CN110305972A - The primer and probe and kit of the synchronous detection of chicken, duck and goose source property in meat products - Google Patents
The primer and probe and kit of the synchronous detection of chicken, duck and goose source property in meat products Download PDFInfo
- Publication number
- CN110305972A CN110305972A CN201910709570.0A CN201910709570A CN110305972A CN 110305972 A CN110305972 A CN 110305972A CN 201910709570 A CN201910709570 A CN 201910709570A CN 110305972 A CN110305972 A CN 110305972A
- Authority
- CN
- China
- Prior art keywords
- source property
- seq
- probe
- duck
- chicken
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer and probe of the synchronous detection of chicken, duck and goose source property in meat products and kit, primer and probe sequence are as follows: three source property detect forward primer sequence as shown in SEQ ID No.1；Chicken source property detects reverse primer sequences as shown in SEQ ID No.2；Duck source property detects reverse primer sequences as shown in SEQ ID No.3；The reverse sequence of goose source property is as shown in SEQ ID No.4；Primer chicken probe sequence is as shown in SEQ ID No.5；Duck probe sequence is as shown in SEQ ID No.6；Goose probe sequence is as shown in SEQ ID No.7.The specific good, high sensitivity of primer, probe and kit of the invention, may be implemented chicken source property in meat products, duck source property and goose source property and detects with pipe, and can carry out the quantitative detection of chicken source property, the duck source source Xing Hee property.
Description
Technical field
The invention belongs to animal derived detection fields in technical field of food detection more particularly to meat products.
Background technique
For meat products other than conventional nutrients rich in, the sensory experience of excellent in color is more to confer to it
The kernel of global cuisines.However, being generated along with the cost variance between growing output and consumption figure and meat
Profit temptation, meat products becomes fakes adulterated main target in food production, processing, circulation and catering field.One
A little illegal enterprises and retailer pretend to be high price meat with low price meat, and it is low that chicken, duck and goose etc. are adulterated in the high prices meat products such as sheep, ox, deer
Valence meat.
China starts to walk evening for the research in terms of meat products true and false authentication technique, and the research in this field is also in first step
Section.It can be seen that currently the research field in terms of meat products true and false authentication technique, realization have the autonomous property right in China, peace
Complete efficient detection technique is the research topic full of opportunity great challenge simultaneously.As sheep, ox, horse, hunchbacked product base
Xilinguole League there is an urgent need to research and develop chicken, duck and goose correlation meat products true and false authentication technique and inspection with independent intellectual property rights
Mark is quasi-, thereby protects local characteristic mutton product and safeguards the legitimate rights and interests of consumer.Currently, the meat products true and false identifies correlation
Technical research, examination criteria, patent of invention and commercial reagents box be concentrated mainly on single channel single source detection and it is different
Pipe detection, while multichannel polyphyly is detected and is reported with pipe detection less.The detection of multichannel siphunculus not only can save the time,
Cost can be reduced simultaneously.
Summary of the invention
The technical problems to be solved by the invention are as follows: how to provide one kind efficiently and Ji Yuan in the meat products of high specificity
Property, duck source property and goose source the property primer, probe and the kit that detect with pipe and method, solve chicken, duck and goose source in meat products
Property ingredient is qualitative and quantitative detection problem.
The technical solution of the present invention is as follows: chicken source property, duck source property and goose source property are detected with pipe in meat products primer and spy
Needle, primer and probe sequence are as follows:
Three source property detect forward primer: 5'CAAAAGGCTTAAGCCCTTT 3'(SEQ ID No.1),
Chicken source property detects reverse primer: 5'CACGGCGATTAGGATGG 3'(SEQ ID No.2),
Duck source property detects reverse primer: 5'ACGGCAATTAAGATTGGGA 3'(SEQ ID No.3),
Goose source property detects reverse primer: 5'TACGGCAATCAGGATTGG 3'(SEQ ID No.4),
Chicken probe: 5'ACCCCGGACATGACCCTGC 3'(SEQ ID No.5),
Duck probe: 5'TAGCTACACATGCCACAAACAACAATAG 3'(SEQ ID No.6),
Goose probe: 5'CTTC (A/T) CCCATGATTCAAATAACAACAC 3'(SEQ ID No.7).
Further, the 5' of chicken probe, duck probe and goose probe sequence is terminal modified reporter group, and 3' is terminal modified to be quenched
Group, any one in reporter group FAM, HEX, ROX or CY5, in quenching group TAMRA, BHQ1, BHQ2 or MGB
Any one.
As another object of the present invention, provide what chicken source property, duck source property and goose in a kind of meat products detected with pipe
Kit contains in the kit:
Three source property shown in SEQ ID No.1 detect forward primer,
Chicken source property shown in SEQ ID No.2 detects reverse primer,
Duck source property shown in SEQ ID No.3 detects reverse primer,
Goose source property shown in SEQ ID No.4 detects reverse primer,
Chicken probe shown in SEQ ID No.5,
Duck probe shown in SEQ ID No.6,
Goose probe shown in SEQ ID No.7,
Probe qPCR premixed liquid,
Chicken positive criteria product,
Duck positive criteria product,
Goose positive criteria product.
It is of course also possible to by detection chicken source property and duck source property, in order to save cost, it is only necessary to it is related to remove goose source property
Reagent can (goose source property shown in SEQ ID No.4 detects reverse primer, goose probe shown in SEQ ID No.7 and goose sun
Property standard items) therefore, as another object of the present invention, additionally provide the reagent of chicken and the detection of duck source property in a kind of meat products
Box contains in the kit:
Three source property shown in SEQ ID No.1 detect forward primer,
Chicken source property shown in SEQ ID No.2 detects reverse primer,
Duck source property shown in SEQ ID No.3 detects reverse primer,
Chicken probe shown in SEQ ID No.5,
Duck probe shown in SEQ ID No.6,
Probe qPCR premixed liquid,
Chicken positive criteria product,
Duck positive criteria product.
It is of course also possible to by detection chicken source property and goose source property, in order to save cost, it is only necessary to it is related to remove duck source property
Reagent can (duck source property shown in SEQ ID No.3 detects reverse primer, duck probe shown in SEQ ID No.6 and duck sun
Property standard items) therefore, as another object of the present invention, additionally provide the reagent of chicken and the detection of goose source property in a kind of meat products
Box contains in the kit:
Three source property shown in SEQ ID No.1 detect forward primer,
Chicken source property shown in SEQ ID No.2 detects reverse primer,
Goose source property shown in SEQ ID No.4 detects reverse primer,
Chicken probe shown in SEQ ID No.5,
Goose probe shown in SEQ ID No.7,
Probe qPCR premixed liquid,
Chicken positive criteria product,
Goose positive criteria product.
It is of course also possible to by detection duck source property and goose source property, in order to save cost, it is only necessary to it is related to remove chicken source property
Reagent can (chicken source property shown in SEQ ID No.2 detects reverse primer, chicken probe shown in SEQ ID No.5 and chicken sun
Property standard items) therefore, as another object of the present invention, additionally provide a kind of reagent of property detection in duck and goose source in meat products
Box contains in the kit:
Three source property shown in SEQ ID No.1 detect forward primer,
Duck source property shown in SEQ ID No.3 detects reverse primer,
Goose source property shown in SEQ ID No.4 detects reverse primer,
Duck probe shown in SEQ ID No.6,
Goose probe shown in SEQ ID No.7,
Probe qPCR premixed liquid,
Duck positive criteria product,
Goose positive criteria product.
The method that chicken source property, duck source property and goose source property are detected with pipe in meat products, steps are as follows:
(1) DNA of meat products is extracted；
(2) concentration and quality of DNA are detected, and by concentration dilution to 100-200ng/ μ L；
(3) multiple fluorescence quantitative is carried out to dilution DNA using the primer and probe of SEQ ID No.1~SEQ ID No.7
PCR amplification does positive control using chicken, duck and goose positive criteria product, does negative control using the deionized water of sterilizing, utilizes
The control group of extracting method is done in the blank control that DNA is extracted；
(4) after reaction, setting Threshold is automatic, reading chicken, duck and goose correspondent probe to Real-time PCR
Ct value and positive control, negative control and blank control Ct；Only when positive control Ct≤40, negative control and blank
Control Ct can just carry out the judgement of correspondent probe source property result when being 0；When Ct≤40 of correspondent probe, result judgement be with
Respective sources, while having Ct≤40 of multiple probes, result judgement is with corresponding three source property；
(5) the quantitative standard curve of DNA is done using chicken, duck and goose positive criteria product；
(6) phase in the available meat products of formula in the Ct value and standard curve of the respective sources of detection meat products is utilized
Answer the quantitative detection result of source property.
Further, Real-time PCR amplification parameter are as follows: 94 DEG C of denaturation temperature, 30s, 94 DEG C of denaturation temperature, 5s,
60 DEG C of elongating temperature, 34s of annealing, 40 circulations.
Further, Real-time PCR reaction system are as follows: shown in 10 μ L of Probe qPCR premixed liquid, SEQ ID No.1
Three source property detect 1 μ L of forward primer, concentration be 10 μM；Chicken source property shown in SEQ ID No.2 detects 0.33 μ L of reverse primer,
Concentration is 10 μM；Duck source property shown in SEQ ID No.3 detects 0.33 μ L of reverse primer, and concentration is 10 μM；SEQ ID No.4 institute
The goose source property detection 0.34 μ L of reverse primer shown, concentration is 10 μM；0.5 μ L of chicken probe, concentration 10 shown in SEQ ID No.5
μM；, 0.5 μ L of duck probe shown in SEQ ID No.6, concentration is 0.5 μ L of goose probe shown in 10 μM and SEQ ID No.7, dense
Degree is 10 μM；2 μ L of DNA profiling, the 4.5 μ L of deionized water of sterilizing, 20 μ L of total volume.
The present invention is by comparing chicken, duck, goose, quail, pigeon, ox, buffalo, yak, sheep, goat, pig, horse, donkey, white horse with a black mane
The mitochondrial genomes of 15 kinds of animals such as camel and rabbit, every kind of animal choose the mitochondrial genomes sequence of 5 kinds or strain.
Above-mentioned 75 sequences are compared by bioinformatics software, filter out that chicken, duck and goose be conservative and special sequence, utilize design of primers
The design of software progress primer and probe.The novelty of design is to need to filter out both ends guarantor in the sequence of 100-150bp
It keeps and intermediate special sequence, the conservative Position Design primer in both ends, intermediate special Position Design probe.Conservative primer and
Special probe can effectively reduce the competition of mispairing and multiple PCR reaction to reaction resource between primer, Ke Yibao
Demonstrate,prove the progress of multiple real time fluorescence quantifying PCR reaction.Multiple real time fluorescence quantifying PCR reaction is the base of polyphyly composition detection
Plinth.The annealing temperature of primer and probe is controlled in 55-60 DEG C and 65-70 DEG C, and the secondary structure without influencing annealing efficiency,
And to guarantee primer and probe on chondriogen with the specificity of height, above-mentioned design guarantees that primer and probe can be with
For subsequent qualitative and quantitative detection.
The present invention has developed the 3 Air conduct measurement primer and probe such as chicken, duck and goose, the detection of optimization multichannel polyphyly and same pipe
The primer and probe of detection combines.The shadow in same PCR reaction system between a variety of primer and probes is overcome in the process
Ring and to template and PCR reaction resource competition the problem of, reach PCR reaction system can carry out simultaneously it is multiple in real time it is glimmering
The effect of light PCR.
Chicken source property probe can detecte the chicken source property DNA of 0.25pg in sample, and duck source property probe can detecte sample
The duck source property DNA of middle 2.5pg, goose source property probe can detecte the goose source property DNA of 1pg in sample.Illustrate chicken of the invention, duck
Reach pg level with the detection limit of goose primer and probe, the sensitivity of detection is higher.
Chicken probe and duck probe may detect that 0.1% horizontal mixing sample.Illustrate mixed probe (chicken, duck and goose)
With chicken source property, duck source property and goose source property with pipe detectability.
Compared with prior art, the invention has the following advantages:
Primer of the invention, the high specificity of probe and kit, high sensitivity, may be implemented chicken in meat products, duck and
The qualitative and quantitative detection of goose source property, and detection while chicken, duck and goose can be carried out, process is saved, is reduced costs.
Detailed description of the invention
Fig. 1 utilizes FAM and TAMRA modification probe label chicken source property, HEX and TAMRA modification probe label duck source property and ROX
With MGB modification probe label goose source property control to chicken, quail, pigeon, ox, buffalo, yak, sheep, goat, pig, horse, donkey,
The detection for the real-time fluorescence quantitative PCR that 13 kinds of animal muscle tissues such as camel and rabbit (other meat) carry out is expanded in chicken
Increase curve, amplification curve all do not occur in other meat, illustrate that chicken source property primer and probe has specificity.
Fig. 2 utilizes FAM and TAMRA modification probe label chicken source property, HEX and TAMRA modification probe label goose source property and ROX
With MGB modification probe label goose source property to duck, quail, pigeon, ox, buffalo, yak, sheep, goat, pig, horse, donkey, camel
And the detection of real-time fluorescence quantitative PCR that 13 kinds of animal muscle tissues such as rabbit (other meat) carry out, it is bent to occur amplification in duck
All there is not amplification curve in line, other meat, illustrate that duck source property primer and probe has specificity.
Fig. 3 utilizes FAM and TAMRA modification probe label chicken source property, HEX and TAMRA modification probe label goose source property and ROX
With MGB modification probe label goose source property to goose, quail, pigeon, ox, buffalo, yak, sheep, goat, pig, horse, donkey, camel
And the detection of real-time fluorescence quantitative PCR that 13 kinds of animal muscle tissues such as rabbit (other meat) carry out, it is bent to occur amplification in goose
All there is not amplification curve in line, other meat, illustrate that goose source property primer and probe has specificity.
Fig. 4 using FAM and TAMRA modification probe label chicken source property to chicken DNA (100ng, 10ng, 1ng, 0.1ng,
0.01ng, 0.001ng, 0.0005ng, 0.00025ng, 0.0001ng and 0.00001ng) detection sensitivity amplification experiment is carried out,
Chicken source property probe can detecte the chicken source property DNA of 0.25pg.These results suggest that chicken probe is in the source property detection side of meat products
Face sensitivity with higher.
Fig. 5 using HEX and TAMRA modification probe label duck source property to duck DNA (100ng, 10ng, 1ng, 0.1ng,
0.01ng, 0.005ng, 0.0025ng, 0.001ng, 0.0001ng and 0.00001ng) carry out detection sensitivity amplification experiment, duck
Property probe in source can detecte the duck source property DNA of 2.5pg.These results suggest that duck probe has in the source property context of detection of meat products
There is higher sensitivity.
Fig. 6 using ROX and MGB modification probe label goose source property to goose DNA (100ng, 10ng, 1ng, 0.1ng, 0.01ng,
0.001ng, 0.005ng, 0.0025ng, 0.0001ng and 0.00001ng) detection sensitivity amplification experiment is carried out, goose source property is visited
Needle can detecte the goose source property DNA of 1pg.These results suggest that goose probe is with higher in the source property context of detection of meat products
Sensitivity.
Fig. 7 chicken source property examination criteria curve: the quantitative detection for chicken source property in meat products.
Fig. 8 duck source property examination criteria curve: the quantitative detection for duck source property in meat products.
Fig. 9 goose source property examination criteria curve: the quantitative detection for goose source property in meat products.
Figure 10 using FAM and TAMRA modification probe label chicken source property, HEX and TAMRA modification probe label duck source property and
ROX and MGB modification probe label goose to chicken, duck and goose gradient mixing sample (0.1%, 1%, 10%, 30%, 40%, 80%,
98% and 99.8%) carry out chicken, duck and goose while detect, chicken probe, duck probe and goose probe can detect as the result is shown
To 0.1% horizontal mixing sample.These results suggest that mixed probe (chicken, duck and goose) has chicken source property, duck source property and goose
Source property is simultaneously the same as pipe detectability.
Figure 11 using FAM and TAMRA modification probe label chicken source property, HEX and TAMRA modification probe label duck source property and
ROX and MGB modification probe label goose source property to mixing sample (30% chicken, 30% duck and 40% goose) carry out chicken, duck and
It is detected while goose, amplification curve all occur in chicken source property (chicken-FAM), duck source property (duck-HEX) and goose source property (goose-ROX).More than
As a result illustrate that mixed probe (chicken, duck and goose) has chicken source property, duck source property and goose source property simultaneously with pipe detectability.
Specific embodiment
1, detection method:
(1) DNA for extracting meat products, sets up and extracts blank control (the subsequent control group for doing extracting method).
(2) concentration and quality of DNA are detected, and by concentration dilution to 100-200ng/ μ L.
(3) augmentation detection is carried out to dilution DNA using multiple fluorescence quantitative PCR primer and probe, utilizes chicken, duck and goose sun
Property standard items do positive control, do negative control using the deionized water of sterilizing, using DNA extract blank control do extraction side
The control group of method, Real-time PCR reaction system is as shown in table 1, and Real-time PCR amplification parameter is as shown in table 5.
1 Real-time PCR reaction system (being detected while chicken, duck and goose) of table
| Ingredient | Volume (microlitre) |
| Probe qPCR premixed liquid | 10 |
| Three source property detect forward primer | 1 |
| Chicken source property detects reverse primer | 0.33 |
| Duck source property detects reverse primer | 0.33 |
| Goose source property detects reverse primer | 0.34 |
| Chicken probe | 0.5 |
| Duck probe | 0.5 |
| Goose probe | 0.5 |
| DNA | 2 |
| The deionized water of sterilizing | 4.5 |
| Total volume | 20 |
2 Real-time PCR reaction system of table (chicken and duck detect simultaneously)
| Ingredient | Volume (microlitre) |
| Probe qPCR premixed liquid | 10 |
| Three source property detect forward primer | 1 |
| Chicken source property detects reverse primer | 0.5 |
| Duck source property detects reverse primer | 0.5 |
| Chicken probe | 0.5 |
| Duck probe | 0.5 |
| DNA | 2 |
| The deionized water of sterilizing | 5 |
| Total volume | 20 |
3 Real-time PCR reaction system of table (chicken and goose detect simultaneously)
| Ingredient | Volume (microlitre) |
| Probe qPCR premixed liquid | 10 |
| Three source property detect forward primer | 1 |
| Chicken source property detects reverse primer | 0.5 |
| Goose source property detects reverse primer | 0.5 |
| Chicken probe | 0.5 |
| Goose probe | 0.5 |
| DNA | 2 |
| The deionized water of sterilizing | 5 |
| Total volume | 20 |
4 Real-time PCR reaction system of table (duck and goose detects simultaneously)
5 Real-time PCR amplification parameter of table
(4) after reaction, setting Threshold is automatic, reading chicken, duck and goose correspondent probe to Real-time PCR
Ct value and positive control, negative control and blank control Ct；Only when positive control Ct≤40, negative control and blank
Control Ct can just carry out the judgement of correspondent probe source property result when being 0；When Ct≤40 of correspondent probe, result judgement be with
Respective sources, while having Ct≤40 of multiple probes, result judgement is with corresponding three source property.
(5) the chicken, (dilution 10 of duck and goose positive criteria product are utilized1To 107Times) do the quantitative standard curve of DNA.
(6) phase in the available meat products of formula in the Ct value and standard curve of the respective sources of detection meat products is utilized
Answer the quantitative detection result of source property.
2, the design of primer and probe sequence
Since the copy number of mitochondria in the tissue is high and relatively stable in meat products, so selection mitochondria base
Because of design chicken, duck and goose detection primer and probe.The synthetic method of primer and probe: commission Beijing biotech firm, farsighted Boxing section presses
Bright sequence is issued as before to be synthesized and purified.
Three source property detect forward primer: 5'CAAAAGGCTTAAGCCCTTT3'(SEQ ID No.1),
Chicken source property detects reverse primer: 5'CACGGCGATTAGGATGG3'(SEQ ID No.2),
Duck source property detects reverse primer: 5'ACGGCAATTAAGATTGGGA3'(SEQ ID No.3),
Goose source property detects reverse primer: 5'TACGGCAATCAGGATTGG 3'(SEQ ID No.4),
Chicken probe: 5'ACCCCGGACATGACCCTGC3'(SEQ ID No.5),
Duck probe: 5'TAGCTACACATGCCACAAACAACAATAG 3'(SEQ ID No.6),
Goose probe: 5'CTTC (A/T) CCCATGATTCAAATAACAACAC 3'(SEQ ID No.7)；
Chicken, duck and goose probe sequence 5' it is terminal modified have reporter group, 3' is terminal modified quenching group, wherein the report
Group is any one in FAM, HEX, ROX or CY5, and the quenching group is any one in TAMRA, BHQ1, BHQ2 or MGB
Kind.
3, the specific detection of primer and probe
The Real-time PCR reaction system of single source property detection is as shown in the table
| Ingredient | Volume (microlitre) |
| Probe qPCR premixed liquid | 10 |
| Three source property detect forward primer | 1 |
| Chicken or duck or goose source property detect reverse primer | 1 |
| Respective sources probe | 1 |
| DNA | 2 |
| The deionized water of sterilizing | 5 |
| Total volume | 20 |
Using FAM and TAMRA modification probe label chicken source property, HEX and TAMRA modification probe label duck source property and ROX and
MGB modify probe label goose source property to chicken, duck, goose, quail, pigeon, ox, buffalo, yak, sheep, goat, pig, horse, donkey,
Camel and rabbit carry out the detection of qPCR.
Testing result is as follows:
Ct value: average value (three groups of data) ± standard deviation；: do not detect signal
As a result illustrate: Ct illustrates there are respective sources in sample less than 40 (being not 0).Testing result meets sample animal
Source.Chicken source property is detected in chicken, duck source property is detected in duck, and goose source property is detected in goose, and in other meat
In do not detect chicken, duck and goose source property.
4, the detection limit experiment of the primer and probe of respective sources detection
The genomic DNA of chicken is diluted 10 respectively1To 107Times and 0.0005 and 0.00025 (totally 10 template concentrations ladders
Degree), the genomic DNA of duck is diluted 10 respectively1To 107Times and 0.005 and 0.0025 (totally 10 template concentrations gradients), will
The genomic DNA of goose dilutes 10 respectively1To 107Again and 0.0005 and 0.00025 (totally 10 template concentrations gradients) carries out primer
Experiment is expanded with the detection limit of probe.By following result it is found that chicken source property probe can detecte the chicken of 0.25pg in sample
Source property DNA, duck source property probe can detecte the duck source property DNA of 2.5pg in sample, and goose source property probe can detecte in sample
The goose source property DNA of 1pg.These results suggest that the detection limit of the chicken of independent research, duck and goose primer and probe reaches fg level,
The sensitivity of detection is higher.
Testing result is as follows:
Ct value: average value (three groups of data) ± standard deviation；N/A: it is not suitable for detecting；: do not detect signal
5, FAM and TAMRA modification probe label chicken source property, HEX and TAMRA modification probe label duck source property and ROX are utilized
With MGB modification probe label goose source property to chicken, duck and goose gradient mixing sample (0.1%, 1%, 10%, 30%,
40%, 80%, 98% and 99.8%) carry out chicken, duck and goose while detect.
Testing result is as follows:
Ct value: average value (three groups of data) ± standard deviation
As a result illustrate: Ct illustrates there is corresponding fluorescence corresponding source in sample less than 40 (being not 0).As the result is shown chicken probe and
Duck probe may detect that 0.1% horizontal mixing sample.These results suggest that mixed probe (chicken, duck and goose) has Ji Yuan
Property, duck source property and goose source property are the same as pipe detectability.
6, kit makes
(1) chicken source property, the duck source source Xing Hee property synchronous detection reagent kit reagent are as shown in the table:
(2) source chicken source Xing Heya property synchronous detection reagent kit reagent is as shown in the table:
| Reagent | Explanation |
| Probe qPCR premixed liquid | Reaction system (enzyme, dNTP, Mg2+) |
| Three source property detect forward primer | Concentration is 10 μM |
| Chicken source property detects reverse primer | Concentration is 10 μM |
| Duck source property detects reverse primer | Concentration is 10 μM |
| Chicken probe | Concentration is 10 μM |
| Duck probe | Concentration is 10 μM |
| Chicken positive criteria product | Concentration is 100ng/ μ L, is used for chicken positive control and standard curve |
| Duck positive criteria product | Concentration is 100ng/ μ L, is used for duck positive control and standard curve |
| The deionized water of sterilizing | Supplement reaction system |
(3) source chicken source Xing Hee property synchronous detection reagent kit reagent is as shown in the table:
(4) source duck source Xing Hee property synchronous detection reagent kit reagent is as shown in the table:
| Reagent | Explanation |
| Probe qPCR premixed liquid | Reaction system (enzyme, dNTP, Mg2+) |
| Three source property detect forward primer | Concentration is 10 μM |
| Duck source property detects reverse primer | Concentration is 10 μM |
| Goose source property detects reverse primer | Concentration is 10 μM |
| Duck probe | Concentration is 10 μM |
| Goose probe | Concentration is 10 μM |
| Duck positive criteria product | Concentration is 100ng/ μ L, is used for chicken positive control and standard curve |
| Goose positive criteria product | Concentration is 100ng/ μ L, is used for duck positive control and standard curve |
| The deionized water of sterilizing | Supplement reaction system |
。
Claims (9)
1. the primer and probe that chicken source property, duck source property and goose source property are detected with pipe in meat products, which is characterized in that primer and spy
Needle sequence is as follows:
Three source property detect forward primer sequence as shown in SEQ ID No.1,
Chicken source property detects reverse primer sequences as shown in SEQ ID No.2,
Duck source property detects reverse primer sequences as shown in SEQ ID No.3,
Goose source property detects reverse primer sequences as shown in SEQ ID No.4
Chicken probe sequence as shown in SEQ ID No.5,
Duck probe sequence as shown in SEQ ID No.6,
Goose probe sequence is as shown in SEQ ID No.7.
2. the primer and probe that chicken source property, duck source property and goose source property are detected with pipe in meat products according to claim 1,
It is characterized in that, the 5' of chicken probe, duck probe and goose probe sequence is terminal modified reporter group, 3' is terminal modified quenching group,
Reporter group is any one in FAM, HEX, ROX or CY5, any one in quenching group TAMRA, BHQ1, BHQ2 or MGB
Kind.
3. the kit that chicken source property, duck source property and goose source property are detected with pipe in meat products, which is characterized in that contain in the kit
Have:
Three source property shown in SEQ ID No.1 detect forward primer,
Chicken source property shown in SEQ ID No.2 detects reverse primer,
Duck source property shown in SEQ ID No.3 detects reverse primer,
Goose source property shown in SEQ ID No.4 detects reverse primer
Chicken probe shown in SEQ ID No.5,
Duck probe shown in SEQ ID No.6,
Goose probe shown in SEQ ID No.7,
Probe qPCR premixed liquid,
Chicken positive criteria product,
Duck positive criteria product,
Goose positive criteria product.
4. the kit that chicken source property and duck source property are detected with pipe in meat products, which is characterized in that contain in the kit:
Three source property shown in SEQ ID No.1 detect forward primer,
Chicken source property shown in SEQ ID No.2 detects reverse primer,
Duck source property shown in SEQ ID No.3 detects reverse primer,
Chicken probe shown in SEQ ID No.5,
Duck probe shown in SEQ ID No.6,
Probe qPCR premixed liquid,
Chicken positive criteria product,
Duck positive criteria product.
5. the kit that chicken source property and goose source property are detected with pipe in meat products, which is characterized in that contain in the kit:
Three source property shown in SEQ ID No.1 detect forward primer,
Chicken source property shown in SEQ ID No.2 detects reverse primer,
Goose source property shown in SEQ ID No.4 detects reverse primer
Chicken probe shown in SEQ ID No.5,
Goose probe shown in SEQ ID No.7,
Probe qPCR premixed liquid,
Chicken positive criteria product,
Goose positive criteria product.
6. the kit that duck source property and goose source property are detected with pipe in meat products, which is characterized in that contain in the kit:
Three source property shown in SEQ ID No.1 detect forward primer,
Duck source property shown in SEQ ID No.3 detects reverse primer,
Goose source property shown in SEQ ID No.4 detects reverse primer
Duck probe shown in SEQ ID No.6,
Goose probe shown in SEQ ID No.7,
Probe qPCR premixed liquid,
Duck positive criteria product,
Goose positive criteria product.
7. the method that chicken source property, duck source property and goose source property are detected with pipe in meat products, which is characterized in that steps are as follows:
(1) DNA of meat products is extracted；
(2) concentration and quality of DNA are detected, and by concentration dilution to 100-200ng/ μ L；
(3) multiple fluorescence quantitative PCR is carried out to DNA dilution using the primer and probe of SEQ ID No.1~SEQ ID No.7
Amplification, does positive control with chicken, duck and goose positive criteria product, does negative control with the deionized water of sterilizing, the sky extracted with DNA
It is white to the control group for complying extracting method；
(4) Real-time PCR after reaction, setting Threshold be it is automatic, reading chicken, duck and goose correspondent probe Ct
Value and positive control, negative control and the Ct of blank control；Only when positive control Ct≤40, negative control and blank control
Ct can just carry out the judgement of correspondent probe source property result when being 0；When Ct≤40 of correspondent probe, result judgement is with corresponding
Source property, while having Ct≤40 of multiple probes, result judgement is with corresponding three source property；
(5) the quantitative standard curve of DNA is done using chicken, duck and goose positive criteria product；
(6) respective sources in the available meat products of formula in the Ct value and standard curve of the respective sources of detection meat products are utilized
The quantitative detection result of property.
8. the method that chicken source property, duck source property and goose source property are detected with pipe in meat products according to claim 7, feature
It is, Real-time PCR amplification parameter are as follows: 94 DEG C of denaturation temperature, 30s, 94 DEG C of denaturation temperature, 5s, elongating temperature of annealing
60 DEG C, 34s, 40 circulations.
9. the method for chicken source property, duck source property and the detection of goose source property, feature exist in meat products according to claim 7
In Real-time PCR reaction system are as follows: three source property shown in 10 μ L of Probe qPCR premixed liquid, SEQ ID No.1 detect just
To 1 μ L of primer, concentration is 10 μM；Chicken source property shown in SEQ ID No.2 detects 0.33 μ L of reverse primer, and concentration is 10 μM；SEQ
Duck source property shown in ID No.3 detects 0.33 μ L of reverse primer, and concentration is 10 μM；The detection of goose source property shown in SEQ ID No.4
0.34 μ L of reverse primer, concentration are 10 μM；0.5 μ L of chicken probe shown in SEQ ID No.5, concentration are 10 μM；,SEQ ID
0.5 μ L of duck probe shown in No.6, concentration are 0.5 μ L of goose probe shown in 10 μM and SEQ ID No.7, and concentration is 10 μM；DNA
2 μ L of template, the 4.5 μ L of deionized water of sterilizing, 20 μ L of total volume.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910709570.0A CN110305972B (en) | 2019-08-02 | 2019-08-02 | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910709570.0A CN110305972B (en) | 2019-08-02 | 2019-08-02 | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110305972A true CN110305972A (en) | 2019-10-08 |
| CN110305972B CN110305972B (en) | 2022-12-27 |
Family
ID=68082818
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910709570.0A Active CN110305972B (en) | 2019-08-02 | 2019-08-02 | Primer, probe and kit for synchronous detection of chicken, duck and goose sources in meat products |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110305972B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745707A (en) * | 2015-04-08 | 2015-07-01 | 苏州红冠庄国药股份有限公司 | Primer system for PCR identification of rabbits, chicken, ducks, gooses, cattle, sheep, donkeys, horses, pigs and deer |
| WO2015097030A1 (en) * | 2013-12-27 | 2015-07-02 | Universite De Liege | Detection methods |
| CN107663543A (en) * | 2017-11-09 | 2018-02-06 | 贵州省产品质量监督检验院 | Detect triple fluorescent PCR primer probe groups, kit and the method for six kinds of avian compositions |
-
2019
- 2019-08-02 CN CN201910709570.0A patent/CN110305972B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015097030A1 (en) * | 2013-12-27 | 2015-07-02 | Universite De Liege | Detection methods |
| CN104745707A (en) * | 2015-04-08 | 2015-07-01 | 苏州红冠庄国药股份有限公司 | Primer system for PCR identification of rabbits, chicken, ducks, gooses, cattle, sheep, donkeys, horses, pigs and deer |
| CN107663543A (en) * | 2017-11-09 | 2018-02-06 | 贵州省产品质量监督检验院 | Detect triple fluorescent PCR primer probe groups, kit and the method for six kinds of avian compositions |
Non-Patent Citations (3)
| Title |
|---|
| GUO-QIANG等: "Improved triplex real-time PCR with endogenous control for synchronous identification of DNA from chicken, duck, and goose meat", 《FOOD SCI. NUTR.》 * |
| HOU BO等: "Development of a sensitive and specific multiplex PCR method for the simultaneous detection of chicken, duck and goose DNA in meat products", 《MEAT SCIENCE》 * |
| 张慧霞等: "应用PCR 技术检测禽类源性成分", 《中国畜牧杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110305972B (en) | 2022-12-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kumar et al. | Identification of species origin of meat and meat products on the DNA basis: a review | |
| Lee et al. | Comparative survey of rumen microbial communities and metabolites across one caprine and three bovine groups, using bar-coded pyrosequencing and 1H nuclear magnetic resonance spectroscopy | |
| CN107245518A (en) | It is a kind of while gene micro-fluid chip and its application of 26 kinds of animal derived materials of detection | |
| CN105274099A (en) | Primers, probe composition and kit for rapid identification of nine animal origin ingredients in food or feed, detection method for identification of nine animal origin ingredients in food or feed and application of primers, probe composition, kit and detection method | |
| Zhu et al. | Selection of reference genes for gene expression studies related to intramuscular fat deposition in Capra hircus skeletal muscle | |
| CN101173316A (en) | Chicken, beef, pork and horseflesh multiple PCR rapid detection kit and uses thereof | |
| CN104946790B (en) | A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source | |
| CN105177150B (en) | A kind of the multiple PCR primer system and detection method of quick detection pig sheep ox animal derived materials | |
| CN105734160A (en) | Primer system for PCR identification on pig, bovine and sheep derived components of livestock and PCR identification method and kit | |
| CN104928391A (en) | Primer probe combination for identifying four components of canine animal origin, kit and multiple real-time fluorescence PCR (polymerase chain reaction) detection method | |
| CN105296648B (en) | Fox derived component identify and animal product in fox, rabbit, dog ingredient multiple PCR detection kit | |
| CN104774958A (en) | Primer probe composition for identifying sources of animals including donkeys, horses and foxes, kit and multiplex real-time fluorescence quantitative PCR detecting method | |
| CN103361422A (en) | Multiplex-PCR rapid detection method for identification of adulterated meat and products thereof | |
| Zhao et al. | Direct lysis-multiplex polymerase chain reaction assay for beef fraud substitution with chicken, pork and duck | |
| CN106868188A (en) | Deer in a kind of deer horn glue, ox source property multiple fluorescence PCR detection primer, probe, kit and detection method and application | |
| CN108060238A (en) | The primer and probe and kit of ox and the detection of horse source property in former milk or acidified milk | |
| CN105132543A (en) | Primers, probe composition, kit and multiplex fluorescence PCR detection method for detecting ass-derived component, horse-derived component and bovine-derived component in cosmetics | |
| Kim et al. | Development of a fast duplex real-time PCR assay for simultaneous detection of chicken and pigeon in raw and heat-treated meats | |
| CN107858443A (en) | Quantitatively detect primer, probe and the kit of sheep, ox and pig source property in meat products | |
| CN103224989A (en) | Method for quickly detecting duck-derived components in food | |
| CN105907852A (en) | Nested fluorescent PCR detection primer, probe, kit and detection method of donkey-origin, horse-origin, swine-origin and bovine-origin in donkey-hide gelatin, and applications thereof | |
| Liu et al. | Analysis on bacterial community structure of new and old fermented pit mud of Shedian Liquor | |
| CN105734156A (en) | Nest-type fluorescence PCR detection primers, probe composition and kit for donkey and pig-sourced ingredients in colla corii asini and detection method and application | |
| CN110305972A (en) | The primer and probe and kit of the synchronous detection of chicken, duck and goose source property in meat products | |
| CN104789692B (en) | A kind of primer sets and kit for differentiating cattle and sheep pig derived component |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |