CN107439220A - A kind of high yield cultivating method of the non-all-male kind of asparagus - Google Patents
A kind of high yield cultivating method of the non-all-male kind of asparagus Download PDFInfo
- Publication number
- CN107439220A CN107439220A CN201710706385.7A CN201710706385A CN107439220A CN 107439220 A CN107439220 A CN 107439220A CN 201710706385 A CN201710706385 A CN 201710706385A CN 107439220 A CN107439220 A CN 107439220A
- Authority
- CN
- China
- Prior art keywords
- male
- plant
- asparagus
- plants
- female
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 235000005340 Asparagus officinalis Nutrition 0.000 title claims abstract description 46
- 238000000034 method Methods 0.000 title claims abstract description 29
- 244000003416 Asparagus officinalis Species 0.000 title description 2
- 241000234427 Asparagus Species 0.000 claims abstract description 55
- 238000002955 isolation Methods 0.000 claims abstract description 8
- 238000010899 nucleation Methods 0.000 claims abstract description 7
- 241000196324 Embryophyta Species 0.000 claims description 84
- 238000009331 sowing Methods 0.000 claims description 12
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 claims description 10
- 239000000758 substrate Substances 0.000 claims description 8
- 210000000056 organ Anatomy 0.000 claims description 7
- 238000012364 cultivation method Methods 0.000 claims description 6
- 235000016709 nutrition Nutrition 0.000 claims description 6
- 230000035764 nutrition Effects 0.000 claims description 5
- 238000001514 detection method Methods 0.000 claims description 4
- 239000003147 molecular marker Substances 0.000 claims description 4
- 230000000877 morphologic effect Effects 0.000 claims description 4
- 210000001672 ovary Anatomy 0.000 claims description 4
- 230000004888 barrier function Effects 0.000 claims description 3
- 108020005120 Plant DNA Proteins 0.000 claims description 2
- 239000003086 colorant Substances 0.000 claims description 2
- 230000007850 degeneration Effects 0.000 claims description 2
- 238000007726 management method Methods 0.000 description 20
- 235000017166 Bambusa arundinacea Nutrition 0.000 description 17
- 235000017491 Bambusa tulda Nutrition 0.000 description 17
- 241001330002 Bambuseae Species 0.000 description 17
- 235000015334 Phyllostachys viridis Nutrition 0.000 description 17
- 239000011425 bamboo Substances 0.000 description 17
- 238000009395 breeding Methods 0.000 description 9
- 230000001488 breeding effect Effects 0.000 description 9
- 238000003306 harvesting Methods 0.000 description 6
- 230000009418 agronomic effect Effects 0.000 description 5
- 108020004414 DNA Proteins 0.000 description 3
- 230000009286 beneficial effect Effects 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 230000018109 developmental process Effects 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 235000019640 taste Nutrition 0.000 description 3
- 244000025254 Cannabis sativa Species 0.000 description 2
- OKTJSMMVPCPJKN-UHFFFAOYSA-N Carbon Chemical compound [C] OKTJSMMVPCPJKN-UHFFFAOYSA-N 0.000 description 2
- 238000005452 bending Methods 0.000 description 2
- 229910052799 carbon Inorganic materials 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 239000003337 fertilizer Substances 0.000 description 2
- 229910052500 inorganic mineral Inorganic materials 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000005259 measurement Methods 0.000 description 2
- 239000011707 mineral Substances 0.000 description 2
- 239000010451 perlite Substances 0.000 description 2
- 235000019362 perlite Nutrition 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000005070 sampling Methods 0.000 description 2
- 239000002689 soil Substances 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 235000013311 vegetables Nutrition 0.000 description 2
- 239000010455 vermiculite Substances 0.000 description 2
- 229910052902 vermiculite Inorganic materials 0.000 description 2
- 235000019354 vermiculite Nutrition 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 208000035240 Disease Resistance Diseases 0.000 description 1
- 241000234280 Liliaceae Species 0.000 description 1
- XSQUKJJJFZCRTK-UHFFFAOYSA-N Urea Chemical compound NC(N)=O XSQUKJJJFZCRTK-UHFFFAOYSA-N 0.000 description 1
- 206010052428 Wound Diseases 0.000 description 1
- 208000027418 Wounds and injury Diseases 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 239000004202 carbamide Substances 0.000 description 1
- 238000005336 cracking Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 230000003203 everyday effect Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000005078 fruit development Effects 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 210000004907 gland Anatomy 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 229910000402 monopotassium phosphate Inorganic materials 0.000 description 1
- 235000019796 monopotassium phosphate Nutrition 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 235000015097 nutrients Nutrition 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- GNSKLFRGEWLPPA-UHFFFAOYSA-M potassium dihydrogen phosphate Chemical compound [K+].OP(O)([O-])=O GNSKLFRGEWLPPA-UHFFFAOYSA-M 0.000 description 1
- LWIHDJKSTIGBAC-UHFFFAOYSA-K potassium phosphate Substances [K+].[K+].[K+].[O-]P([O-])([O-])=O LWIHDJKSTIGBAC-UHFFFAOYSA-K 0.000 description 1
- 230000035935 pregnancy Effects 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G22/00—Cultivation of specific crops or plants not otherwise provided for
- A01G22/10—Asparagus
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Cultivation Of Plants (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of non-all-male kind high yield cultivating method of asparagus, using the common commercially available non-all-male variety seeds of conventional asparagus, passes through the steps such as seeding and seedling raising, sex identification, isolation cultivation and Routine Management, you can reach the purpose of volume increase, upgrading.
Description
Technical Field
The invention relates to the field of asparagus cultivation, and in particular relates to a high-yield cultivation method for non-all-male asparagus varieties.
Background
Asparagus officinalis L belongs to Asparagus perennial herbaceous plants in Liliaceae, is a nutritional health-care high-grade vegetable deeply loved by consumers, and is a reputation of vegetable king. Through the seed sowing and planting, the asparagus tender stem can be continuously harvested for more than 10 years.
The existing large-scale asparagus planting adopts a seed cultivation mode. At present, the commercial asparagus improved variety is mostly an amphoteric variety bred by adopting a conventional breeding mode, in the cultivation process, female plants and male plants in a population are mixed and distributed, and the theoretical ratio is 1: 1. In the flowering phase, female plants in the population are pregnant, and 5-7% of dry matter in the plants is consumed for fruit development. Therefore, in conventional cultivation, the yield of female asparagus plants is lower than that of male plants.
In view of the above reasons, researchers are dedicated to breeding all-male asparagus varieties to avoid the generation of female plants so as to improve the overall yield and quality. However, the asparagus all-male breeding needs to obtain an asparagus male line amphibian strain and a supermale strain, the amphibian strain is less in nature, the development and fructification of the amphibian strain are influenced by genetic materials and environmental factors, the selfing fructification rate is low, the breeding material is difficult to obtain, the breeding material is limited by genetic background greatly, the all-male breeding technology is not mature, the asparagus all-male seed variety is rare, and the selling price is high.
Disclosure of Invention
The invention aims to provide a high-yield cultivation method for non-all-male asparagus varieties, which adopts the conventional non-all-male asparagus varieties improved varieties sold in the common market and can achieve the purposes of yield increase and quality improvement through the steps of seeding and seedling raising, sex identification, isolated cultivation, conventional management and the like.
In order to achieve the purpose, the invention adopts the following technical scheme:
after the asparagus plant is subjected to sex identification, a female plant and a male plant of the asparagus are cultivated in an isolated manner.
In certain embodiments, the method comprises the steps of:
step 1: selecting conventional non-full-male variety improved varieties of asparagus, and sowing and raising seedlings;
step 2: identifying the sex of the single plant, and respectively marking the female plant and the male plant;
and step 3: planting and isolating the female plants and the male plants marked in the step 2;
and 4, step 4: and (5) performing conventional cultivation management.
In certain embodiments, in the method, the step 1 seeding is performed by single-seed seeding and seedling raising by using a nutrition pot or a plug substrate.
In certain embodiments, the method of step 2 for identifying the sex of the individual plant comprises:
(1) extracting single plant DNA, and marking female plants and male plants by ropes with different colors according to a molecular marking detection result;
or (2) identifying the female plant and the male plant according to the morphological difference of flower organs when the plants bloom, wherein the floral organ difference of the female plant and the male plant is as follows: the pistil of the female plant of asparagus has normal pistil, a healthy ovary and a healthy stigma, and the stamen is highly degenerated uniformly; stamens of stamens are healthy, the degree of pistil degeneration is high, ovaries are small, and stigmas do not exist (figure 1).
In some embodiments, the method wherein the method of identifying the individual sex (1) is performed prior to seedbed management; the method (2) for identifying the sex of the single plant is carried out at the plant florescence stage after seedbed management.
In certain embodiments, in the methods, the method for identifying the individual sex (1) employs a molecular marker Asp1-T7 sp.
In certain embodiments, in the method, the step 3 of isolation cultivation of the female and male plants employs distance isolation or barrier isolation.
The invention has the beneficial effects that:
1. according to the method, female asparagus plants and male asparagus plants are separately cultivated through the steps of seeding and seedling raising, sex identification, isolated cultivation, conventional management and the like. After isolation, female plants do not bear the pregnancy result in the flowering phase, so that nutrients in the plants are reserved, and the yield per unit and the quality of the plants are improved; the flowering period of the male plant is not affected, and the yield and the quality of the male plant are kept unchanged. Thereby realizing the overall effect of increasing the yield and improving the quality.
2. In the invention, the asparagus female and male plants are separately and respectively planted, which is beneficial to adopting more scientific field management according to respective physiological characteristics.
3. The invention separately and respectively plants the asparagus female and male plants, is beneficial to field harvest and product grading, and saves time and labor.
4. The method adopts a non-all-male asparagus variety, and can ensure the supply quantity of commercial asparagus products and the diversity of agronomic characters, tastes and tastes of the commercial asparagus products before the asparagus all-male breeding technology is mature.
Drawings
Fig. 1 shows the morphological structure of male and female asparagus flowers.
In the figure: a-male flowers; b-female flowers; 1-stamen; 2-pistil; 3-ovary; 4-column cap.
Detailed Description
The following examples are given to illustrate specific embodiments of the present invention:
example 1
The method is carried out in 2016 in an experimental base of a commercial crop breeding and cultivation research institute of academy of agricultural sciences of Sichuan province, and comprises the steps of setting an experimental plot 1, a plot 2 and a plot 3, wherein conventional planting greenhouses are adopted among the plots, and the spacing is 300-1000 m. The asparagus seeds are derived from a commercial "atlas" variety.
Experimental plot 1 was a control group. The specific implementation method adopts the conventional asparagus cultivation management method and mainly comprises the steps of sowing and seedling raising, seedbed management, field planting, field management and the like.
Preparation of plug substrates: the 32-hole disk specification has the total length of 53.5cm, the total width of 27.5cm, the upper caliber of 6cm and the height of 5 cm. The matrix mainly adopts grass carbon, and natural mineral substances such as perlite, vermiculite, sawdust and the like are added.
Sowing and seedling raising: the proper sowing period is when the soil temperature reaches more than 10 ℃ at 4-5 cm underground. The plug is filled with a substrate. During sowing, water is firstly poured thoroughly, then small holes with the depth of 2cm are pricked, single-seed sowing is carried out, and 2cm of soil is covered after sowing.
Transplanting and field planting: and randomly mixing and transplanting asparagus seedlings in the experimental plot 1.
And (3) sex identification: in order to accurately count the yield of female plants and male plants in the system, the plants are marked according to the difference of flower organs during the flowering period: the male plant is tied with a red rope, and the female plant is tied with a yellow rope.
The experimental plots 2 and 3 are experimental groups, and the specific implementation mode is as follows:
preparation of plug substrates: same as the control.
Sowing and seedling raising: same as the control.
Sampling and sex identification: sampling and numbering in sequence according to the plug arrangement sequence, and taking tender leaves of each plant 20 days before transplanting for extracting DNA; extracting individual DNA, performing polymerase chain reaction on the extracted DNA by using a molecular marker Asp1-T7sp (the primer sequence is shown in attached table 1 in detail), and detecting the amplification product by 2% agarose gel electrophoresis. And binding red ropes on the male plants and binding yellow ropes on the female plants in sequence according to the detection result.
Attached table 1: molecular marker Asp1-T7sp sequence
| The forward primers 5, -3, | the reverse primers 5, -3, |
| ATATGCGAGGCATTTGGAAG | CTGCTACTGAGATACCTTAC |
transplanting and field planting: and (5) transplanting 80 days after seedling cultivation when the plant height of the seedlings reaches 20-30 cm. Transplanting the male plants tied with the red ropes into the plots 2, and transplanting the female plants tied with the yellow ropes into the plots 3.
Field management: both the two greenhouses adopt the same seedbed management and cultivation management as the land parcel 1, and further determine male and female plants in the flowering phase, so as to ensure that no male plant exists in the land parcel 3 and no female plant exists in the land parcel 2.
The next year after planting is the year of picking the bamboo shoots, and 20 asparagus plants are randomly marked in an experimental plot 1, a plot 2 and a plot 3 respectively for measuring yield. And (4) performing plant division and harvesting on the bamboo shoots with the height of 20cm or more in the shed twice a day (once in the morning and afternoon), and determining the related agronomic characters. The statistical results are detailed in the attached table 2.
Attached table 2: example 1 statistical results of yield measurements
Description of the drawings: first-stage bamboo shoot: the diameter is more than 1cm, the length of the bamboo shoot is more than or equal to 20cm, and the bamboo shoot is free of loose head, bending and stem cracking and hollow;
second-stage bamboo shoot: the diameter is 0.8-1.0 cm, the length of the bamboo shoot is more than or equal to 20cm, and small cracks, slight bending and mechanical wounds are allowed;
third-stage bamboo shoots: the diameter is 0.5-0.8 cm, the length of the bamboo shoot is more than or equal to 20cm, and the shape of the bamboo shoot is required to be the same as that of the second-level bamboo shoot.
As can be seen from the attached table 2, the indexes of the female plants cultivated in the plot 3, such as the number of the shoot branches of a single plant, the diameter of the shoot, the weight of the single branch, the first-level shoot rate, the total yield of the single-plant shoot picking and the like, are obviously superior to the indexes of the female plants in the plot 1; and the agronomic character indexes of the male plants cultivated in the land parcel 2 are similar to the indexes of the male plants in the land parcel 1. Therefore, the first-grade bamboo shoot rate and the total yield index of single-plant bamboo shoot picking in the experimental plot are superior to those of a control plot.
If the average level of the conventional asparagus cultivation management is calculated, the yield of female plants per mu can be increased by 28kg, the first-grade bamboo shoot rate is increased, and the sale price is increased. Calculated according to the market price of 20 yuan/kg in the current asparagus sales, 560 yuan can be increased per mu. The asparagus is a perennial economic crop, can be harvested for 10-15 years after being planted once, and the yield is further improved after the third year.
Example 2
In this example, the experiment time and place were the same as in example 1, and the seeds were derived from a commercially available "Gland" variety. Two experimental plots 4 and 5 are defined, and a closable greenhouse is adopted between the plots for barrier isolation.
Plot 4 was a control group and was conducted in greenhouse a.
The experimental plot 5 adopts the non-all-male variety high-yield cultivation method, and the specific implementation method is as follows:
preparing a nutrition pot substrate: the nutrition pot is characterized in that the diameter of the upper opening is 8cm, the height is 8cm, the substrate mainly adopts grass carbon, and natural mineral substances such as perlite, vermiculite, sawdust and the like are added.
Seedling raising and seedling stage management: the method of sowing and raising seedlings was similar to that of example 1, and single-grain sowing was performed in a nutrition pot. In the field management of the seedling stage, the seedlings need to be transplanted after flowering, so that the asparagus seedlings are relatively long in time on a seedling bed, and the intensive management is needed in the later stage. After 45 days of seedling culture, dressing foliage fertilizer is started, 7 g of monopotassium phosphate and urea (1: 1) are sprayed every 15 days and every square meter, and the concentration is 0.5%. After about 4 months, properly controlling water and fertilizer to promote flowering. After blooming, half of the plants are randomly selected and transplanted into the greenhouse a. And carrying out sex identification on the remaining half of the plants.
And (3) sex identification: and (4) when the asparagus seedlings start to bloom on the seedbed, carrying out sex identification on the plants according to the difference of flower organs every day. And binding a red rope on the male plant and binding a yellow rope on the female plant in sequence according to the identification result.
Transplanting: the experimental plot 5 is divided into a greenhouse b and a greenhouse c. And transplanting the identified male plant and the female plant into a greenhouse b and a greenhouse c respectively for field planting.
Cultivation management: the experimental plot 4 and the experimental plot 5 adopt the same existing cultivation management method.
The agronomic characters of the greenhouse a, the greenhouse b and the greenhouse c are counted respectively in the year of picking the bamboo shoots, and the method is the same as the embodiment 1. The statistical results are detailed in the attached table 3.
Attached table 3: example 2 statistical results of yield measurements
As can be seen from the attached Table 3, the results of example 2 are consistent with those of example 1, i.e., the first-grade bamboo shoot yield and the total yield index of single-plant bamboo shoot harvest of the experimental plot 5 of the present invention are superior to those of the control plot 4.
If the average level of the conventional asparagus cultivation management and the selling price of the asparagus are used, the yield of each mu is increased by 26.4kg and the income is increased by 528 yuan according to the data of the attached table 3 by calculating 800 female plants in each mu.
The above scheme is further illustrated as follows:
the asparagus fine variety bred by conventional breeding has wider selection range of agronomic characters, disease resistance, taste and the like and more reasonable purchase price compared with the prior rare all-male variety.
Based on the current technological development level, a method for identifying the sex through floral organ difference in the flowering period is more suitable for field production, and the isolated planting of female asparagus plants and male asparagus plants is realized. But does not exclude the possibility that the rapid identification of the asparagus sex can be realized in the seedling stage or earlier stage of the asparagus by the biotechnology means along with the development of the detection technology.
When the sex identification of the individual plant and the isolated cultivation are carried out, compared with the existing asparagus cultivation method, the labor total amount is not obviously increased, and the labor intensity is only increased in part of time intervals. Compared with the cultivation period of more than 10 years after the field planting of the asparagus, the cost of labor time increase caused by single plant sex identification and isolated cultivation operation is very little, and the yield increasing and quality improving effects generated by the operation of the invention generate obvious economic benefit.
Research shows that the harvesting time and the harvesting time length of the female asparagus plant and the male asparagus plant are different. Therefore, after the asparagus plants with different sexes are isolated and cultivated, the field management and the harvesting are facilitated.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.
Claims (7)
1. A high-yield cultivation method for non-full-male asparagus varieties is characterized in that after sex identification is carried out on asparagus plants, female plants and male plants of asparagus are separately cultivated.
2. The method of claim 1, comprising the steps of:
step 1: selecting conventional non-full-male variety improved varieties of asparagus, and sowing and raising seedlings;
step 2: identifying the sex of the single plant, and respectively marking the female plant and the male plant;
and step 3: planting and isolating the female plants and the male plants marked in the step 2;
and 4, step 4: and performing conventional cultivation management.
3. The method as claimed in claim 2, wherein the seeding in step 1 is carried out by single-seed seeding and seedling raising by using a plug substrate or a nutrition pot substrate.
4. The method of claim 2, wherein the step 2 of identifying the individual sex comprises:
(1) extracting single plant DNA, and marking female plants and male plants by ropes with different colors according to a molecular marking detection result; or,
(2) identifying a female plant and a male plant according to the morphological difference of flower organs of the plants during the flowering, wherein the morphological difference of the female plant and the male plant is as follows: the pistil of the female plant of asparagus has normal pistil, a healthy ovary and a healthy stigma, and the stamen is highly degenerated uniformly; the stamen of the stamen organ of the stamen plant is healthy, the degree of pistil degeneration is high, the ovary is very small, and no stigma exists.
5. The method according to claim 4, wherein the method for identifying the individual sex (1) is performed at a pre-bed management stage; the method (2) for identifying the sex of the single plant is carried out at the later stage of seedbed management and the flowering period of the plant.
6. The method according to claim 4, wherein the molecular marker used in the method (1) is Asp1-T7 sp.
7. The method according to claim 2, wherein the step 3 of isolated cultivation of female and male plants employs distance isolation or barrier isolation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710706385.7A CN107439220B (en) | 2017-08-17 | 2017-08-17 | High-yield cultivation method for asparagus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710706385.7A CN107439220B (en) | 2017-08-17 | 2017-08-17 | High-yield cultivation method for asparagus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107439220A true CN107439220A (en) | 2017-12-08 |
| CN107439220B CN107439220B (en) | 2020-02-18 |
Family
ID=60491386
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710706385.7A Active CN107439220B (en) | 2017-08-17 | 2017-08-17 | High-yield cultivation method for asparagus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107439220B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111183896A (en) * | 2020-03-11 | 2020-05-22 | 四川省农业科学院经济作物育种栽培研究所 | Method for rapidly identifying amphibian asparagus plant fruits |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101263783A (en) * | 2008-03-25 | 2008-09-17 | 浙江大学 | Method for using herbicide barban to fast breed aloe all-male plant strain |
| CN104604502A (en) * | 2015-02-04 | 2015-05-13 | 广西壮族自治区农业科学院经济作物研究所 | Cultivating method for cannabis sativa L. for southern plain autumn sowing seed use |
| CN106718866A (en) * | 2017-03-21 | 2017-05-31 | 河北省农林科学院经济作物研究所 | A kind of asparagus all-male breeding method |
-
2017
- 2017-08-17 CN CN201710706385.7A patent/CN107439220B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101263783A (en) * | 2008-03-25 | 2008-09-17 | 浙江大学 | Method for using herbicide barban to fast breed aloe all-male plant strain |
| CN104604502A (en) * | 2015-02-04 | 2015-05-13 | 广西壮族自治区农业科学院经济作物研究所 | Cultivating method for cannabis sativa L. for southern plain autumn sowing seed use |
| CN106718866A (en) * | 2017-03-21 | 2017-05-31 | 河北省农林科学院经济作物研究所 | A kind of asparagus all-male breeding method |
Non-Patent Citations (2)
| Title |
|---|
| 周劲松: "DNA分子标记早期快速鉴别芦笋雌雄株", 《分子植物育种》 * |
| 范双喜: "我国石刁柏研究现状及存在的主要问题", 《北京农学院学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111183896A (en) * | 2020-03-11 | 2020-05-22 | 四川省农业科学院经济作物育种栽培研究所 | Method for rapidly identifying amphibian asparagus plant fruits |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107439220B (en) | 2020-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | The historical and current research progress on jujube–a superfruit for the future | |
| CN106900346B (en) | Edible sweet potato simple root vine seedling raising method | |
| WO2015109880A1 (en) | Method for cultivating overyear regrowing rice seeds and seedling growing and planting method | |
| CN107251802A (en) | A kind of method of Kiwi berry high position grafting | |
| CN103404428B (en) | Cross-breeding method of Fuhong large cherry | |
| CN104584973A (en) | Cultivation method for early fruiting and high yield of Carya cathayensis | |
| CN105359963B (en) | Method for cultivating easy-coloring apple variety | |
| CN114885830B (en) | Method for cultivating pepper polygene polymerization germplasm based on combination of molecular marker-assisted selection and ploidy breeding | |
| Zandi et al. | Agronomic study of fenugreek grown under different in-row spacing and nitrogen levels in a paddy field of Iran | |
| CN107232012B (en) | Method for cultivating walnut and fruit material dual-purpose forest | |
| CN106416995A (en) | Method for breeding novel variety of Brassica oleracea by using two DH (dihaploid) lines | |
| CN110419440B (en) | Double-clone hybrid variety breeding method of tea tree based on Baihao early Obelia | |
| CN107439220B (en) | High-yield cultivation method for asparagus | |
| CN105284590B (en) | The breeding method of precocity shape sponge gourd with a tight waist | |
| CN109348952A (en) | A method of improving dry land willow salt resistant character | |
| CN103947539A (en) | Breeding method for minquan-series radish | |
| CN107548858A (en) | A kind of apple nursery stock mating system | |
| CN102273372A (en) | Method for planting golden and purple bean in sunlight greenhouse | |
| CN112136617A (en) | Planting method for achieving one-crop-multiple-harvest of oilseed rape | |
| CN105766288A (en) | Method for staged harvest and whole-year production of early-spring sweet potatoes | |
| CN1600075A (en) | Method for cultivating disease resistance tomato breeds of standing against store and transportation and long shelf life | |
| CN105519318A (en) | Two-crop corn planting method | |
| Siéné et al. | Behaviour of a Traditional Variety of Fonio (Digitaria exilis (Kippist) Stapf) sowed following five densities of pot seeds in the municipality of Korhogo (COTE D’IVOIRE) | |
| CN106358729B (en) | Propagation updating method for genetic integrity analysis of wild soybeans | |
| CN114128580B (en) | Lily bulb breeding method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210406 Address after: No.159, section 3, Huajin Avenue, Qingbaijiang District, Chengdu, Sichuan 610000 Patentee after: Institute of economic crop breeding and cultivation, Sichuan Academy of Agricultural Sciences Patentee after: Pengzhou Tianfu Shuxiang Agricultural Development Co.,Ltd. Address before: No.159, section 3, Huajin Avenue, Qingbaijiang District, Chengdu, Sichuan 610399 Patentee before: Institute of economic crop breeding and cultivation, Sichuan Academy of Agricultural Sciences |
|
| TR01 | Transfer of patent right | ||
| CP01 | Change in the name or title of a patent holder |
Address after: No.159, section 3, Huajin Avenue, Qingbaijiang District, Chengdu, Sichuan 610000 Patentee after: INDUSTRIAL CROP Research Institute Patentee after: Pengzhou Rural Investment Development Co., Ltd Address before: No.159, section 3, Huajin Avenue, Qingbaijiang District, Chengdu, Sichuan 610000 Patentee before: INDUSTRIAL CROP Research Institute Patentee before: Pengzhou Tianfu vegetable Township Agricultural Development Co., Ltd |
|
| CP01 | Change in the name or title of a patent holder |