CN104946790B - A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source - Google Patents
A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source Download PDFInfo
- Publication number
- CN104946790B CN104946790B CN201510447039.2A CN201510447039A CN104946790B CN 104946790 B CN104946790 B CN 104946790B CN 201510447039 A CN201510447039 A CN 201510447039A CN 104946790 B CN104946790 B CN 104946790B
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- pig
- yak
- sheep
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the related production product detection technique field that animal derived materials include meat and its source, specifically providing a pair can be in PCR reaction while detecting goat, sheep, buffalo, family ox, pig, deer, camel and the yak primer of totally 8 kinds of animal derived materials and the Molecular Identification technology of operating process, and the kit and methods for using them comprising above-mentioned primer.The nucleotide sequence of primer is as shown in SEQ ID1 and SEQ ID3.PCR-based technology of the present invention, has the advantages that simple to operate, high specificity, equipment requirement be not high, it is important that can detect 8 kinds of animal derived materials simultaneously in a PCR.The present invention can be used for the identification of tracing to the source of animal derived materials in food meat and its detection of adulterations and feed that produce product.Inventive method is simple and quick, improves detection efficiency.
Description
Technical field
The invention belongs to technical field of food detection, and in particular to a kind of PCR side for 8 kinds of animal derived materials of identification of tracing to the source
Method, i.e., identify goat, sheep, buffalo, family ox, pig, deer, camel and yak derived component simultaneously using pcr amplification reaction.
Background technology
Since ancient times " bread is the staff of life ", " food " is also a Sinitic part.Development and people with social economy
Rhythm of life quickening, the value volume and range of product of food there occurs very big change.The a variety of characteristic meat production products in west area are such as
Yak meat, desert hunchbacked meat and venison etc. have arrived all parts of the country also by network selling.These meats and its various fabricated products into
For people's daily life and the important sources and part of leisure food, but due to cattle and sheep meat and its produce the price of product compared with
The event " hung out a sheep's head but actually sell dog's meat " on the price of the products such as pork, domestic and international market happens occasionally, and not only compromises consumer
Interests, while being also possible to bring the social concerns such as some religious beliefs, consumption sincerity.Therefore, state supervision department successively issues
The multinomial laws and regulations of cloth carry out multiple links of specification these food processings sale, have also technically formulated a series of detection mark
Accurate and method.
The inspection of meat and identification of tracing to the source are after organoleptic examination and the evolution of morphological examination, both inspection parties
Method accuracy is low, limited degrees big, substantially can not particularly with the animal derived materials added in the meat and feed of deep processing
Differentiate.Then Meat ingredients i.e. albumen and DNA authentication method are developed, have established substantially with characteristic in this process
The thinking that nucleic acid DNA is tested as target substance, and nucleic acid DNA especially mitochondrial DNA (mtDNA) has heat resistance
By force, independent of cellular morphology, interspecies variation is good the features such as, shown in species identification the higher degree of accuracy and precision with
And repeatability, the first choice as species identification.Such as authentication method of the multiple species of pig, cattle and sheep in existing national standards
All it is the DNA analysis technology using mtDNA as target.
On the other hand, identify object for single species or using multiple in the most detection method of existing national standards
PCR method simultaneously detect 2-3 species, detection efficiency it is low and identify species quantity it is few, for the identification of ox, sheep, pig and deer
Middle most of method is based on fluorescent quantitative PCR technique, exists to deficiencies such as instrument requirements height, reagent relative price height, to large quantities of
The sample of the non-principal component of amount carries out the cost height of Screening and Identification, time-consuming.Jin Wu armies etc. (Jin Wu armies, as if illuminate is high, Zhang Xiujie, Ruan
It is deep more, a kind of method for differentiating pig, beef or mutton and its product, the B of Authorization Notice No. CN 102337328) invent a kind of discriminating
The method of pig, beef or mutton and its product, improves the efficiency of species identification.Although can in national standard and some inventive methods
To implement to identify venison and pork etc., but to production products such as yak meat, venison and hunchbacked meat in current species identification method
Still without a kind of efficient authentication method.Therefore, set up a kind of simple and easy to do and many animals derived component can be identified simultaneously
Detection method for improve detection operating efficiency and to unknown animal derived materials trace to the source identification all have important meaning
Justice.The present invention is using mtDNA as detection target, the mtDNA complete sequences through the multiple common species of fine correlation, with the conservative sequence of species
There is insertion-deletion fragment in row design primer, amplified production, therefore can identify multiple by analyzing PCR primer between each species
Species, improve detection efficiency.The technology of the present invention method is for improving inspection and quarantine department supervision efficiency and food adulteration
It is all significant in terms of sample census identification.
The content of the invention
It is the invention provides a kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source, i.e., same using pcr amplification reaction
Shi Jianding goats, sheep, buffalo, family ox, pig, deer, camel and yak derived component;So as to make up the deficiencies in the prior art.
The method of the present invention, including the steps:
1) genomic DNA of detected sample is extracted, the sample gene group DNA of extraction is dissolved in TE solution or in pure water
Save backup;
2) using PCR primer to detecting that the genomic DNA of sample carries out pcr amplification reaction;
The primer sequence is as follows:
Upper general sense primer:CCTCCCTAAGACTCAGGGAA(SEQ ID NO:1)、
General reverse primer:CGGAGCGAGAAGAGGGAT(SEQ ID NO:2)、
Anti-sense primer is preferred:CGGAGCGAGAAGAGG(SEQ ID NO:3)、
Described primer also includes being used for the 16S rRNA primers as positive control, and sequence is as follows:
Sense primer:GATTGCGCTGTTATCCCTAGGGTA(SEQ ID NO:4)、
Anti-sense primer:AAGACGAGAAGACCCTTGGACTTTA(SEQ ID NO:5);
3) electrophoresis detection is carried out to PCR primer, according to PCR primer stripe size and whetheing there is can determine that in detection sample whether
Containing above-mentioned 8 kinds of animal derived materials, wherein corresponded to after goat, sheep, buffalo, family ox, pig, deer, camel, yak amplification
Clip size is respectively 787bp, 763bp, 563bp, 512bp, 507bp, 491bp, 455bp and 385bp.
Preferably, in step 2) while setting positive and negative control group.
Step 2) PCR response procedures it is as follows:
95 DEG C of denaturation 5min;95 DEG C of denaturation 30s, anneal 61.5 DEG C of 35s, and 72 DEG C of extension 30s are a circulation, altogether 30
Circulation;Then 72 DEG C keep 10min.4 DEG C are cooled to after end.
Described positive control is the genomic DNA of intact goat, sheep, buffalo, family ox, pig, deer, camel and yak
Sample, can also be with 16S rRNA primers as positive control, and negative control is distilled water.
4) present invention also provides a kind of applicable goat, sheep, buffalo, family ox, pig, deer, camel and yak composition detection
PCR kit, it includes following reagent and suitable concn:
PCR A liquid:Contain dNTP, MgCl2, PCR buffer, Taq polymerase, primer and distilled water.
PCR B liquid:Contain positive DNA profiling, including goat, sheep, buffalo, family ox, pig, deer, camel, the gene of yak
Group DNA.
PCR primer can be presented with agarose or polyacrylamide gel electrophoresis in the present invention.Colouring method optional EB, 4S
The commercially available nucleic acid staining agent such as Green, GelRed or 4S Red and the disclosed other method technology with equivalent effect.
The present invention compared with live species Testing and appraisal technology, can in PCR reaction detection goat, sheep, deer,
Buffalo, family ox, yak, 8 species of pig and camel, and with very high specificity and sensitivity.PCR-based technology of the present invention is put down
Platform is developed, less demanding to laboratory equipment, is applied suitable for most of Molecular Detection laboratory and research unit.Relatively existing inspection
Survey technology substantially increases detection efficiency, has saved manpower and materials, has weight particularly with the detection of tracing to the source of unknown Species composition
Want meaning.
Brief description of the drawings
Fig. 1 is that the present invention expands electricity to the PCR of the DNA sample of goat, sheep, buffalo, family ox, pig, deer, camel and yak
Swimming testing result.For swimming lane numbering 1-8 and correspondence primer size, (the second line number word is correspondence PCR primer size, single shown in figure
Position bp):1:Goat;2:Sheep;3:Deer;4:Buffalo;5:Family ox;6:Yak;7:Pig;8:Camel.With reference to molecular weight mark successively
It is 1200bp, 900bp, 700bp, 500bp, 300bp and 100bp.
Fig. 2 is testing result of the present invention to 8 kinds of animal DNA sample P CR product SspI digestions identifications.Each swimming lane mark in figure
Species name is noted, correspondence product clip size is as follows after its digestion:Goat:317bp, 192bp, 160bp and 118bp;Sheep:
301bp, 237bp, 78bp and 75bp;Deer:417bp and 146bp;Buffalo:512bp;Family ox:329bp and 178bp;Yak:
240bp, 178bp and 73bp;Pig:300bp and 155bp;Camel:385bp.
Fig. 3 is to be examined using primer SEQ ID1 and the SEQ ID3 in the present invention with the double PCR that 16S rRNA primers are constituted
Survey result.Swimming lane, identification PCR primer size and 16S rRNA amplified production sizes are labelled with figure.Compiled shown in figure for swimming lane
Number 1-8 and correspondence primer size (second and the third line numeral be correspondence PCR primer size, unit bp):1:Goat;2:Sheep;
3:Deer;4:Buffalo;5:Family ox;6:Yak;7:Pig;8:Camel.
Embodiment
Applicant passes through to goat, sheep, buffalo, family ox, pig, deer, 8 species of camel and yak and common animals (bag
Include chicken, duck, mouse, rabbit, dog, horse, donkey, fish) mtDNA complete sequences do fine correlation, it was found that in these species each it is peculiar
Series of variation, there is insertion-deletion polymorphism in this section of series of variation, but the sequence at two ends is highly conserved in each species.Cause
This, can be with the conserved sequences of 8 species as primer, specific amplification sequence, and insertion-deletion piece is included in amplified production
Section, these fragments are of different sizes in different plant species, therefore can be used for the identification of species.It is entirely capable of after PCR condition optimizings
Enough reach expected amplified fragments size and specificity and repeatability are good, identify that set up method accurately may be used with digestion through being sequenced
Lean on, what is more important can identify this 8 species simultaneously in One_step PCR, improve the efficiency of species identification.
The procedure of the present invention is described further with reference to example.But example is only limitted to explanation, however it is not limited to
This.The experimental method of unreceipted actual conditions in the following example, generally can routinely condition, such as J. Pehanorm Brookers
Etc. (Sambrook) write《Molecular Cloning:A Laboratory guide》Described in condition, or enter according to the condition proposed by manufacturer
OK.Those skill in the art related can more fully understand and grasp the present invention by example.But, protection of the invention and
Right is not limited to provided case.
The design of primers of embodiment 1
The gene order announced according to GenBank, with goat (GU229278), deer (HQ191428), marsh buffalo
(AF702618), family ox (EU177861), sheep (KF938337), yak (KM233416), pig (AF486867) and camel
(AP003423) mitochondrial DNA (mtDNA) total order is classified as template, by compare analysis 8 species and common species (chicken, duck,
Rabbit, mouse, horse, dog) mtDNA sequences, according to the specificity and conservative of its gene order, utilize Primer premier 5.0
Software, designs the universal primer of multiple species, and the mtDNA sequences of the primer and above-mentioned 8 species of ox are matched, administrative amplification region
In there is insertion-deletion fragment, therefore each species amplified production is of different sizes.In order to improve Detection results, while design two
Bar anti-sense primer is for preferably, primer sequence is as follows:
Upper general sense primer:CCTCCCTAAGACTCAGGGAA(SEQ ID NO:1)、
General reverse primer:CGGAGCGAGAAGAGGGAT(SEQ ID NO:2)、
Moreover, the sensitivity in order to increase detection, anti-sense primer is optimized, the primer sequence after optimization is
CGGAGCGAGAAGAGG(SEQ ID NO:3)。
The optimization of the PCR system of embodiment 2 and reaction condition
PCR reaction systems employ 20 μ L foundational system, and wherein Buffer 2.0 μ L, primer SEQ ID 1 and optimization is drawn
Each 1.6 μ L, Taq archaeal dna polymerases of 2.0 μ L, dNTP mixture 0.2 μ L, MgCl of thing SEQ ID 2 or SEQ ID 321.2 μ L,
The μ L of DNA profiling 3.0 (containing about 30ng DNA), ddH2O is supplemented to 20.0 μ L.
According to above-mentioned PCR system, thermograde (48.0~65.0 DEG C) is set to carry out annealing temperature first on grads PCR instrument
Degree optimization.Basic PCR processes are as follows:95 DEG C of denaturation 5min;95 DEG C of denaturation 40s, different annealing temperature 30s, 72 DEG C of extension 40s
For a circulation, altogether 30 circulations;Then 72 DEG C extend 5min.Through electrophoresis detection, (4S Red agar ribosomal ribonucleic acid contaminates PCR primer
Material) choose afterwards electrophoretic band size with expected in the same size, brightness system based on high, temperature without other amplified productions
Temperature, then carries out Mg successively at such a temperature2+Concentration (2.0,2.5,3.0mM), dNTP concentration and primer concentration and PCR journeys
The optimization of sequence.
By above-mentioned course of reaction and carry out Comparative result, it is determined that with SEQ ID 1 and SEQ ID 3 be optimum combination
20 μ L volume PCR reaction systems, the wherein μ L of Buffer buffer solutions (10 ×) 2.0, each 2.0 μ L of primer SEQ ID1 and SEQ ID 3,
1.6 μ L, Taq archaeal dna polymerases of dNTP mixture 0.2 μ L, MgCl21.6 μ L, the μ L of DNA profiling 3.0 (containing about 30ng DNA),
ddH2O is supplemented to 20.0 μ L.
PCR processes after it optimizes are as follows:95 DEG C of denaturation 5min;95 DEG C of denaturation 30s, 61.5 DEG C of annealing 35s, 72 DEG C of extensions
30s is a circulation, altogether 30 circulations;Then 72 DEG C keep 10min.4 DEG C are cooled to after end.
The PCR primer of embodiment 3 is detected and sequencing
The present invention separates PCR primer in implementing using 2.0% Ago-Gel, and 4S Red nucleic acid dyes add to specifications
In the gel for adding to thawing.Taken pictures after 90V constant pressure electrophoresis 40min under gel imaging system observation.As a result show, in the present invention
PCR primer its size of resolution capable of washing, concrete outcome is shown in Fig. 1 and brief description of the drawings.
Each species PCR primer reclaims PCR primer, send biotech firm to be sequenced according to gel reclaims kit operating instruction.Survey
Sequence result and GenBank alignments, while doing comparative analysis with online software Blast, its similarity and matching degree exist
More than 98%, illustrate that amplified production and sample source are completely the same.
The PCR primer digestion of embodiment 4 is identified
In order to preferably distinguish 8 species, especially PCR primer size close goat and sheep in the present invention,
Buffalo, yak and family ox, fine correlation has been carried out to extension increasing sequence by inventor and applied biology software finds suitable inscribe
DraI, HinCII, DpnI enzyme and SspI are successively have selected in enzyme, the present invention, and totally 4 kinds of restriction endonucleases are identified PCR primer digestion, knot
Fruit shows that SspI can preferably identify above-mentioned 8 species.Fragment of different sizes is produced after each species DNA PCR primer digestion,
Goat PCR primer is divided into 317bp, 192bp, 160bp and 118bp totally 4 fragments after digestion;It is divided into after sheep PCR primer digestion
The fragment of 301bp, 237bp, 78bp and 75bp fragment, wherein 78bp and 75bp often abuts against one in agarose electrophoresis
Rise;The PCR primer digestion of deer produces two fragments of 417bp and 146bp;Buffalo and camel PCR primer do not have point of contact, therefore respectively
Retain original 512bp and 385bp sizes;Two fragments of 329bp and 178bp are produced after family's ox PCR primer digestion, and yak is then
There are tri- fragments of 240bp, 178bp and 73bp;There are two fragments of 300bp and 155bp after the PCR primer digestion of pig, according to these
Number of fragments and difference in size can clearly differentiate each species, and specific electrophoresis result is shown in Fig. 2 and explanation.
The positive control double PCR detection architecture of embodiment 5
The present invention establishes pair of primers can detect the reaction system of 8 species in single tube PCR, but in the detection
Negative and positive control is set, and positive control is at least one of the positive DNA sample in this method DNA, and this undoubtedly increases
Kit cost, also adds workload to detection.In order to be able to preferably improve detection efficiency, the present invention is to positive control body
System is improved, and adds a pair of 16S rRNA primer sets into double PCR, the primer can expand all higher mammals
MtDNA, obtains 233-246bp product, and need not change the reaction condition and reagent of original detection architecture, it is only necessary to add
Each 2.0 μ L of upstream and downstream primer, at the same in reduction system 4 μ L water.Above-mentioned 8 species can be simultaneously after the completion of PCR reactions
The reference product of specific amplification product and 16S rRNA.Without amplified production if DNA in detection extracts failure, if only 16S
RRNA's then excludes above-mentioned 8 species with reference to product.The double PCR system of two pairs of primer compositions has equal specificity, has
Precursor reactant result is shown in Fig. 3.
16S rRNA gene magnification primers reference literature (Bottero M.T., Civera T., Nucera D.&Turi
R.M.(2003)Design of universal primers for the detection of animal tissues in
The Suppl 1,667-669. of feedstuff.Vet Res Commun 27), sequence is as follows:
Sense primer:GATTGCGCTGTTATCCCTAGGGTA
Anti-sense primer:AAGACGAGAAGACCCTTGGACTTTA
Embodiment 6:PCR specificity and sensitivity technique
To verify general sense primer (SEQ ID NO:1) with anti-sense primer (the SEQ ID NO of optimization:3) spy of combination
The opposite sex and sensitivity, the genomic DNA to including above-mentioned 8 species and chicken, duck, squid, little yellow croaker, horse, donkey, dog, mouse and rabbit
Amplified reaction has been carried out, other are as a result proved in addition to goat, sheep, buffalo, family ox, pig, deer, 8 species of camel and yak
Animal expands without PCR.Also confirm simultaneously, this PCR system is to Plant Genome (soybean) DNA without amplified production.Then to primer
SEQ ID 1 and SEQ ID 3 combinations carry out sensitivity technique.The genomic DNA template of family ox, sheep, goat, pig and deer is pressed
According to gradient dilution least concentration to 1.0pg/ μ L, different amounts of DNA profiling, amplification rear electrophoresis detection PCR are added under optimal conditions
Product.As a result show to be 10pg to family ox DNA detection limit in the PCR reaction systems of 20 μ L volumes, sheep it is minimum
Detection limit is 8pg, and the detection limit of goat is 6pg, and the detection limit of pig is 4pg, and the detection limit of deer is 10pg.And
Use anti-sense primer (the SEQ ID NO being not optimised:2), the sensitivity of its detection is combined significantly lower than above-mentioned primer.
Embodiment 7 is actually detected with applying
According to the detection method of above-mentioned foundation, performing PCR is entered to the DNA of ox, sheep, deer, pork sample and mixing sample extraction
Amplification, can each species of clear interpretation after detection.The subsequent shishkabab on sale to market, roasting venison, Jiaozi Stuffed with Pork and Celery, ripe ox
Meat, spiced donkey meat, hand tears hunchbacked meat, plateau yak meat, roasting mutton respectively takes 5 batch samples to be detected, wherein beef, mutton
Identification with deer is performed referring concurrently to GB/T 21104-2007, and the detection of pork is performed with reference to GB/T 21101-2007, yak,
The identification of donkey meat and hunchbacked meat is using the method being sequenced after PCR primer direct purification.As a result show, cooked beef, spiced donkey meat, hand
Tear hunchbacked meat, plateau yak meat, roasting mutton middle has there are 3 parts of incorporations in different degrees of other meats of incorporation, cooked beef
There is a buffalo meat, it is entirely beef that spiced donkey meat, which there are 3 parts, it is entirely that 4 parts completely in beef, plateau yak meat that hand, which tears hunchbacked meat there are 4 parts,
It is beef, pork content is detected in roasting mutton.The method that the present invention is set up is consistent with reference standard method testing result,
Yak (KM65859) and the sequence homology of hunchbacked (JN632608) that the PCR sequencing results and GenBank of yak and hunchbacked meat are announced
97.2% and 98.2% are reached, corresponding ratio is below with the sequence homology of other species.Therefore, the method that the present invention is set up
There is very high reliability to the identification of species.
Claims (4)
1. a kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source, it is characterised in that described method is anti-with PCR amplifications
Goat, sheep, buffalo, family ox, pig, deer, camel and yak derived component should be identified;Including the steps:
1) genomic DNA of detected sample is extracted, the sample gene group DNA of extraction is dissolved in TE solution or preserved in pure water
It is standby;
2) using PCR primer to detecting that the genomic DNA of sample carries out pcr amplification reaction, the primer sequence is as follows:
Upper general sense primer:CCTCCCTAAGACTCAGGGAA(SEQ ID NO:1)、
Anti-sense primer is preferred:CGGAGCGAGAAGAGG(SEQ ID NO:3)、
3) electrophoresis detection is carried out to PCR primer, can determine that whether contain in detection sample according to PCR primer stripe size and whetheing there is
Homologous segment is obtained after above-mentioned 8 kinds of animal derived materials, wherein goat, sheep, buffalo, family ox, pig, deer, camel, yak amplification
Size is respectively 787bp, 763bp, 563bp, 512bp, 507bp, 491bp, 455bp and 385bp.
2. the method as described in claim 1, it is characterised in that described step 3) PCR primer, it is further with SspI digestions
Identification, correspondence product clip size is after its digestion:Goat:317bp, 192bp, 160bp and 118bp;Sheep:301bp、
237bp, 78bp and 75bp;Deer:417bp and 146bp;Buffalo:512bp;Family ox:329bp and 178bp;Yak:240bp、
178bp and 73bp;Pig:300bp and 155bp;Camel:385bp.
3. the method as described in claim 1, it is characterised in that described step 2) PCR response procedures it is as follows:
95 DEG C of denaturation 5min;95 DEG C of denaturation 30s, anneal 61.5 DEG C of 35s, and 72 DEG C of extension 30s are a circulation, and 30 are followed altogether
Ring;Then 72 DEG C keep 10min;4 DEG C are cooled to after end.
4. a kind of PCR kit for being applicable goat, sheep, buffalo, family ox, pig, deer, camel and yak composition detection, it is included
Following reagent and suitable concn:
PCR A liquid:DNTP mixtures containing 0.2mM, 2.0mM MgCl2, 1xPCR buffer, 1U/20 μ L Taq polymerizations
Enzyme, each 1.0mM upstream and downstream primer and distilled water;
Described upstream and downstream primer is the primer that uses in the method for claim 1;
PCR B liquid:Containing positive pig DNA template, concentration is 50ng/ μ L.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510447039.2A CN104946790B (en) | 2015-07-28 | 2015-07-28 | A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510447039.2A CN104946790B (en) | 2015-07-28 | 2015-07-28 | A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104946790A CN104946790A (en) | 2015-09-30 |
CN104946790B true CN104946790B (en) | 2017-10-20 |
Family
ID=54161852
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510447039.2A Active CN104946790B (en) | 2015-07-28 | 2015-07-28 | A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104946790B (en) |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105734157A (en) * | 2016-04-28 | 2016-07-06 | 山东省农业科学院生物技术研究中心 | Fluorogenic quantitative PCR primer, probe combination, kit and detecting method for fast identifying camel source ingredients |
CN106868188B (en) * | 2017-04-11 | 2020-07-31 | 山东省农业科学院生物技术研究中心 | Deer and bovine derived multiplex fluorescence PCR detection primer, probe, kit, detection method and application in deer-horn glue |
CN108531618A (en) * | 2018-05-30 | 2018-09-14 | 贵州省产品质量监督检验院 | Detect triple fluorescent PCR primer probe groups, kit and the detection method of domestic animals derived component |
CN109295241B (en) * | 2018-11-23 | 2022-03-08 | 山东省农业科学院农产品研究所 | Method for distinguishing goat from sheep meat |
CN109735629B (en) * | 2018-12-01 | 2022-05-10 | 兰州海关技术中心 | Kit for detecting pig-derived components in food based on padlock probe technology |
CN110777209B (en) * | 2019-11-07 | 2022-07-26 | 西藏自治区农牧科学院畜牧兽医研究所 | Wheat-hollow yak specific gene, primer group and application |
CN111830218B (en) * | 2020-07-27 | 2021-03-09 | 江苏省家禽科学研究所 | Animal origin identification method for livestock and poultry meat |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103397101A (en) * | 2013-08-22 | 2013-11-20 | 山东省农业科学院生物技术研究中心 | Fluorescently-labeled gene multiplex amplification method for identifying sources of goat, sheep, pig and duck meat simultaneously |
-
2015
- 2015-07-28 CN CN201510447039.2A patent/CN104946790B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103397101A (en) * | 2013-08-22 | 2013-11-20 | 山东省农业科学院生物技术研究中心 | Fluorescently-labeled gene multiplex amplification method for identifying sources of goat, sheep, pig and duck meat simultaneously |
Also Published As
Publication number | Publication date |
---|---|
CN104946790A (en) | 2015-09-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104946790B (en) | A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source | |
CN104946788B (en) | A kind of PCR primer and kit for differentiating 8 kinds of animal derived materials | |
CN104046700B (en) | The detection kit of a kind of Rapid identification donkey hide, horse skin and mule skin | |
CN104404145B (en) | A kind of test kit quickly detecting meat adulteration based on LAMP method | |
CN105648046B (en) | Method for identifying sheep, goat, mink, nutria and duck meat at one time | |
CN106967838A (en) | A kind of RPA primers, kit and detection method for detecting duck derived component | |
CN104774958A (en) | Primer probe composition for identifying sources of animals including donkeys, horses and foxes, kit and multiplex real-time fluorescence quantitative PCR detecting method | |
CN105039329B (en) | The double fluorescent quantitative PCR method of salmon and its deep processed product Identification of Species | |
CN106148559A (en) | The multiple PCR primer system of a kind of five kinds of animal derived materials of synchronous detecting and detection method | |
CN111808975A (en) | Deer species source identification primer pair of pilose antler product and identification method thereof | |
CN107345246B (en) | Diatom rbcL gene analysis method and application thereof in forensic detection | |
CN106987647A (en) | A kind of RPA primers, kit and detection method for detecting pig derived component | |
CN111850134A (en) | Specific forward and reverse primers and probe for rainbow trout, detection kit and application of specific forward and reverse primers and probe | |
CN102643912B (en) | Amplification primer for detecting mink derived ingredients | |
CN105063229B (en) | For detecting quantitative fluorescent PCR specific primer, probe and its kit of sheep derived material in meat products | |
CN104962650B (en) | A kind of synchronous PCR method and kit for differentiating animal derived materials | |
Wang et al. | Identification of chicken-derived ingredients as adulterants using loop-mediated isothermal amplification | |
CN103525908A (en) | Method for rapidly detecting chicken, duck and pig blood components in blood jelly | |
CN104789692B (en) | A kind of primer sets and kit for differentiating cattle and sheep pig derived component | |
CN104726579A (en) | PCR-SSCP kit used for molecular selection of sheep meat performance | |
CN114686600B (en) | Primer group and method for meat detection based on seven-fold PCR technology | |
CN104611454B (en) | The primer sets of the blue fox of a kind of detection simultaneously, racoon dog and dog Species composition and application thereof | |
CN108251534B (en) | Multiple PCR detection kit for rapidly detecting meat-derived food | |
Huang et al. | Identification of species in commercial frozen shrimp meat in Taiwan | |
KR20130130221A (en) | Method for identifying duck using multiplex pcr |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |