in Beijing
Company is synthesized and is purified according to the sequence of invention.
Goat source property detects forward primer：5'TTGAATCAGGCCATGAAGC 3'(SEQ ID No.1),
Milk cow source property detects forward primer：5'TTGAATTAGGCCATGAAGC 3'(SEQ ID No.2),
Goat source property detects reverse primer：5'CTTACCTTGTTACGACTTATCTC 3'(SEQ ID No.3),
Milk cow source property detects reverse primer：5'CTTACCTTGTTACGACTTGTCTC 3'(SEQ ID No.4),
Goat probe：5'TCTCATGTAGTTGATGCGTGTTAATAGGCT 3'(SEQ ID No.5),
Milk cow probe：5'CTCTCATGTAGCTAGTGCGTTTAAATAGGG 3'(SEQ ID No.6),
Quality Control probe：5'ACACACCGCCCGTCACCCT 3'(SEQ ID No.7)；
The 5' of goat, milk cow and Quality Control probe sequence is terminal modified reporter group, and 3' is terminal modified quenching group, wherein institute
It is any one in FAM, HEX, ROX or CY5 to state reporter group, and the quenching group is to appoint in TAMRA, BHQ1 or BHQ2
Meaning is a kind of.
3, the specific detection of primer and probe
The Real-time PCR reaction systems of single source property detection are as shown in the table
| Ingredient | Volume (microlitre) |
| Probe qPCR premixed liquids | 10 |
| Goat or milk cow source property detect forward primer | 1 |
| Goat or milk cow source property detect reverse primer | 1 |
| Respective sources probe | 1 |
| Quality Control probe | 1 |
| DNA | 1 |
| The deionized water of sterilizing | 5 |
| Total volume | 20 |
Using HEX and TAMRA modification probe labels goat source property, FAM and TAMRA modification probe label milk cow source property and
ROX and BHQ2 modification probe label Quality Control control to chevon, Carnis Bovis seu Bubali, meat of a sheep, buffalo meat, yak meat, pork, horseflesh,
Bactrian camel meat, donkey meat, chicken, duck, turkey meat, rabbit meat, dog meats, pigeon meat and quail meat carry out the detection of qPCR
Testing result is as follows：
Ct values：Average value (three groups of data) ± standard deviation
As a result illustrate：Ct illustrates there are respective sources in sample less than 35 (being not 0).Testing result meets sample animal
Source.Goat source property is detected in chevon, milk cow source property is detected in Carnis Bovis seu Bubali, and is not detected in other meat
Goat and milk cow source property.
Using HEX and TAMRA modification probe labels goat source property, FAM and TAMRA modification probe label milk cow source property and
ROX and BHQ2 modification probe label Quality Control controls carry out Goat Milk, milk and mare's milk the detection of qPCR
Testing result is as follows：
Ct values：Average value (three groups of data) ± standard deviation
As a result illustrate：Ct illustrates there are respective sources in sample less than 35 (being not 0).Testing result meets sample animal
Source.Goat source property is detected in Goat Milk, milk cow source property is detected in milk, and does not detect mountain in its mare's milk
Sheep and milk cow source property.
4, the detection limit experiment of the primer and probe of respective sources detection
The genomic DNA of Goat Milk and milk is diluted 10 respectively1To 107(totally 8 template concentrations gradients) is drawn again
The amplification experiment of the detection limit of object and probe.By following result it is found that goat source property probe can detect 0.1pg in sample
Goat source property DNA, milk cow source property probe can detect the milk cow source property DNA of 10pg in sample.It these results suggest that and independently grind
The goat of hair and the detection limit of milk cow primer and probe reach pg levels, and the sensitivity of detection is higher.
Testing result is as follows：
Ct values：Average value (three groups of data) ± standard deviation；N/A:It is not suitable for detecting
5, HEX and TAMRA modification probe label goats source property, FAM and TAMRA modification probe label milk cows source property are utilized
And ROX and BHQ2 modification probe label Quality Control control to Goat Milk and milk gradient mixing sample (1%, 5%, 10%, 30%,
70%, it 90%, 95% and 99%) carries out goat, milk cow and Quality Control while and detects.
Testing result is as follows：
Ct values：Average value (three groups of data) ± standard deviation
As a result illustrate：Ct illustrates there is corresponding fluorescence corresponding source in sample less than 35 (being not 0).As a result goat probe is shown
It may detect that 10% level above mixes sample, milk cow probe may detect that 5% level above mixes sample.More than
As a result illustrate that there is mixed probe (goat, milk cow and Quality Control control) goat source property, milk cow source property and Quality Control to be detected with pipe
Ability.
6, kit makes
(1) detection kit reagent is as shown in the table simultaneously for goat source property, milk cow source property：
| Reagent | Explanation |
| Probe qPCR premixed liquids | Reaction system (enzyme, dNTP, Mg2+) |
| Goat source property detects forward primer | A concentration of 10 μm of ol/L |
| Milk cow source property detects forward primer | A concentration of 10 μm of ol/L |
| Goat source property detects reverse primer | A concentration of 10 μm of ol/L |
| Milk cow source property detects reverse primer | A concentration of 10 μm of ol/L |
| Goat probe | A concentration of 10 μm of ol/L |
| Milk cow probe | A concentration of 10 μm of ol/L |
| Quality Control probe | A concentration of 10 μm of ol/L |
| Goat positive criteria product | A concentration of 100ng/ μ L are used for goat positive control and standard curve |
| Milk cow positive criteria product | A concentration of 100ng/ μ L are used for milk cow positive control and standard curve |
| The deionized water of sterilizing | Supplement reaction system |
(2) property detection kit reagent in goat source is as shown in the table：
| Reagent | Explanation |
| Probe qPCR premixed liquids | Reaction system (enzyme, dNTP, Mg2+) |
| Goat source property detects forward primer | A concentration of 10 μm of ol/L |
| Goat source property detects reverse primer | A concentration of 10 μm of ol/L |
| Goat probe | A concentration of 10 μm of ol/L |
| Quality Control probe | A concentration of 10 μm of ol/L |
| Goat positive criteria product | A concentration of 100ng/ μ L are used for goat positive control and standard curve |
| The deionized water of sterilizing | Supplement reaction system |
(3) property detection kit reagent in milk cow source is as shown in the table：
Sequence table
<110>Applicant's title:Siklingelei Professional School
<120>The primer and probe and kit of goat detection synchronous with milk cow source property in former milk
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ttgaatcagg ccatgaagc 19
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ttgaattagg ccatgaagc 19
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cttaccttgt tacgacttat ctc 23
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
cttaccttgt tacgacttgt ctc 23
<210> 5
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
tctcatgtag ttgatgcgtg ttaataggct 30
<210> 6
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
ctctcatgta gctagtgcgt ttaaataggg 30
<210> 7
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
acacaccgcc cgtcaccct 19
Claims (6)
1. the primer and probe that goat source property, milk cow source property and Quality Control are detected with pipe in former milk, which is characterized in that primer and spy
Needle sequence is as follows：
Goat source property detects forward primer sequence as shown in SEQ ID No.1,
Milk cow source property detects forward primer sequence as shown in SEQ ID No.2,
Goat source property detects reverse primer sequences as shown in SEQ ID No.3,
Milk cow source property detects reverse primer sequences as shown in SEQ ID No.4,
Goat probe sequence as shown in SEQ ID No.5,
Milk cow probe sequence as shown in SEQ ID No.6,
Quality Control probe sequence is as shown in SEQ ID No.7.
2. the primer and probe that goat source property, milk cow source property and Quality Control are detected with pipe in original milk according to claim 1,
It is characterized in that, the 5' of goat probe, milk cow probe and Quality Control probe sequence is terminal modified reporter group, 3' is terminal modified to be quenched
Group, any one in reporter group FAM, HEX, ROX or CY5 are arbitrary in quenching group TAMRA, BHQ1 or BHQ2
It is a kind of.
3. the kit that goat source property, milk cow source property and Quality Control are detected with pipe in former milk, which is characterized in that contain in the kit
Have：
Goat source property shown in SEQ ID No.1 detects forward primer,
Milk cow source property shown in SEQ ID No.2 detects forward primer,
Goat source property shown in SEQ ID No.3 detects reverse primer,
Milk cow source property shown in SEQ ID No.4 detects reverse primer,
Goat probe shown in SEQ ID No.5,
Milk cow probe shown in SEQ ID No.6,
Quality Control probe shown in SEQ ID No.7,
Probe qPCR premixed liquids,
Goat positive criteria product,
Milk cow positive criteria product.
4. the method that goat source property, milk cow source property and Quality Control are detected with pipe in former milk, which is characterized in that steps are as follows：
(1) DNA of former milk is extracted；
(2) concentration and quality of DNA are detected, and by concentration dilution to 100-200ng/ μ L；
(3) multiple fluorescence quantitative PCR expansion is carried out to dilution DNA using the primer and probe of SEQ ID No.1~SEQ ID No.7
Increase, does positive control using goat and milk cow positive criteria product, do negative control using the deionized water of sterilizing, carried using DNA
The control group of extracting method is done in the blank control taken；
(4) after reaction, setting Threshold is automatic to Real-time PCR, reads goat, milk cow and Quality Control and accordingly visits
The Ct values and positive control of needle, the Ct of negative control and blank control；Only when Quality Control Ct≤35 and positive control Ct≤35,
Negative control and blank control Ct can just carry out the judgement of correspondent probe source property result when being 0；When Ct≤35 of correspondent probe,
Result judgement is while to have Ct≤35 of multiple probes with respective sources, and result judgement is with corresponding two source property；
(5) the quantitative standard curves of DNA are done using goat and milk cow positive criteria product；
(6) respective sources in former milk can be obtained using the formula in the Ct values and standard curve of the respective sources of the former milk of detection
Quantitative testing result.
5. the method that goat source property, milk cow source property and Quality Control are detected with pipe in original milk according to claim 4, feature
It is, Real-time PCR amplification parameters are：94 DEG C, 30s of denaturation temperature, 94 DEG C, 5s of denaturation temperature, elongating temperature of annealing
60 DEG C, 31s, 40 cycles.
6. the method that goat source property, milk cow source property and Quality Control are detected with pipe in original milk according to claim 4, feature
It is, Real-time PCR reaction systems are：Goat source property shown in 10 μ L of Probe qPCR premixed liquids, SEQ ID No.1 is examined
Survey forward primer 0.5 μ L, a concentration of 10 μm of ol/L；0.5 μ L of milk cow source property detection forward primer, dense shown in SEQ ID No.2
Degree is 10 μm of ol/L；0.5 μ L, a concentration of 10 μm of ol/L of goat source property detection reverse primer shown in SEQ ID No.3；SEQ ID
0.5 μ L, a concentration of 10 μm of ol/L of milk cow source property detection reverse primer shown in No.4；Goat probe 1 shown in SEQ ID No.5
μ L, a concentration of 10 μm of ol/L；, 1 μ L of milk cow probe shown in SEQ ID No.6, a concentration of 10 μm of ol/L and SEQ ID No.7 institutes
Quality Control probe 1 the μ L, a concentration of 10 μm of ol/L shown；1 μ L of DNA profiling, the 4 μ L of deionized water of sterilizing, 20 μ L of total volume.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810477823.1A CN108467895B (en) | 2018-05-18 | 2018-05-18 | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810477823.1A CN108467895B (en) | 2018-05-18 | 2018-05-18 | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108467895A true CN108467895A (en) | 2018-08-31 |
| CN108467895B CN108467895B (en) | 2020-08-04 |
Family
ID=63260394
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810477823.1A Active CN108467895B (en) | 2018-05-18 | 2018-05-18 | Primer, probe and kit for synchronously detecting sources of goats and cows in raw milk |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108467895B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880918A (en) * | 2019-04-17 | 2019-06-14 | 锡林郭勒职业学院 | The primer and probe and detection method of sheep detection synchronous with pig source property in meat products |
| CN110283918A (en) * | 2019-08-02 | 2019-09-27 | 锡林郭勒职业学院 | The primer and probe and kit of camel detection synchronous with milk cow source property in meat cream |
| CN110305973A (en) * | 2019-08-02 | 2019-10-08 | 锡林郭勒职业学院 | The primer and probe and kit of ox detection synchronous with donkey source property in fresh meat and product |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101659996A (en) * | 2009-07-27 | 2010-03-03 | 花群义 | Fluorescence PCR detection reagent capable of discriminating source components of ruminant animal, preparation method and application thereof |
| CN102534035A (en) * | 2012-02-21 | 2012-07-04 | 山东省农业科学院畜牧兽医研究所 | Kit for fast identifying beef and mutton and use method thereof |
| CN103882012A (en) * | 2014-04-21 | 2014-06-25 | 山东省农业科学院生物技术研究中心 | Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder |
| CN104894227A (en) * | 2014-09-29 | 2015-09-09 | 山东省农业科学院生物技术研究中心 | Quick detection reagent box for goat milk mixed with cow milk or soybean milk |
| CN107475365A (en) * | 2017-07-03 | 2017-12-15 | 中国检验检疫科学研究院 | Fluorescent PCR differentiates composition, kit and the method for sheep Niu Chengfen in sheep breast |
-
2018
- 2018-05-18 CN CN201810477823.1A patent/CN108467895B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101659996A (en) * | 2009-07-27 | 2010-03-03 | 花群义 | Fluorescence PCR detection reagent capable of discriminating source components of ruminant animal, preparation method and application thereof |
| CN102534035A (en) * | 2012-02-21 | 2012-07-04 | 山东省农业科学院畜牧兽医研究所 | Kit for fast identifying beef and mutton and use method thereof |
| CN103882012A (en) * | 2014-04-21 | 2014-06-25 | 山东省农业科学院生物技术研究中心 | Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder |
| CN104894227A (en) * | 2014-09-29 | 2015-09-09 | 山东省农业科学院生物技术研究中心 | Quick detection reagent box for goat milk mixed with cow milk or soybean milk |
| CN107475365A (en) * | 2017-07-03 | 2017-12-15 | 中国检验检疫科学研究院 | Fluorescent PCR differentiates composition, kit and the method for sheep Niu Chengfen in sheep breast |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880918A (en) * | 2019-04-17 | 2019-06-14 | 锡林郭勒职业学院 | The primer and probe and detection method of sheep detection synchronous with pig source property in meat products |
| CN110283918A (en) * | 2019-08-02 | 2019-09-27 | 锡林郭勒职业学院 | The primer and probe and kit of camel detection synchronous with milk cow source property in meat cream |
| CN110305973A (en) * | 2019-08-02 | 2019-10-08 | 锡林郭勒职业学院 | The primer and probe and kit of ox detection synchronous with donkey source property in fresh meat and product |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108467895B (en) | 2020-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108342495A (en) | Sheep and goat source property synchronizes the primer and probe and kit of detection in meat products | |
| CN104531884B (en) | Primer and probe composition for distinguishing various animal sources in colla corii asini, kit and multiple real-time fluorescence quantification PCR detection method | |
| CN104946788B (en) | A kind of PCR primer and kit for differentiating 8 kinds of animal derived materials | |
| Guo et al. | Authentication of Edible Bird's nests by TaqMan-based real-time PCR | |
| CN110283918A (en) | The primer and probe and kit of camel detection synchronous with milk cow source property in meat cream | |
| CN108467895A (en) | The primer and probe and kit of goat detection synchronous with milk cow source property in former milk | |
| CN105274099A (en) | Primers, probe composition and kit for rapid identification of nine animal origin ingredients in food or feed, detection method for identification of nine animal origin ingredients in food or feed and application of primers, probe composition, kit and detection method | |
| CN104946790B (en) | A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source | |
| CN107475365A (en) | Fluorescent PCR differentiates composition, kit and the method for sheep Niu Chengfen in sheep breast | |
| CN108060238A (en) | The primer and probe and kit of ox and the detection of horse source property in former milk or acidified milk | |
| CN111334585B (en) | Primer and kit for simultaneously detecting 8 animal components, detection method and application | |
| CN106868188A (en) | Deer in a kind of deer horn glue, ox source property multiple fluorescence PCR detection primer, probe, kit and detection method and application | |
| Herrero et al. | Authentication of male beef by multiplex fast real-time PCR | |
| CN102643912B (en) | Amplification primer for detecting mink derived ingredients | |
| CN107858443B (en) | Primer, probe and kit for quantitatively detecting sources of sheep, cattle and pigs in meat products | |
| CN110004233B (en) | Dual PCR detection kit for adulterated cow milk in special milk and application thereof | |
| CN104789692B (en) | A kind of primer sets and kit for differentiating cattle and sheep pig derived component | |
| CN103122373B (en) | Real-time fluorescence PCR (polymerase chain reaction) reagent kit and real-time fluorescence PCR detection method for specific detection of salmonidae fishes | |
| CN104962650B (en) | A kind of synchronous PCR method and kit for differentiating animal derived materials | |
| CN101812509B (en) | PCR identification method for equine derived material in traditional Chinese medicament | |
| CN105734157A (en) | Fluorogenic quantitative PCR primer, probe combination, kit and detecting method for fast identifying camel source ingredients | |
| CN110305973A (en) | The primer and probe and kit of ox detection synchronous with donkey source property in fresh meat and product | |
| CN114990227A (en) | Primer, probe and kit for synchronously detecting sources of dromedary and bactrian camel in milk powder | |
| CN102559919A (en) | Real-time PCR (Polymerase Chain Reaction) detection method of buffalo components in food and feed | |
| CN109880918A (en) | The primer and probe and detection method of sheep detection synchronous with pig source property in meat products |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |