JP2009065939A - Primer set for animal discrimination, and the primer kit - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a primer set capable of easily and efficiently discriminating the kind of animal from which foreign materials in foods originate. <P>SOLUTION: The number of PCR reactions necessary for detection can be decreased, by using a primer set enabling proper PCR reaction, even in a mixed state for detecting the animal kind from which foreign materials in a test material originate. Since each primer set is prepared to enable the PCR reaction of all primer pairs, included in the primer set under the same condition, the PCR reaction of only the primer pair, necessary for the detection, can be carried out, simultaneously, with primer pairs included in the different primer set to decrease the number of the reactions. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a primer set for quickly and easily detecting an animal species derived from an animal-derived substance mixed in food.

Due to the increasing demand for food safety, the demand for detection of animal species in food-contaminated foreign substances is increasing rapidly.
In recent years, a PCR (Polymerase Chain Reaction) method, which is one of genetic engineering techniques, has been used for detection of animal species from which food or food-contaminated foreign substances originate. The PCR method is a method in which two short DNA fragments called primers are used and DNA derived from an animal species contained in a sample is used as a template, and a specific part thereof is copied several hundred thousand times and increased. Therefore, even DNA contained in a very small amount of sample can be detected with high sensitivity, and since it is a technique that amplifies in a short time, it can be used in foods and feeds in terms of simplicity, speed, and accuracy. It is expected to be applicable to the detection of animal species (Patent Document 1).

JP 2003-230383 A

However, the detection method using the conventional PCR method, when detecting animal species in food-contaminated foreign substances, the existing primer pairs reported so far have different reaction conditions for each PCR reaction. There is a problem that the PCR reaction cannot be performed and the number of PCR reactions is increased depending on the number of samples.
In addition, in order to reduce the number of PCR reactions, even if primers for different animal species are simply mixed to carry out the PCR reaction, there is a high possibility that they will bind to each other.

  Therefore, the present inventor has intensively studied to solve the above-mentioned problems, and a primer pair that can perform a PCR reaction satisfactorily even in a situation where a PCR reaction can be performed under the same conditions and another primer pair exists simultaneously. It has led to the development of a primer set that can distinguish animal species.

  The present inventors paid attention to a mitochondrial genome having a higher copy number than a nuclear gene. Among them, the cytochrome b gene having the most DNA sequence information was selected, and primers were designed based on the alignment of 12 kinds of mammals that are highly required to identify foreign substances mixed in food, thereby completing the present invention.

The invention described in claim 1 is a primer set for detecting a gene sequence specific to an animal derived from a cytochrome b gene sequence of mitochondrial DNA, and the following SEQ ID NOs: 1 and 2 specific to cattle A primer pair for identification of animal species comprising the following primer pairs: SEQ ID NO: 3 and 4 primer pairs specific to pigs, and the following primer pairs SEQ ID NOs: 5 and 6 specific to birds.
SEQ ID NO: 1
CCATACCATCGGCAACAATT
SEQ ID NO: 2
AATATAGTAGTGGAACTATGGCAATT
SEQ ID NO: 3
CTCCATCCTAATCCTAATTTTTAATG
SEQ ID NO: 4
CGATGATGCTAGTGATTGGTATC
SEQ ID NO: 5
CCAAAAATAAACTAATGCGCACC
SEQ ID NO: 6
CGGTGAGGATTTGGGTC
In the animal species of claim 1, bovine refers to the “Bos taurus” species, pig refers to the “Sus scrofa” species, and bird refers to the “Gallus gallus” species.

The invention described in claim 2 is a primer set for detecting an animal-specific gene sequence derived from the cytochrome b gene sequence of mitochondrial DNA, which is specific to horses as shown in SEQ ID NOs: 7 and 8 below. And a primer pair of SEQ ID NOs: 9 and 10 specific for sheep and a primer pair of SEQ ID NOs: 11 and 12 specific for goats and a primer set for distinguishing animal species.
SEQ ID NO: 7
GAGGAGCAACAGCATCATCATG
SEQ ID NO: 8
CGTGAAGAAATATAGTAAATGTACGAACTATC
SEQ ID NO: 9
GGAGTAATCCCTCCATTTGCG
SEQ ID NO: 10
GCGATGATGAATGGGAAA
SEQ ID NO: 11
ATGACCAACATCCGAAAG
SEQ ID NO: 12
GTATTGCTAGGAATAGGCCTGTC
In the animal species of claim 2, the horse indicates the “Equus caballus” species, the sheep indicates the “Ovis aries” species, and the goat indicates the “Capra hircus” species.

The invention described in claim 3 is a primer set for detecting a gene sequence specific to an animal derived from a cytochrome b gene sequence of mitochondrial DNA, and the following SEQ ID NOs: 13 and 14 specific to rabbits A primer pair of SEQ ID NOs: 15 and 16 specific for dogs, a primer pair of SEQ ID NOs: 17 and 18 specific for cats, and a SEQ ID NO: 17 and 25 specific for cats It is a primer set for distinguishing animal species comprising primer pairs.
SEQ ID NO: 13
CATTTATCATGCCAACTTTAGTCTTAA
SEQ ID NO: 14
AATAAGGAGGGAGAAGAATGGC
SEQ ID NO: 15
GGCTGAATTATTCCGCTATATG
SEQ ID NO: 16
AATTCCAATGTTTCATGTTTCTATGAATAC
SEQ ID NO: 17
ACCCTCAAAACAAGGAGA
SEQ ID NO: 18
AGACTCTTCATTTGAGTAGACG
SEQ ID NO: 25
AGACTCTTCATTGAGTAGGGCG
In the animal species of claim 3, the rabbit indicates the “Oryctolagus cuniculus” species, the dog indicates the “Canis familiaris” species, and the cat indicates the “Felis catus” species.

The invention described in claim 4 is a primer set for detecting a gene sequence specific to an animal derived from the cytochrome b gene sequence of mitochondrial DNA, and the following SEQ ID NOs: 19 and 20 specific to a rat And a primer pair of the following SEQ ID NOs: 21 and 22 specific for the mouse and a primer pair of the following SEQ ID NOs: 23 and 24 specific for the mouse.
SEQ ID NO: 19
AGCCTTCCTACCATTCTCTG
SEQ ID NO: 20
TTTCATTTTAACATTTTTGCTCCAAC
SEQ ID NO: 21
GCTCTCTTCTAGGAGGTATGCCCTTAG
SEQ ID NO: 22
GAGTAACTGATGGAGATGCTGTTAAA
SEQ ID NO: 23
TCAAGATATCTCTAGGTATCCTAATCA
SEQ ID NO: 24
GGTGTTTAGTGGATTAGCTGGTA
In the animal species of claim 4, the rat refers to the “Rattus norvegicus” species, the rat refers to the “Rattus rattus” species, and the mouse refers to the “Mus musuculus” species.

  The invention described in claim 5 includes at least one first primer pair included in the primer set according to claim 1 and at least one second primer included in the primer set according to claim 2. A primer comprising a primer pair, at least one third primer pair included in the primer set according to claim 3, and at least one fourth primer pair included in the primer set according to claim 4. It is a primer kit for identifying an animal species constituted by at least two or more primer pairs selected from a pair group.

Since the primer sets of claims 1 to 4 include primers corresponding to three kinds of animals that do not bind each other in one primer set, it is possible to simultaneously perform PCR reactions in the same tube. It is possible to reduce the number of PCR reactions necessary for detection.
Moreover, since the PCR products synthesized with one primer set are synthesized in different sizes for each of the three types of animals, it can be easily estimated which animal the DNA in the sample is derived from.
Furthermore, since the primer kit of claim 5 can perform the PCR reaction under the same reaction conditions for all the primers contained in the four different primer sets, the four primer sets are reacted at the same time on the same PCR machine. And the number of necessary PCR reactions can be reduced.
These characteristic effects make it possible to easily and quickly determine the identity of foreign matters mixed in food, beverages, etc., and it becomes possible to easily examine and develop the cause of mixing and means for avoiding mixing.

  The primer set and primer kit of the present invention and the method of using the same are preferably carried out under the following conditions, but are not limited thereto.

(Primer)
The primer of the present invention is purified by a commonly used method (for example, column chromatography) after extending the nucleotide on the support using an automatic DNA synthesizer, then deprotecting and cleaving from the support. Thus, the target primer can be obtained.

The primer pairs shown in the present invention are constructed by selecting the sense strand (SEQ ID NO: odd number) upstream of the target DNA of each species and the antisense strand (SEQ ID NO: even number) downstream. However, with respect to the primer pair for cats, SEQ ID NO: 17 is used as the sense strand, SEQ ID NO: 18 is used as the antisense strand, and SEQ ID NO: 25 is used as the antisense strand because of polymorphism within the cat species.
In each arrangement, the left end corresponds to the 5 ′ side, and the right end corresponds to the 3 ′ side. Symbols 5 ′ and 3 ′ indicate the positions of sugar carbons constituting DNA. Symbols C, A, T, and G represent known base types.
Furthermore, the amplification size indicated in the present invention is the length of the PCR product amplified by each species-specific primer pair, and its unit bp is a base pair.

(Primer usage)
The amount of the primer used for the PCR reaction using the primer set of the present invention is not particularly limited, but generally it is preferably used at a final concentration of 0.2 to 0.5 μM, more preferably 0.25 to 0. More preferably, 4 μM is used.

(DNA extraction method)
A well-known method can be adopted for extraction of DNA from food-contaminated foreign substances used for PCR reaction using the primer set of the present invention. For example, as such a method, the Marmur method, the enzyme method, the benzyl chloride method, the CTAB method and the like can be mentioned. It is also possible to use a commercially available kit for roughly extracting DNA in a short time, such as Prepman Ultra Reagent (manufactured by Applied Biosystems).
In addition, for efficient DNA extraction from test foreign matter such as animal hair that has been treated by heating or the like and contains only a small amount of DNA, it is desirable to use a proteolytic enzyme such as proteinase K. For example, QIAamp DNA Micro kit It is also possible to use a commercially available kit for extracting and purifying a very small amount of DNA such as (manufactured by QIAGEN).

(Sample to be measured)
Samples to be measured by PCR reaction using the primer set of the present invention include raw meat, processed meat food, processed food containing food, blood, body hair, body fluid, milk, meat and bone meal, bone meal, and a sample containing these, Examples include fertilizers and feed additives.

(PCR)
In the PCR reaction using the primer set of the present invention, a block type or capillary type apparatus can be used as the PCR apparatus. The conditions for the PCR reaction are not particularly limited, and an optimum condition may be determined for each specimen. For example, when the primer set according to the present application is used, the following conditions are preferable.
-Heat denaturation of double-stranded DNA into a single strand: heating at about 90 ° C to 98 ° C, preferably about 92 ° C to 96 ° C, for about 1 second to about 1 minute, preferably about 3 seconds to about 30 seconds.
Annealing: Heating at about 50 ° C. to 75 ° C., preferably about 50 ° C. to 70 ° C., more preferably about 55 ° C. to 65 ° C. for about 1 second to 1 minute 30 seconds, preferably about 5 seconds to 30 seconds .
DNA extension reaction: Heated at about 50 ° C. to 75 ° C., preferably about 70 ° C. to 74 ° C. for about 3 seconds to 2 minutes, preferably about 5 seconds to 1 minute.
-Mg ion concentration in the reaction solution: Usually about 1.0 to 3.5 mM, preferably about 2.0 to 3.0 mM.
By performing the above reaction for about 25 to 40 cycles, the specific gene region of the target cytochrome b can be amplified to a detectable level.

(DNA detection process)
The detection of the reaction product after completion of the PCR reaction using the primer set of the present invention can be visualized by separating the amplified product by agarose gel electrophoresis and performing nucleic acid staining with ethidium bromide or cyber green. .
(If you use a PCR device that can monitor the amount of PCR products using fluorescence detection such as Cyber Green, use the melting curve analysis after the PCR reaction to detect the target amplification product based on the melting temperature of the PCR product. can do.)

  When the target band is detected by agarose electrophoresis after the completion of the PCR reaction of the present invention, or when the melting temperature peak of the PCR amplification product DNA is detected in the melting curve analysis, the animal to which the primer pair is targeted It can be seen that the cytochrome b gene of the species was present in the test food, that is, which animal species-derived raw material was present.

  In the present invention, the primer sequences are specified and shown, but the present invention is not intended to be limited to the examples. A sequence that includes the primer sequence and can hybridize with the target DNA by changing the hybridization conditions (that is, can specifically detect a specific animal species) is also included in the scope of the present invention. Needless to say.

  Next, the present invention will be described in more detail with reference to examples. However, the present invention is not limited to the following examples.

<Example 1>
In Example 1, a primer set (hereinafter referred to as primer set A) for discriminating the types of cattle, pigs, and birds was prepared, and the specificity was examined.

Preparation of primers Based on the nucleotide sequences of SEQ ID NOs: 1 to 6, free nucleotides were bound by the Fmoc solid phase method, and then purified by an OPC column to prepare six types of primers. The synthesized primer was stored at −80 ° C. until immediately before use, and was used immediately after thawing, and freeze-thawing was not repeated three times or more.

Preparation of primer set The above 6 types of primers were dissolved in distilled water before use, and a primer set was prepared by mixing with a reaction solution containing a test DNA solution so that the final concentration of each was 0.25 μM. .

[How to use primer set A when only one kind of DNA is present]
A kit for purifying total DNA from animal tissues from commercially available meat from bovine, porcine, avian, equine, and sheep DNA, and from a tail fragment obtained by cleaving each DNA from rat, mouse, and mouse. It refine | purified using DNeasy Blood & Tissue kit (made by QIAGEN). Goat, rabbit, dog, and cat DNA were purified from each hair using QIAamp DNA Micro kit (QIAGEN), which is a kit for purifying genomic and mitochondrial DNA from a small amount of sample. Guinea pig DNA and human DNA used as controls were purified from body hair and head hair using QIAamp DNA Micro kit (manufactured by QIAGEN).

The concentrations of the 14 kinds of DNAs of the purified animals are measured, sterilized water is added, and diluted to a test DNA solution (1 ng / μl). Sterile water and PCR enzyme buffer mixture and primers were added to 1 μl of each test DNA solution according to the protocol of QIAGEN Fast Cycling PCR Kit (manufactured by QIAGEN), and the total volume was adjusted to 20 μl to carry out PCR reaction.
Regarding the use of the primer, as described above, the primer set A was added to the reaction solution containing each of the 14 kinds of test DNA solutions of animals. That is, it is adjusted to a PCR reaction solution in which one kind of primer set coexists for one kind of animal DNA.

  As conditions for the PCR reaction, the tube containing the reaction solution was held at 95 ° C. for 5 minutes, then the heat denaturation reaction was performed at 96 ° C. for 5 seconds, the annealing reaction was performed at 60 ° C. for 5 seconds, and the DNA extension reaction was performed at 68 ° C. The above reaction was repeated 45 cycles, and finally a DNA extension reaction was performed at 72 ° C. for 1 minute.

  After completion of the PCR reaction, the obtained PCR product was subjected to electrophoresis at 100 V for 45 minutes using 4.0% agarose gel (manufactured by Invitrogen) with Mupid-2 (manufactured by Advanced), and ethidium bromide (1.0 μg / ml) After staining for 5 minutes, the band was photographed under a UV lamp (FIG. 1 (a)).

  From FIG. 1 (a), primers for cattle, pigs and birds included in primer set A are cytochromes only for the target animal species, even in the presence of primers corresponding to other animal species included in the same set. It was found that b was specifically amplified. In addition, the PCR products derived from the three types of animals contained in one primer set are all located in different locations by separation by agarose electrophoresis, and it is easy to confirm which animal species derived DNA was amplified. It became clear that we could do it.

[How to use primer set A when DNA from multiple animals coexists]
Cattle, swine, and chicken DNAs are mixed into 8: 1: 1 or 1: 8: 1, or 1: 1: 8 weight ratio after each commercial meat is subdivided, Purification was performed using DNeasy Blood & Tissue kit (QIAGEN), which is a kit for purifying total DNA from commercially available animal tissues.

Measure the concentration of the purified bovine, porcine and avian mixed DNA, add sterilized water, and dilute to a test DNA solution (1 ng / μl). To 1 μl of each test DNA solution, sterilized water and a PCR enzyme buffer mixed solution and primers were added according to the protocol of QIAGEN Fast Cycling PCR Kit (manufactured by QIAGEN), and the total solution volume was adjusted to 20 μl to carry out PCR reaction.
As for the primers, as described above, six kinds of primers contained in the primer set A were added to the reaction solution so that the final concentration was 0.25 μM with respect to the reaction solution containing the test DNA solution. That is, it is adjusted to a PCR reaction solution in which one kind of primer set coexists for three kinds of animal DNA.

  As conditions for the PCR reaction, the tube containing the reaction solution was held at 95 ° C. for 5 minutes, then the heat denaturation reaction was performed at 96 ° C. for 5 seconds, the annealing reaction was performed at 60 ° C. for 5 seconds, and the DNA extension reaction was performed at 68 ° C. The above reaction was repeated 45 cycles, and finally a DNA extension reaction was performed at 72 ° C. for 1 minute.

  After completion of the PCR reaction, the obtained PCR product was subjected to electrophoresis at 100 V for 45 minutes using 4.0% agarose gel (manufactured by Invitrogen) with Mupid-2 (manufactured by Advanced), and ethidium bromide (1.0 μg / ml) After staining for 5 minutes, the band was photographed under a UV lamp (FIG. 2).

As shown in FIG. 2, even when a PCR reaction is performed based on a template in which three types of DNA are mixed using primer set A, a PCR reaction corresponding to each of three types of animals can be performed satisfactorily. This was confirmed from the three bands that appeared by electrophoresis.
In addition, even when the amount of DNA of the target animal species is a very small proportion in the total amount of added DNA, the PCR reaction is performed normally, and the corresponding amount of DNA is roughly correlated with the proportion of added template DNA. It became clear that the density of the band was changing.
That is, it was confirmed that the primer set A is useful as a detectable primer set even if the animal species-derived foreign matter contains DNA derived from a plurality of animal species.

<Example 2>
In Example 2, a primer set (hereinafter referred to as primer set B) for discriminating types of horses, sheep, and goats was prepared, and the specificity was examined.

Preparation of primers Based on the nucleotide sequences of SEQ ID NOs: 7 to 12, free nucleotides were bound by the Fmoc solid phase method and then purified by an OPC column to prepare six types of primers. The synthesized primer was stored at −80 ° C. until immediately before use, and was used immediately after thawing, and freeze-thawing was not repeated three times or more.

Preparation of primer set The above 6 types of primers were dissolved in distilled water before use, and a primer set was prepared by mixing with a reaction solution containing a test DNA solution so that the final concentration of each was 0.25 μM. .

[How to use primer set B when only one kind of DNA is present]
A kit for purifying total DNA from animal tissues from commercially available meat from bovine, porcine, avian, equine, and sheep DNA, and from a tail fragment obtained by cleaving each DNA from rat, mouse, and mouse. It refine | purified using DNeasy Blood & Tissue kit (made by QIAGEN). Goat, rabbit, dog, and cat DNA were purified from each hair using QIAamp DNA Micro kit (QIAGEN), which is a kit for purifying genomic and mitochondrial DNA from a small amount of sample. Guinea pig DNA and human DNA used as controls were purified from body hair and head hair using QIAamp DNA Micro kit (manufactured by QIAGEN).

The concentrations of the 14 kinds of DNAs of the purified animals are measured, sterilized water is added, and diluted to a test DNA solution (1 ng / μl). To 1 μl of each test DNA solution, sterilized water and a PCR enzyme buffer mixed solution and primers were added according to the protocol of QIAGEN Fast Cycling PCR Kit (manufactured by QIAGEN), and the total solution volume was adjusted to 20 μl to carry out PCR reaction.
Regarding the use of the primer, as described above, the primer set B was added to the reaction solution containing each of the 14 kinds of test DNA solutions of animals. That is, it is adjusted to a PCR reaction solution in which one kind of primer set coexists for one kind of animal DNA.

  As conditions for the PCR reaction, the tube containing the reaction solution was held at 95 ° C. for 5 minutes, then the heat denaturation reaction was performed at 96 ° C. for 5 seconds, the annealing reaction was performed at 60 ° C. for 5 seconds, and the DNA extension reaction was performed at 68 ° C. The above reaction was repeated 45 cycles, and finally a DNA extension reaction was performed at 72 ° C. for 1 minute.

  After completion of the PCR reaction, the obtained PCR product was subjected to electrophoresis at 100 V for 45 minutes using 4.0% agarose gel (manufactured by Invitrogen) with Mupid-2 (manufactured by Advanced), and ethidium bromide (1.0 μg / ml) After staining for 5 minutes, the band was photographed under a UV lamp (FIG. 1 (b)).

  From FIG. 1 (b), the primers for horses, sheep and goats included in primer set B are cytochromes only for the target animal species, even in the presence of primers corresponding to other animal species included in the same set. It was found that b was specifically amplified. In addition, the PCR products derived from the three kinds of animals contained in one primer set are all located at different locations by separation by agarose electrophoresis, and it is easy to confirm which animal species-derived DNA was amplified. It became clear that we could do it.

<Example 3>
In Example 3, a primer set (hereinafter referred to as primer set C) for discriminating the types of rabbits, dogs, and cats was prepared, and the specificity was examined.

Preparation of primers Based on the nucleotide sequences of SEQ ID NOs: 13 to 18 and 25, free nucleotides were bound by the Fmoc solid phase method and then purified by an OPC column to prepare seven types of primers. The synthesized primer was stored at −80 ° C. until immediately before use, and was used immediately after thawing, and freeze-thawing was not repeated three times or more.

Preparation of Primer Set The above seven types of primers were dissolved in distilled water before use, and the final concentration of each of the reaction solutions containing the test DNA solution was 0.25 μM (only SEQ ID NO: 18 and 25, the final concentration was A primer set mixed so as to be 0.125 μM) was obtained.

[How to use primer set C when only one kind of DNA is present]
A kit for purifying total DNA from animal tissues from commercially available meat from bovine, porcine, avian, equine, and sheep DNA, and from a tail fragment obtained by cleaving each DNA from rat, mouse, and mouse. It refine | purified using DNeasy Blood & Tissue kit (made by QIAGEN). Goat, rabbit, dog, and cat DNA were purified from each hair using QIAamp DNA Micro kit (QIAGEN), which is a kit for purifying genomic and mitochondrial DNA from a small amount of sample. Guinea pig DNA and human DNA used as controls were purified from body hair and head hair using QIAamp DNA Micro kit (manufactured by QIAGEN).

The concentrations of the 14 kinds of DNAs of the purified animals are measured, sterilized water is added, and diluted to a test DNA solution (1 ng / μl). To 1 μl of each test DNA solution, sterilized water and a PCR enzyme buffer mixed solution and primers were added according to the protocol of QIAGEN Fast Cycling PCR Kit (manufactured by QIAGEN), and the total solution volume was adjusted to 20 μl to carry out PCR reaction.
Regarding the use of the primer, as described above, the primer set C was added to the reaction solution containing each of the 14 kinds of test DNA solutions of animals. That is, it is adjusted to a PCR reaction solution in which one kind of primer set coexists for one kind of animal DNA.

  As conditions for the PCR reaction, the tube containing the reaction solution was held at 95 ° C. for 5 minutes, then the heat denaturation reaction was performed at 96 ° C. for 5 seconds, the annealing reaction was performed at 60 ° C. for 5 seconds, and the DNA extension reaction was performed at 68 ° C. The above reaction was repeated 45 cycles, and finally a DNA extension reaction was performed at 72 ° C. for 1 minute.

  After completion of the PCR reaction, the obtained PCR product was subjected to electrophoresis at 100 V for 45 minutes using Mupid-2 (manufactured by Invitrogen) using 4.0% agarose gel (manufactured by Invitrogen), and ethidium bromide (1.0 μg / ml) After staining for 5 minutes, the band was photographed under a UV lamp (FIG. 1 (c)).

  From FIG. 1 (c), the primers for rabbits, dogs, and cats included in primer set C are cytochromes of only the target animal species even in the presence of primers corresponding to other animal species included in the same set. It was found that b was specifically amplified. In addition, the PCR products derived from the three types of animals contained in one primer set are all located in different locations by separation by agarose electrophoresis, and it is easy to confirm which animal species derived DNA was amplified. It became clear that we could do it.

<Example 4>
In Example 4, a primer set (hereinafter referred to as primer set D) for discriminating the types of rats, rats, and mice was prepared, and its specificity was examined.

Preparation of primers Based on the nucleotide sequences of SEQ ID NOs: 19 to 24, free nucleotides can be bound by the Fmoc solid phase method and then purified by an OPC column, so that species-specific amplification can be performed in rats, rats, and mice. Primers were made. The synthesized primer was stored at −80 ° C. until immediately before use, and was used immediately after thawing, and freeze-thawing was not repeated three times or more.

Preparation of primer set The above 6 types of primers were dissolved in distilled water before use, and a primer set was prepared by mixing with a reaction solution containing a test DNA solution so that the final concentration of each was 0.25 μM. .

[How to use primer set D when only one kind of DNA is present]
A kit for purifying total DNA from animal tissues from commercially available meat from bovine, porcine, avian, equine, and sheep DNA, and from a tail fragment obtained by cleaving each DNA from rat, mouse, and mouse. It refine | purified using DNeasy Blood & Tissue kit (made by QIAGEN). Goat, rabbit, dog, and cat DNA were purified from each hair using QIAamp DNA Micro kit (QIAGEN), which is a kit for purifying genomic and mitochondrial DNA from a small amount of sample. Guinea pig DNA and human DNA used as controls were purified from body hair and head hair using QIAamp DNA Micro kit (manufactured by QIAGEN).

The concentrations of the 14 kinds of DNAs of the purified animals are measured, sterilized water is added, and diluted to a test DNA solution (1 ng / μl). To 1 μl of each test DNA solution, sterilized water and a PCR enzyme buffer mixed solution and primers were added according to the protocol of QIAGEN Fast Cycling PCR Kit (manufactured by QIAGEN), and the total solution volume was adjusted to 20 μl to carry out PCR reaction.
As for the primer, as described above, the primer set D was added to the reaction solution containing each of 14 kinds of test DNA solutions of animals. That is, it is adjusted to a PCR reaction solution in which one kind of primer set coexists for one kind of animal DNA.

  As conditions for the PCR reaction, the tube containing the reaction solution was held at 95 ° C. for 5 minutes, then the heat denaturation reaction was performed at 96 ° C. for 5 seconds, the annealing reaction was performed at 60 ° C. for 5 seconds, and the DNA extension reaction was performed at 68 ° C. The above reaction was repeated 45 cycles, and finally a DNA extension reaction was performed at 72 ° C. for 1 minute.

  After completion of the PCR reaction, the obtained PCR product was subjected to electrophoresis at 100 V for 45 minutes using 4.0% agarose gel (manufactured by Invitrogen) with Mupid-2 (manufactured by Advanced), and ethidium bromide (1.0 μg / ml) After 5 minutes of staining, followed by destaining for 10 minutes, a band was photographed under a UV lamp (FIG. 1 (d)).

  From FIG. 1 (d), primers for rat, rat and mouse contained in the primer set D are cytochromes of only the target animal species even in the presence of primers corresponding to other animal species contained in the same set. It was found that b was specifically amplified. In addition, the PCR products derived from the three types of animals contained in one primer set are all located in different locations by separation by agarose electrophoresis, and it is easy to confirm which animal species derived DNA was amplified. It became clear that we could do it.

<Example 5>
In Example 5, the specificity in the PCR reaction using the primer kit E consisting of the primer sets A, B, C, and D under the same conditions was examined.

Preparation of primers Based on the nucleotide sequences of SEQ ID NOs: 1 to 25, free nucleotides were bound by the Fmoc solid phase method and then purified by an OPC column to prepare 25 types of primers. The synthesized primer was stored at −80 ° C. until immediately before use, and was used immediately after thawing, and freeze-thawing was not repeated three times or more.

Preparation of primer sets The primer sets A, B, C, and D were prepared by dissolving 6 types of primers (7 types only for primer set C) in distilled water before use, and containing a test DNA solution. On the other hand, each primer set was prepared such that the final concentration was 0.25 μM (SEQ ID NOS: 18 and 25 only, final concentration was 0.125 μM).

[How to use primer kit E consisting of primer sets A to D]
A kit for purifying total DNA from animal tissues from commercially available meat from bovine, porcine, avian, equine, and sheep DNA, and from a tail fragment obtained by cleaving each DNA from rat, mouse, and mouse. It refine | purified using DNeasy Blood & Tissue kit (made by QIAGEN). Goat, rabbit, dog, and cat DNA were purified from each hair using QIAamp DNA Micro kit (QIAGEN), which is a kit for purifying genomic and mitochondrial DNA from a small amount of sample. Guinea pig DNA and human DNA used as controls were purified from body hair and head hair using QIAamp DNA Micro kit (manufactured by QIAGEN).

The concentrations of the 14 kinds of DNAs of the purified animals are measured, sterilized water is added, and diluted to a test DNA solution (1 ng / μl). To 1 μl of each test DNA solution, sterilized water and a PCR enzyme buffer mixed solution and primers were added according to the protocol of QIAGEN Fast Cycling PCR Kit (manufactured by QIAGEN), and the total solution volume was adjusted to 20 μl to carry out PCR reaction.
About the use of a primer, primer set A, B, C, and D was added with respect to the reaction liquid which respectively contains the test DNA solution of 14 types of animals. That is, it is adjusted to a PCR reaction solution in which one kind of primer set is present for one kind of animal DNA.

  As conditions for the PCR reaction, the tube containing the reaction solution was held at 95 ° C. for 5 minutes, then the heat denaturation reaction was performed at 96 ° C. for 5 seconds, the annealing reaction was performed at 60 ° C. for 5 seconds, and the DNA extension reaction was performed at 68 ° C. The above reaction was repeated 45 cycles, and finally a DNA extension reaction was performed at 72 ° C. for 1 minute.

  After completion of the PCR reaction, the obtained PCR product was subjected to electrophoresis at 100 V for 45 minutes using 4.0% agarose gel (manufactured by Invitrogen) with Mupid-2 (manufactured by Advanced), and ethidium bromide (1.0 μg / ml) After staining for 5 minutes, the band was photographed under a UV lamp.

  As a result, the primer pairs included in the primer sets A, B, C, and D in the primer kit E are targeted against the 12 animal species targeted by the primer kit E under the same PCR reaction conditions. It was found to specifically amplify cytochrome b of the animal species. Therefore, it has been shown that a single PCR machine can detect a plurality of animal species at a time.

It is an electrophoresis photograph which shows the result after performing PCR reaction which used the DNA set derived from each animal as a template using the primer set which has an animal specific arrangement | sequence. It is an electrophoresis photograph which shows the result of DNA detection by primer set A when bovine, porcine and avian DNA are mixed in the same tube.

Claims (5)

A primer set for detecting an animal-specific gene sequence derived from a cytochrome b gene sequence of mitochondrial DNA,
It consists of the following primer pairs SEQ ID NO: 1 and 2 specific for cattle, the following primer pairs SEQ ID NO: 3 and 4 specific for pigs, and the following primer pairs SEQ ID NO: 5 and 6 specific for birds Primer set for animal species identification.
SEQ ID NO: 1
CCATACCATCGGCAACAATT
SEQ ID NO: 2
AATATAGTAGTGGAACTATGGCAATT
SEQ ID NO: 3
CTCCATCCTAATCCTAATTTTTAATG
SEQ ID NO: 4
CGATGATGCTAGTGATTGGTATC
SEQ ID NO: 5
CCAAAAATAAACTAATGCGCACC
SEQ ID NO: 6
CGGTGAGGATTTGGGTC A primer set for detecting an animal-specific gene sequence derived from a cytochrome b gene sequence of mitochondrial DNA,
It consists of the following primer pairs SEQ ID NO: 7 and 8 specific for horses, the following primer pairs SEQ ID NO: 9 and 10 specific for sheep, and the following primer pairs SEQ ID NO: 11 and 12 specific for goats Primer set for animal species identification.
SEQ ID NO: 7
GAGGAGCAACAGCATCATCATG
SEQ ID NO: 8
CGTGAAGAAATATAGTAAATGTACGAACTATC
SEQ ID NO: 9
GGAGTAATCCCTCCATTTGCG
SEQ ID NO: 10
GCGATGATGAATGGGAAA
SEQ ID NO: 11
ATGACCAACATCCGAAAG
SEQ ID NO: 12
GTATTGCTAGGAATAGGCCTGTC A primer set for detecting an animal-specific gene sequence derived from a cytochrome b gene sequence of mitochondrial DNA,
SEQ ID NO: 13 and 14 primer pairs specific to rabbits, SEQ ID NO: 15 and 16 primer pairs specific to dogs, SEQ ID NOs: 17 and 18 primer pairs specific to cats, and cats A primer set for distinguishing animal species comprising the following primer pairs of SEQ ID NOs: 17 and 25 specific for.
SEQ ID NO: 13
CATTTATCATGCCAACTTTAGTCTTAA
SEQ ID NO: 14
AATAAGGAGGGAGAAGAATGGC
SEQ ID NO: 15
GGCTGAATTATTCCGCTATATG
SEQ ID NO: 16
AATTCCAATGTTTCATGTTTCTATGAATAC
SEQ ID NO: 17
ACCCTCAAAACAAGGAGA
SEQ ID NO: 18
AGACTCTTCATTTGAGTAGACG
SEQ ID NO: 25
AGACTCTTCATTGAGTAGGGCG A primer set for detecting an animal-specific gene sequence derived from a cytochrome b gene sequence of mitochondrial DNA,
SEQ ID NOs: 19 and 20 below specific for a rat, primer pairs below SEQ ID NO: 21 and 22 specific for a mouse, and primers below SEQ ID NO 23 and 24 specific for a mouse Primer set for animal species identification.
SEQ ID NO: 19
AGCCTTCCTACCATTCTCTG
SEQ ID NO: 20
TTTCATTTTAACATTTTTGCTCCAAC
SEQ ID NO: 21
GCTCTCTTCTAGGAGGTATGCCCTTAG
SEQ ID NO: 22
GAGTAACTGATGGAGATGCTGTTAAA
SEQ ID NO: 23
TCAAGATATCTCTAGGTATCCTAATCA
SEQ ID NO: 24
GGTGTTTAGTGGATTAGCTGGTA   The at least one first primer pair included in the primer set according to claim 1, the at least one second primer pair included in the primer set according to claim 2, and the 5. At least 2 selected from the group of primer pairs consisting of at least one third primer pair included in the primer set and at least one fourth primer pair included in the primer set according to claim 4 A primer kit for distinguishing animal species composed of two or more primer pairs.

Images