CN108060238A - The primer and probe and kit of ox and the detection of horse source property in former milk or acidified milk - Google Patents
The primer and probe and kit of ox and the detection of horse source property in former milk or acidified milk Download PDFInfo
- Publication number
- CN108060238A CN108060238A CN201810072479.8A CN201810072479A CN108060238A CN 108060238 A CN108060238 A CN 108060238A CN 201810072479 A CN201810072479 A CN 201810072479A CN 108060238 A CN108060238 A CN 108060238A
- Authority
- CN
- China
- Prior art keywords
- probe
- seq
- horse
- source property
- milk
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the primer and probe and kit of ox and the detection of horse source property in a kind of former milk or acidified milk, primer and probe sequence is as follows:Ox source property detects forward primer sequence as shown in SEQ ID No.1;Horse source property detects forward primer sequence as shown in SEQ ID No.2;Two source property detect reverse primer sequences as shown in SEQ ID No.3;Ox probe sequence is as shown in SEQ ID No.4;Horse probe sequence is as shown in SEQ ID No.5;Quality Control probe sequence is as shown in SEQ ID No.6.The primer of the present invention, the specific good, high sensitivity of probe and kit, can realize that ox source property in former milk or acidified milk, horse source property and Quality Control are detected with pipe, and can carry out the quantitative detection of ox source Xing Hema sources property.
Description
Technical field
The invention belongs to animal derived detection fields in technical field of food detection more particularly to former milk and acidified milk.
Background technology
Animal derived materials refer to animal tissue, including meat and its products (containing animal viscera).Animal derived detection is
Refer to the method that its derived component is detected from food and feed.Due to the price variance of different animals tissue, drive some illegal
Retailer and enterprise adulterate the low price such as pig and duck meat in the high prices meat products such as ox and sheep, are adulterated in the high prices milk such as mare's milk and hunchbacked milk
The low price milk such as milk.Animal derived detection not only effectively protection consumer lawful right, national interest, religious belief but also can also
Prevent bovine spongiform encephalopathy, transmissible spongiform encephalopathy, the propagation of people and animals' infectious disease such as rabid ox disease and aftosa.Siklingelei
The alliance ox important as north of China, sheep, there is an urgent need to research and develop the animal with independent intellectual property right in horse correlation livestock products base
Source property detection kit.
Mare's milk due to its nutritional ingredient composition and monogastric digestion system be considered as closest human milk food.Koumiss
It is the dairy products using mare's milk spontaneous fermentation.As traditional Mongolian medicine's therapy koumiss have treatment indigestion, blood pressure lowering and
The effect of reducing blood lipid.Since the price of mare's milk is higher with respect to milk, so appearance milk or milk product (yoghurt in the market
With sour soup) the phenomenon that pretending to be mare's milk and koumiss.There is an urgent need to can differentiate the technology of ox source property in horse dairy products in market.At present,
Animal derived materials detection technique is concentrated mainly on to sample protein matter and DNA specific detections and analysis.The technology hand being related to
Section includes enzyme linked immunological (ELISA), PCR (PCR), electrophoresis, chromatography etc..Quantitative real-time PCR (Real-
Time fluorescent polymerase chain reaction, RT-PCR) there is high-throughput and high efficiency.
Saez etc. establishes the random primer that can differentiate pig, ox, sheep, the chicken and turkey amplification fingerprint pattern technology based on DNA.
Walker etc. is developed quantitatively to be detected in the hybrid dna sample that can be never heat-treated for satellite DNA specific designs
I fluorescence quantitative detecting methods of SYBR Green of ox, pig and chicken derived component.Zhang etc. designs primer by chondriogen
With calf-derived Cyclospora in probe in detecting fresh meat, meat products and dairy products, 35pg grades of ox source property DNA can be detected.
This project passes through mitochondrial genomes (ox, horse, sheep, pig, chicken, duck, goose, dog, rabbit, the cat with 11 kinds of animals
And fish) based on, by comparing, analyzing and filter out ox and the combination of primer and probe that horse is special is carried out with quantitative fluorescent PCR
Based on calf-derived Cyclospora and horse derived component qualitative and quantitative detection.It develops and is fitted with high degree of specificity and sensitivity
The primer and probe of detection is examined for ox in former milk and acidified milk and horse derived component.
The content of the invention
The technical problems to be solved by the invention are:How to provide in a kind of efficient and the former milk or acidified milk of high specificity
Primer, probe and the kit and method that ox source property, horse source property and Quality Control are detected with pipe, solve in former milk or acidified milk ox and
The qualitative and quantitative test problems of horse derived component.
The technical scheme is that:The primer that ox source Xing Hema sources property and Quality Control are detected with pipe in former milk or acidified milk
And probe, primer and probe sequence are as follows:
Ox source property detects forward primer sequence as shown in SEQ ID No.1;
Horse source property detects forward primer sequence as shown in SEQ ID No.2;
Two source property detect reverse primer sequences as shown in SEQ ID No.3;
Ox probe sequence is as shown in SEQ ID No.4;
Horse probe sequence is as shown in SEQ ID No.5;
Quality Control probe sequence is as shown in SEQ ID No.6.
Further, the 5' of ox probe, horse probe and Quality Control probe sequence is terminal modified a reporter group, and 3' is terminal modified to be had and quench
Go out group, any one in reporter group FAM, HEX, ROX or CY5, appoints in quenching group TAMRA, BHQ1 or BHQ2
Meaning is a kind of.
As another object of the present invention, ox source Xing Hema sources property and Quality Control in a kind of former milk or acidified milk are additionally provided
With the kit of pipe detection, contain in the kit:
Ox source property detection forward primer shown in SEQ ID No.1,
Horse source property detection forward primer shown in SEQ ID No.2,
Two source property detection reverse primer shown in SEQ ID No.3,
Ox probe shown in SEQ ID No.4,
Horse probe shown in SEQ ID No.5,
Quality Control probe shown in SEQ ID No.6,
Probe qPCR premixed liquids,
Ox positive criteria product,
Horse positive criteria product.
It is of course also possible to ox source property is individually detected, in order to save cost, it is only necessary to remove the relevant reagent of horse source property
(the horse probe and horse positive criteria product shown in horse source property detection forward primer, SEQ ID No.5 shown in SEQ ID No.2) because
This, as another object of the present invention, additionally provides the examination that ox source property and Quality Control are detected with pipe in a kind of former milk or acidified milk
Agent box contains in the kit:
Ox source property detection forward primer shown in SEQ ID No.1,
Two source property detection reverse primer shown in SEQ ID No.3,
Ox probe shown in SEQ ID No.4,
Quality Control probe shown in SEQ ID No.6,
Probe qPCR premixed liquids,
Ox positive criteria product.
It is of course also possible to horse source property is individually detected, in order to save cost, it is only necessary to remove the relevant reagent of ox source property
(the ox probe and ox positive criteria product shown in ox source property detection forward primer, SEQ ID No.4 shown in SEQ ID No.1) because
This, as another object of the present invention, additionally provides the examination that horse source property and Quality Control are detected with pipe in a kind of former milk or acidified milk
Agent box contains in the kit:
Horse source property detection forward primer shown in SEQ ID No.2,
Two source property detection reverse primer shown in SEQ ID No.3,
Horse probe shown in SEQ ID No.5,
Quality Control probe shown in SEQ ID No.6,
Probe qPCR premixed liquids,
Horse positive criteria product.
The method that ox source Xing Hema sources property and Quality Control are detected with pipe in former milk or acidified milk, step are as follows:
(1) DNA of former milk or acidified milk is extracted;
(2) concentration and quality of DNA is detected, and by concentration dilution to 100-200ng/ μ L;
(3) multiple fluorescence quantitative is carried out to dilution DNA using the primer and probe of SEQ ID No.1~SEQ ID No.6
PCR amplification, positive control is done using ox and horse positive criteria product, is done negative control using the deionized water of sterilizing, is carried using DNA
The control group of extracting method is done in the blank control taken;
(4) after reaction, it is automatic to set Threshold to Real-time PCR, reads ox, horse and Quality Control and accordingly visits
The Ct of the Ct values and positive control of pin, negative control and blank control;Only when Quality Control Ct≤35 and positive control Ct≤35,
Negative control and blank control Ct can just carry out the judgement of correspondent probe source property result when being 0;When Ct≤35 of correspondent probe,
Result judgement is with respective sources, while has Ct≤35 of multiple probes, and result judgement is with corresponding two source property;
(5) the quantitative standard curves of DNA are done using ox and horse positive criteria product;
(6) phase in dairy products can be obtained using the formula in the Ct values and standard curve of the respective sources for detecting dairy products
Answer the quantitative testing result of source property.
Further, Real-time PCR amplifications parameter is:94 DEG C, 30s of denaturation temperature, 94 DEG C, 5s of denaturation temperature,
60 DEG C, 31s of elongating temperature of annealing, 40 cycles.
Further, Real-time PCR reaction systems are:Shown in 10 μ L of Probe qPCR premixed liquids, SEQ ID No.1
Ox source property detection 0.5 μ L of forward primer, concentration is 10 μm of ol/L;Horse source property detection forward primer shown in SEQ ID No.2
0.5 μ L, concentration are 10 μm of ol/L;Two source property detection 1 μ L of reverse primer shown in SEQ ID No.3, concentration is 10 μm of ol/L;
1 μ L of ox probe shown in SEQ ID No.4, concentration are 10 μm of ol/L;, 1 μ L of horse probe shown in SEQ ID No.5, concentration is
1 μ L of Quality Control probe shown in 10 μm of ol/L and SEQ ID No.6, concentration are 10 μm of ol/L;1 μ L of DNA, the deionized water 4 of sterilizing
μ L, 20 μ L of total volume.
The present invention is by comparing the chondriogens of 11 kinds of animals such as ox, horse, sheep, pig, chicken, duck, goose, dog, rabbit, cat and fish
Group, each animal choose the mitochondrial genomes sequence of 10 kinds or strain.Above-mentioned 110 are compared by bioinformatics software
Sequence, filter out ox and horse guard with special sequence, primer-design software is utilized to carry out the design of primer and probe.Design
Novelty is that needs filter out the sequence that both ends are guarded and centre is special, the position that both ends are guarded in the sequence of 100-150bp
Install meter primer, intermediate special Position Design probe.Conservative primer and special probe can effectively reduce primer it
Between mispairing and multiple PCR reaction to react resource competition, it is ensured that multiple real time fluorescence quantifying PCR reaction into
Row.Multiple real time fluorescence quantifying PCR reaction is the basis of polyphyly composition detection.The annealing temperature control of primer and probe exists
55-60 DEG C and 65-70 DEG C, and the secondary structure without influencing annealing efficiency, and to ensure primer and probe in mitochondria
There is the specificity of height, above-mentioned design ensures that primer and probe can be used for subsequent qualitative and quantitative detection on gene.
Compared with prior art, the invention has the advantages that:
The primer of the present invention, the specific good, high sensitivity of probe and kit, can realize horse in former milk or acidified milk
It with the qualitative and quantitative detection of ox source property, and can carry out detecting while ox, horse and Quality Control, save process, reduce
Cost.
Description of the drawings
Fig. 1 marks the detection of the real-time fluorescence quantitative PCR of ox source property using FAM and TAMRA modification probes, occurs in beef
Amplification curve illustrates that ox source property primer and probe has specific (A);Utilize HEX and TAMRA modification probe mark horses source property
There is amplification curve in horseflesh in the detection of real-time fluorescence quantitative PCR, illustrates that horse source property primer and probe has specific (B);It is right
The inspection for the real-time fluorescence quantitative PCR that 9 kinds of animal muscle tissues such as sheep, pig, chicken, duck, goose, dog, rabbit, cat and fish (other meat) carry out
It surveys, amplification curve does not all occur, illustrate that ox source Xing Hema sources property primer and probe has specific (A and B).
Fig. 2 utilizes FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX
The detection of real-time fluorescence quantitative PCR is carried out to milk (A) and mare's milk (B) with BHQ2 modification probe mark Quality Control controls, in milk
It detects Quality Control control (amplification curve occur) and ox source property (amplification curve occur), detects that Quality Control control (goes out in mare's milk
Existing amplification curve) and horse source property (amplification curve occur), testing result meet former milk sample animal origin.It these results suggest that mixed
Closing probe has ox source property, horse source property and Quality Control control simultaneously with pipe detectability.
Fig. 3 utilizes FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX
With BHQ2 modification probe mark Quality Control controls to yoghurt (A), koumiss (B) and sour soup (C) (production Mongols tradition milk beans
Rotten by-product) detection of real-time fluorescence quantitative PCR is carried out, detect that Quality Control control (expands in yoghurt and sour soup
Curve) and ox source property (amplification curve occur), detect that Quality Control control (amplification curve occur) and horse source property (go out in koumiss
Existing amplification curve), testing result meets fermented dairy product sample animal origin.It these results suggest that mixed probe has Niu Yuan
Property, horse source property and Quality Control control simultaneously with pipe detectability.
Fig. 4 utilizes FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX
With BHQ2 modification probe mark Quality Control control to milk DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng,
0.0001ng and 0.00001ng) sensitive amplification experiment (A and B) is detected, ox source property probe can detect the ox of 10pg
Source property DNA (A), Quality Control probe can detect the ox source property DNA (B) of 0.01pg.It these results suggest that mixed probe (Niu Yuan
Property, horse source property and Quality Control control) milk source property context of detection have height sensitivity.
Fig. 5 utilizes FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX
With BHQ2 modification probe mark Quality Control control to mare's milk DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng,
0.0001ng and 0.00001ng) sensitive amplification experiment (A and B) is detected, horse source property probe can detect the horse of 1pg
Source property DNA (A), Quality Control probe can detect the horse source property DNA (B) of 0.01pg.It these results suggest that mixed probe (Niu Yuan
Property, horse source property and Quality Control control) mare's milk source property context of detection have height sensitivity.
Fig. 6 utilizes FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX
With BHQ2 modification probe mark Quality Control control to yoghurt DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng,
0.0001ng and 0.00001ng) sensitive amplification experiment (A and B) is detected, ox source property probe can detect the ox of 1ng
Source property DNA (A), Quality Control probe can detect the ox source property DNA (B) of 0.01pg.It these results suggest that mixed probe (Niu Yuan
Property, horse source property and Quality Control control) yoghurt source property context of detection have height sensitivity.
Fig. 7 utilizes FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX
With BHQ2 modification probe mark Quality Control control to koumiss DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng,
0.0001ng and 0.00001ng) sensitive amplification experiment (A and B) is detected, horse source property probe can detect the horse of 1pg
Source property DNA (A), Quality Control probe can detect the horse source property DNA (B) of 0.01pg.It these results suggest that mixed probe (Niu Yuan
Property, horse source property and Quality Control control) koumiss source property context of detection have height sensitivity.
Fig. 8 utilizes FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX
With BHQ2 modification probe mark Quality Control control to sour soup DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng,
0.0001ng and 0.00001ng) sensitive amplification experiment (A and B) is detected, ox source property probe can detect the ox of 10pg
Source property DNA (A), Quality Control probe can detect the ox source property DNA (B) of 0.01pg.It these results suggest that mixed probe (Niu Yuan
Property, horse source property and Quality Control control) sour soup source property context of detection have height sensitivity.
Fig. 9 oxen source property examination criteria curve:For the quantitative detection (A) of ox source property in milk;Horse source property examination criteria is bent
Line:For the quantitative detection (B) of horse source property in mare's milk;Horse source property examination criteria curve:It is quantified for horse source property in koumiss
It detects (C);Ox source property examination criteria curve:For the quantitative detection (D) of ox source property in sour soup.
Figure 10 using FAM and TAMRA modification probe marks ox source property, HEX and TAMRA modification probe mark horse source property and
ROX and BHQ2 modification probe mark Quality Control controls to milk DNA and mare's milk DNA ladder degree biased sample (1%, 5%, 10%,
20%th, 30%, 40%, 50%, 80%, 90%, 95% and 99%) (A) and acid soup DNA and koumiss DNA ladder degree aggregate sample
Product (1%, 5%, 10%, 20%, 30%, 40%, 50%, 80%, 90%, 95% and 99%) (B) carry out ox, horse and Quality Control
It detects simultaneously, as a result illustrates that ox and horse probe may detect that the horizontal biased samples of 1%-5%, illustrate that mixed probe has ox
Source property, horse source property and Quality Control control are simultaneously the same as pipe detectability.
Specific embodiment
1st, detection method:
(1) DNA of former milk and acidified milk is extracted, sets up extraction blank control (control group for subsequently doing extracting method).
(2) concentration and quality of DNA is detected, and by concentration dilution to 100-200ng/ μ L.
(3) augmentation detection is carried out to dilution DNA using multiple fluorescence quantitative PCR primer and probe, it is positive using ox and horse
Standard items do positive control, and negative control is done using the deionized water of sterilizing, and extracting method is done using the DNA blank controls extracted
Control group, Real-time PCR reaction systems are as shown in table 1, and Real-time PCR amplification parameters are as shown in table 4.
1 Real-time PCR reaction systems (being detected while ox, horse and Quality Control) of table
Ingredient | Volume (microlitre) |
Probe qPCR premixed liquids | 10 |
Ox source property detection forward primer | 0.5 |
Horse source property detection forward primer | 0.5 |
Two source property detect reverse primer | 1 |
Ox probe | 1 |
Horse probe | 1 |
Quality Control probe | 1 |
DNA | 1 |
The deionized water of sterilizing | 4 |
Total volume | 20 |
2 Real-time PCR reaction systems of table (ox source property and Quality Control individually detect)
3 Real-time PCR reaction systems of table (horse source property and Quality Control individually detect)
Ingredient | Volume (microlitre) |
Probe qPCR premixed liquids | 10 |
Horse source property detection forward primer | 1 |
Two source property detect reverse primer | 1 |
Horse probe | 1 |
Quality Control probe | 1 |
DNA | 1 |
The deionized water of sterilizing | 5 |
Total volume | 20 |
4 Real-time PCR amplification parameters of table
(4) after reaction, it is automatic to set Threshold to Real-time PCR, reads ox, horse and Quality Control and accordingly visits
The Ct of the Ct values and positive control of pin, negative control and blank control;Only when Quality Control Ct≤35 and positive control Ct≤35,
Negative control and blank control Ct can just carry out the judgement of correspondent probe source property result when being 0;When Ct≤35 of correspondent probe,
Result judgement is with respective sources, while has Ct≤35 of multiple probes, and result judgement is with corresponding two source property.
(5) ox and the (dilution 10 of horse positive criteria product are utilized1To 107) do the quantitative standard curves of DNA (Fig. 4).
(6) phase in dairy products can be obtained using the formula in the Ct values and standard curve of the respective sources for detecting dairy products
Answer the quantitative testing result of source property.
More preferably, the DNA for extracting former milk and acidified milk uses modified CTAB method:By former milk that is fresh or thawing and fermentation
Breast scrapes off the butterfat on centrifuge tube upper strata with small spoon, uses in ultrahigh speed refrigerated centrifuge in 13000r/min, 4 DEG C of centrifugation 10min
Suction pipe removes the lactoprotein in interlayer, leaves one layer of precipitation of bottommost.600 μ L 1xPBS are added in centrifugation bottom of the tube,
Bottom precipitation is beaten and suspends and is transferred in the centrifuge tube of 1.5mL, 4 DEG C of centrifugation 10min of 13000r/min discard upper liquid
Body retains bottom precipitation.Add 60 μ L emulsifiers and 540 μ L 1xPBS to bottom precipitation again, vibrated with oscillator complete to precipitation
It suspends, 40 DEG C of water bath with thermostatic control processing 10min slough the butterfat around body cell, and 4 DEG C of centrifugation 10min of 13000r/min are abandoned
Clearly, 500 μ L of 1xPBS is added to suspend to precipitate, makes body cell precipitation enrichment in 13000r/min room temperature centrifugation 10min, abandons supernatant.It will
Milk obtained by the above process is placed in 1.5mL centrifuge tubes, adds in DNA lysate 1000mL, vortex mixing, in 65 DEG C of metal baths
During which 30min vibrates mixing frequently;13000rpm centrifuges 5min, and transfer supernatant adds in isometric trichlorine in clean centrifuge tube
Methane/isoamyl alcohol (24/1) mixed liquor, abundant mixing, 13000rpm centrifugation 5min take supernatant to be added in new centrifuge tube
Isometric isopropanol, abundant mixing, 13000rpm centrifugation 5min, supernatant discarding, 75% ethyl alcohol washed once, dry, adds in
Suitable ddH2O dissolves, and measures its concentration.It is stored in -20 DEG C.
2nd, the design of primer and probe sequence
Since the copy number of mitochondria in the tissue is high, and stablize relatively in former milk and fermented dairy product, so choosing
Select chondriogen design ox, horse and Quality Control detection primer and probe.The synthetic method of primer and probe:Entrust the farsighted Boxing in Beijing
Biotech firm of section is synthesized and is purified according to the sequence of invention.
Ox source property detection forward primer:5'TTGAATTAGGCCATGAAGC 3'(SEQ ID No.1),
Horse source property detection forward primer:5'TTGAATCAGGCCATGAAGC 3'(SEQ ID No.2),
Two source property detect reverse primer:5'CTTACCTTGTTACGACTTGTCTC 3'(SEQ ID No.3),
Ox probe:5'CTCTCATGTAGCTAGTGCGTTTAAATAGGG 3'(SEQ ID No.4),
Horse probe:5'TTCATATGTTTGGGTCACGGTTTTATGT 3'(SEQ ID No.5),
Quality Control probe:5'ACACACCGCCCGTCACCCT 3'(SEQ ID No.6);
The 5' of ox, sheep and Quality Control probe sequence is terminal modified reporter group, and 3' is terminal modified quenching group, wherein the report
Group is accused as any one in FAM, HEX, ROX or CY5, the quenching group is any one in TAMRA, BHQ1 or BHQ2
Kind.
3rd, the specific detection of primer and probe
The Real-time PCR reaction systems of single source property detection are as shown in the table
3.1 utilize FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX
With BHQ2 modification probe mark Quality Control controls to beef, horseflesh, mutton, pork, chicken, duck, goose, dog meats, rabbit meat, cat meat
And the flesh of fish carries out the detection of qPCR
Testing result is as follows:
Ct values:Average value (three groups of data)+standard deviation;N/A:It is not suitable for detecting
As a result illustrate:Ct illustrates there are respective sources in sample less than 35 (being not 0).Testing result meets sample animal
Source.Ox source property is detected in beef, source property of going into action is detected in horseflesh, and ox and Ma Yuan are not detected in other meat
Property.
3.2 utilize FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX
The detection of qPCR is carried out to milk, mare's milk, yoghurt, koumiss and sour soup with BHQ2 modification probe mark Quality Control controls
Testing result is as follows:
Ct values:Average value (three groups of data)+standard deviation
As a result illustrate:Ct illustrates there are respective sources in sample less than 35 (being not 0).Testing result meets former milk and dairy produce
Sample animal origin.Quality Control control and ox source property are detected in milk, yoghurt and sour soup, are detected in mare's milk and koumiss
Go out Quality Control control and horse source property.
4th, the detection limit experiment of the primer and probe of respective sources detection
The genomic DNA of milk, mare's milk, yoghurt, koumiss and sour soup is diluted 10 respectively1To 107(totally 8 templates are dense
Spend gradient) carry out primer and probe detection limit amplification experiment.From following result, ox source property probe can detect ox
The ox source property DNA of 10pg in milk, horse source property probe can detect the horse source property DNA of 1pg in mare's milk, and ox source property probe can be examined
The ox source property DNA of 1ng in yoghurt is measured, horse source property probe can detect horse source the property DNA, Niu Yuanxing of 1pg in koumiss
Probe can detect the ox source property DNA of 10pg in sour soup, and Quality Control probe may detect that 0.01pg's in five samples
Ox source Xing Huoma sources property DNA.It these results suggest that the detection limit of the ox of independent research, horse and Quality Control primer and probe reaches pg
Level, the sensitivity of detection are higher.
Testing result is as follows:
Ct values:Average value (three groups of data)+standard deviation
5th, FAM and TAMRA modification probe mark oxen source property, HEX and TAMRA modification probe mark horse source property and ROX are utilized
With BHQ2 modification probe mark Quality Control controls to milk DNA and mare's milk DNA ladder degree biased sample (1%, 5%, 10%, 20%,
30%th, 40%, 50%, 80%, 90%, 95% and 99%) and acid soup DNA and koumiss DNA ladder degree biased sample (1%,
5%th, 10%, 20%, 30%, 40%, 50%, 80%, 90%, 95% and 99%) carry out ox, horse and Quality Control while and detect,
As a result illustrate that ox and horse probe may detect that the horizontal biased samples of 1%-5% (milk and mare's milk and sour soup and sour horse
Milk).
Testing result is as follows:
Ct values:Average value (three groups of data)+standard deviation;N/A:It is not suitable for detecting
As a result illustrate:Ct illustrates there is corresponding fluorescence corresponding source in sample less than 35 (being not 0).Ox and horse probe can
Detect the horizontal biased samples of 1%-5% (milk and mare's milk and sour soup and koumiss).
6th, kit makes
(1) detection kit reagent is as shown in the table simultaneously for ox source Xing Hema sources property:
(2) property detection kit reagent in ox source is as shown in the table:
Reagent | Explanation |
Probe qPCR premixed liquids | Reaction system (enzyme, dNTP, Mg2+) |
Ox source property detection forward primer | Concentration is 10 μm of ol/L |
Two source property detect reverse primer | Concentration is 10 μm of ol/L |
Ox probe | Concentration is 10 μm of ol/L |
Quality Control probe | Concentration is 10 μm of ol/L |
Ox positive criteria product | Concentration is 100ng/ μ L, for ox positive control and standard curve |
The deionized water of sterilizing | Supplement reaction system |
(3) property detection kit reagent in horse source is as shown in the table:
Reagent | Explanation |
Probe qPCR premixed liquids | Reaction system (enzyme, dNTP, Mg2+) |
Horse source property detection forward primer | Concentration is 10 μm of ol/L |
Two source property detect reverse primer | Concentration is 10 μm of ol/L |
Horse probe | Concentration is 10 μm of ol/L |
Quality Control probe | Concentration is 10 μm of ol/L |
Horse positive criteria product | Concentration is 100ng/ μ L, for pig positive control and standard curve |
The deionized water of sterilizing | Supplement reaction system |
Sequence table
<110>Siklingelei Professional School
<120>The primer and probe and kit of ox and the detection of horse source property in former milk or acidified milk
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ttgaattagg ccatgaagc 19
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ttgaatcagg ccatgaagc 19
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cttaccttgt tacgacttgt ctc 23
<210> 4
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
ctctcatgta gctagtgcgt ttaaataggg 30
<210> 5
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ttcatatgtt tgggtcacgg ttttatgt 28
<210> 6
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
acacaccgcc cgtcaccct 19
Claims (8)
1. the primer and probe that ox source Xing Hema sources property and Quality Control are detected with pipe in former milk or acidified milk, which is characterized in that draw
Object and probe sequence are as follows:
Ox source property detects forward primer sequence as shown in SEQ ID No.1;
Horse source property detects forward primer sequence as shown in SEQ ID No.2;
Two source property detect reverse primer sequences as shown in SEQ ID No.3;
Ox probe sequence is as shown in SEQ ID No.4;
Horse probe sequence is as shown in SEQ ID No.5;
Quality Control probe sequence is as shown in SEQ ID No.6.
2. in original milk according to claim 1 or acidified milk ox source Xing Hema sources property and Quality Control with the primer that pipe detect with
Probe, which is characterized in that the 5' of ox probe, horse probe and Quality Control probe sequence is terminal modified a reporter group, and 3' is terminal modified to be had and quench
Go out group, any one in reporter group FAM, HEX, ROX or CY5, appoints in quenching group TAMRA, BHQ1 or BHQ2
Meaning is a kind of.
3. the kit that ox source Xing Hema sources property and Quality Control are detected with pipe in former milk or acidified milk, which is characterized in that the reagent
Contain in box:
Ox source property detection forward primer shown in SEQ ID No.1,
Horse source property detection forward primer shown in SEQ ID No.2,
Two source property detection reverse primer shown in SEQ ID No.3,
Ox probe shown in SEQ ID No.4,
Horse probe shown in SEQ ID No.5,
Quality Control probe shown in SEQ ID No.6,
Probe qPCR premixed liquids,
Ox positive criteria product,
Horse positive criteria product.
4. the kit that ox source property and Quality Control are detected with pipe in former milk or acidified milk, which is characterized in that contain in the kit:
Ox source property detection forward primer shown in SEQ ID No.1,
Two source property detection reverse primer shown in SEQ ID No.3,
Ox probe shown in SEQ ID No.4,
Quality Control probe shown in SEQ ID No.6,
Probe qPCR premixed liquids,
Ox positive criteria product.
5. the kit that horse source property and Quality Control are detected with pipe in former milk or acidified milk, which is characterized in that contain in the kit:
Horse source property detection forward primer shown in SEQ ID No.2,
Two source property detection reverse primer shown in SEQ ID No.3,
Horse probe shown in SEQ ID No.5,
Quality Control probe shown in SEQ ID No.6,
Probe qPCR premixed liquids,
Horse positive criteria product.
6. the method that ox source Xing Hema sources property and Quality Control are detected with pipe in former milk or acidified milk, which is characterized in that step is as follows:
(1) DNA of former milk or acidified milk is extracted;
(2) concentration and quality of DNA is detected, and by concentration dilution to 100-200ng/ μ L;
(3) multiple fluorescence quantitative PCR expansion is carried out to dilution DNA using the primer and probe of SEQ ID No.1~SEQ ID No.6
Increase, do positive control using ox and horse positive criteria product, negative control is done using the deionized water of sterilizing, utilize DNA extractions
The control group of extracting method is done in blank control;
(4) after reaction, it is automatic to set Threshold to Real-time PCR, reads ox, horse and Quality Control correspondent probe
Ct values and positive control, the Ct of negative control and blank control;It is negative only when Quality Control Ct≤35 and positive control Ct≤35
Control and blank control Ct can just carry out the judgement of correspondent probe source property result when being 0;When Ct≤35 of correspondent probe, as a result
It is determined as with respective sources, while there are Ct≤35 of multiple probes, result judgement is with corresponding two source property;
(5) the quantitative standard curves of DNA are done using ox and horse positive criteria product;
(6) respective sources in dairy products can be obtained using the formula in the Ct values and standard curve of the respective sources for detecting dairy products
The quantitative testing result of property.
7. the method that ox source Xing Hema sources property and Quality Control are detected with pipe in original milk according to claim 6 or acidified milk,
It is characterized in that, Real-time PCR amplification parameters are:94 DEG C, 30s of denaturation temperature, 94 DEG C of denaturation temperature, 5s, annealing is prolonged
Stretch temperature 60 C, 31s, 40 Xun Huans.
8. the method that ox source Xing Hema sources property and Quality Control are detected with pipe in original milk according to claim 6 or acidified milk,
It is characterized in that, Real-time PCR reaction systems are:Niu Yuan shown in 10 μ L of Probe qPCR premixed liquids, SEQ ID No.1
Property detection 0.5 μ L of forward primer, concentration be 10 μm of ol/L;Horse source property detection 0.5 μ L of forward primer shown in SEQ ID No.2,
Concentration is 10 μm of ol/L;Two source property detection 1 μ L of reverse primer shown in SEQ ID No.3, concentration is 10 μm of ol/L;SEQ ID
1 μ L of ox probe shown in No.4, concentration are 10 μm of ol/L;, 1 μ L of horse probe shown in SEQ ID No.5, concentration is 10 μm of ol/L
With the 1 μ L of Quality Control probe shown in SEQ ID No.6, concentration is 10 μm of ol/L;1 μ L of DNA, the 4 μ L of deionized water of sterilizing, it is overall
20 μ L of product.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810072479.8A CN108060238B (en) | 2018-01-25 | 2018-01-25 | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810072479.8A CN108060238B (en) | 2018-01-25 | 2018-01-25 | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk |
Publications (2)
Publication Number | Publication Date |
---|---|
CN108060238A true CN108060238A (en) | 2018-05-22 |
CN108060238B CN108060238B (en) | 2020-03-10 |
Family
ID=62141929
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810072479.8A Active CN108060238B (en) | 2018-01-25 | 2018-01-25 | Primer, probe and kit for bovine and equine derived detection in raw milk or fermented milk |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108060238B (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110283918A (en) * | 2019-08-02 | 2019-09-27 | 锡林郭勒职业学院 | The primer and probe and kit of camel detection synchronous with milk cow source property in meat cream |
CN110305973A (en) * | 2019-08-02 | 2019-10-08 | 锡林郭勒职业学院 | The primer and probe and kit of ox detection synchronous with donkey source property in fresh meat and product |
CN114045349A (en) * | 2021-12-02 | 2022-02-15 | 锡林郭勒职业学院 | Primer, probe and kit for synchronously detecting sources of sika deer and red deer |
CN114350822A (en) * | 2022-01-21 | 2022-04-15 | 锡林郭勒职业学院 | Primer and probe for synchronously detecting cattle, buffalo and yak in milk meat and quality control |
Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1263559A (en) * | 1997-05-30 | 2000-08-16 | 猪改良英国有限公司 | Method for analyzing animal products |
JP2009065939A (en) * | 2007-09-14 | 2009-04-02 | Aichi Prefecture | Primer set for animal discrimination, and the primer kit |
CN102586436A (en) * | 2012-02-21 | 2012-07-18 | 山东省农业科学院畜牧兽医研究所 | Loop-mediated isothermal amplification (LAMP) detection method for identifying beef and mutton |
CN103740805A (en) * | 2013-10-25 | 2014-04-23 | 刘武军 | SNP marker related to Yili horse milk traits and detection method thereof |
CN105274099A (en) * | 2015-10-23 | 2016-01-27 | 山东省农业科学院生物技术研究中心 | Primers, probe composition and kit for rapid identification of nine animal origin ingredients in food or feed, detection method for identification of nine animal origin ingredients in food or feed and application of primers, probe composition, kit and detection method |
CN105969839A (en) * | 2015-04-29 | 2016-09-28 | 汕头市检测检验学会 | Taqman-LNA multiplex quantitative PCR method for simultaneously detecting cattle and pig-derived ingredient in meat and meat product, primer probe and kit thereof |
CN106048034A (en) * | 2016-07-01 | 2016-10-26 | 北京市食品安全监控和风险评估中心 | Method for scanning and analyzing animal-source components in food based on PCR-RLFP-DHPLC technology |
CN107460248A (en) * | 2017-09-27 | 2017-12-12 | 黑龙江珍宝岛药业股份有限公司 | A kind of primer combination for detecting animal derived components and application, detection kit |
-
2018
- 2018-01-25 CN CN201810072479.8A patent/CN108060238B/en active Active
Patent Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1263559A (en) * | 1997-05-30 | 2000-08-16 | 猪改良英国有限公司 | Method for analyzing animal products |
JP2009065939A (en) * | 2007-09-14 | 2009-04-02 | Aichi Prefecture | Primer set for animal discrimination, and the primer kit |
CN102586436A (en) * | 2012-02-21 | 2012-07-18 | 山东省农业科学院畜牧兽医研究所 | Loop-mediated isothermal amplification (LAMP) detection method for identifying beef and mutton |
CN103740805A (en) * | 2013-10-25 | 2014-04-23 | 刘武军 | SNP marker related to Yili horse milk traits and detection method thereof |
CN105969839A (en) * | 2015-04-29 | 2016-09-28 | 汕头市检测检验学会 | Taqman-LNA multiplex quantitative PCR method for simultaneously detecting cattle and pig-derived ingredient in meat and meat product, primer probe and kit thereof |
CN105274099A (en) * | 2015-10-23 | 2016-01-27 | 山东省农业科学院生物技术研究中心 | Primers, probe composition and kit for rapid identification of nine animal origin ingredients in food or feed, detection method for identification of nine animal origin ingredients in food or feed and application of primers, probe composition, kit and detection method |
CN106048034A (en) * | 2016-07-01 | 2016-10-26 | 北京市食品安全监控和风险评估中心 | Method for scanning and analyzing animal-source components in food based on PCR-RLFP-DHPLC technology |
CN107460248A (en) * | 2017-09-27 | 2017-12-12 | 黑龙江珍宝岛药业股份有限公司 | A kind of primer combination for detecting animal derived components and application, detection kit |
Non-Patent Citations (1)
Title |
---|
JOANA GONCALVES等: "New Method for the Simultaneous Identifi cation of Cow, Sheep, Goat, and Water Buffalo in Dairy Products by Analysis of Short Species-Specifi c Mitochondrial DNA Targets", 《J. AGRIC. FOOD CHEM.》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110283918A (en) * | 2019-08-02 | 2019-09-27 | 锡林郭勒职业学院 | The primer and probe and kit of camel detection synchronous with milk cow source property in meat cream |
CN110305973A (en) * | 2019-08-02 | 2019-10-08 | 锡林郭勒职业学院 | The primer and probe and kit of ox detection synchronous with donkey source property in fresh meat and product |
CN114045349A (en) * | 2021-12-02 | 2022-02-15 | 锡林郭勒职业学院 | Primer, probe and kit for synchronously detecting sources of sika deer and red deer |
CN114045349B (en) * | 2021-12-02 | 2023-08-01 | 锡林郭勒职业学院 | Primer, probe and kit for synchronously detecting source of sika deer and red deer |
CN114350822A (en) * | 2022-01-21 | 2022-04-15 | 锡林郭勒职业学院 | Primer and probe for synchronously detecting cattle, buffalo and yak in milk meat and quality control |
Also Published As
Publication number | Publication date |
---|---|
CN108060238B (en) | 2020-03-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108060238A (en) | The primer and probe and kit of ox and the detection of horse source property in former milk or acidified milk | |
CN114438231B (en) | CRELD1 gene molecular marker related to chicken carcass traits and application | |
CN108342495A (en) | Sheep and goat source property synchronizes the primer and probe and kit of detection in meat products | |
CN113913538A (en) | SNP molecular marker related to chicken carcass traits and application | |
CN111334585B (en) | Primer and kit for simultaneously detecting 8 animal components, detection method and application | |
CN106868188A (en) | Deer in a kind of deer horn glue, ox source property multiple fluorescence PCR detection primer, probe, kit and detection method and application | |
CN110283918A (en) | The primer and probe and kit of camel detection synchronous with milk cow source property in meat cream | |
Fellahi et al. | Phylogenetic analysis of avian infectious bronchitis virus S1 glycoprotein regions reveals emergence of a new genotype in Moroccan broiler chicken flocks | |
CN108467895A (en) | The primer and probe and kit of goat detection synchronous with milk cow source property in former milk | |
CN102643912B (en) | Amplification primer for detecting mink derived ingredients | |
CN107858443B (en) | Primer, probe and kit for quantitatively detecting sources of sheep, cattle and pigs in meat products | |
CN103060435B (en) | Primers and probes for detecting fox component in food and feed | |
CN104480212A (en) | Detection method of SNP (single nucleotide polymorphism) site of cattle PLIN2 gene as well as detection kit | |
CN107287338A (en) | Multiple fluorescence quantitative detects neogenesis cryptococcus and the kit and method of Aspergillus | |
CN106119390A (en) | A kind of based on MGB probe identification donkey skin, Corium Equi and the test kit of mule skin and detection method thereof | |
CN113151489B (en) | Molecular diagnosis method for evaluating growth traits based on cow ZNF146 gene CNV marker and application thereof | |
CN101812509A (en) | PCR identification method for equine derived material in traditional Chinese medicament | |
CN105734157A (en) | Fluorogenic quantitative PCR primer, probe combination, kit and detecting method for fast identifying camel source ingredients | |
CN110343766A (en) | A method of based on calf-derived Cyclospora in QPCR quantitative detection livestock meat | |
CN110305973A (en) | The primer and probe and kit of ox detection synchronous with donkey source property in fresh meat and product | |
CN109880918A (en) | The primer and probe and detection method of sheep detection synchronous with pig source property in meat products | |
CN112501280A (en) | High-sensitivity detection method for hydatid cyst based on high-throughput sequencing | |
CN107130037B (en) | Method and special kit for auxiliary detection of cattle growth and carcass traits through TNNI1 gene | |
CN108676900A (en) | A kind of composite PCR parting kit and its application for distinguishing eight kinds of Serotyping of Actinobacilus pleuropneumoniae | |
CN104962644A (en) | Primer and probe composition and kit for detecting whether donkey milk contains cow milk |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |