CN107418967B - Uracil auxotroph hansenula polymorpha and preparation method and application thereof - Google Patents

Abstract

The invention discloses uracil auxotroph Hansenula polymorpha, a preparation method and application thereof. The invention discloses a preparation method of uracil auxotroph Hansenula polymorpha, which comprises the following steps: knocking out orotidine-5' -phosphate decarboxylase gene in the starting strain of the Hansenula polymorpha or the content of the protein coded by the gene or inactivating the protein coded by the gene to obtain uracil auxotroph Hansenula polymorpha; the knockout orotidine-5' -phosphate decarboxylase genes are M1) and M2) below: m1) premature termination of the coding of the orotidine-5' -phosphate decarboxylase gene; m2) inserting the exogenous DNA fragment in the orotidine-5' -phosphate decarboxylase gene. The uracil auxotroph Hansenula polymorpha constructed by the invention is stable in heredity, has no obvious difference with other growth characteristics from wild strains, and can be used as a chassis cell for metabolic engineering or synthetic biology modification and a cell factory for efficiently expressing recombinant proteins.

Description

Uracil auxotroph hansenula polymorpha and preparation method and application thereof

Technical Field

The invention relates to uracil auxotroph Hansenula polymorpha and a preparation method and application thereof in the technical field of biology.

Background

Yeast, as a unicellular eukaryote, is a very widely applied microorganism in the field of biotechnology and plays a very important role in the production of bulk fermentation products, fine medicinal chemicals and protein drugs. Hansenula polymorpha (Hansenula polymorpha) is a methanol nutritional yeast, and can grow by taking methanol as a unique carbon source and induce the high-efficiency expression of protein; the optimal growth temperature is 37 ℃, and the growth regulator has good tolerance to various environmental stresses such as heat stress, metal stress, oxygen stress and the like, so the growth regulator has wide adaptability to industrial environment; the high efficiency, stability and uniformity of protein expression are ensured by the stable and high copy integration of the exogenous DNA on the chromosome; the protein secretion pathway and the post-translational modification mechanism are closer to those of higher eukaryotes, so that the immunogenicity risk of the recombinant protein is reduced; is a recognized safe microorganism (GRAS) approved by the national food and drug administration (CFDA); some macromolecular proteins, membrane proteins and structural complex proteins which can not realize functional expression in other expression systems are functionally and effectively expressed in the Hansenula polymorpha. Therefore, the Hansenula polymorpha becomes the most ideal microbial cell factory for efficiently synthesizing recombinant protein drugs and other high-valued proteins.

Selectable markers are important tools necessary for genetic engineering of microbial strains. Selection markers commonly used in the genetic modification of Hansenula polymorpha include antibiotic resistance selection and auxotrophic complementation selection. Compared with antibiotic resistance screening, the auxotrophy screening marker with complementary functions has the characteristics of high biological safety and low false positive rate, and has wider application in high-efficiency expression of recombinant protein for food and medicine. However, most of the auxotrophic strains of Hansenula polymorpha used at present are derived from traditional physical or chemical mutagenesis, and the screening efficiency is influenced by the defect in genetic stability; and the original strain is basically a model strain of American Type Culture Collection (ATCC) and is limited in industrial application. The development of the Hansenula polymorpha strain with the auxotrophic selection marker and stable heredity from the source is a problem to be solved by giving full play to the advantages of Hansenula polymorpha in recombinant protein expression and realizing industrial application.

Disclosure of Invention

The technical problems to be solved by the invention are how to prepare uracil auxotroph Hansenula polymorpha and how to express proteins in uracil auxotroph Hansenula polymorpha.

In order to solve the above technical problems, the present invention first provides a method for preparing uracil auxotroph Hansenula polymorpha (Hansenula polymorpha).

The preparation method of uracil auxotroph Hansenula polymorpha (Hansenula polymorpha) provided by the invention comprises the following steps: knocking out genes in a uracil synthesis pathway in a Hansenula polymorpha starting strain or reducing the content of proteins encoded by the genes in the uracil synthesis pathway in the Hansenula polymorpha starting strain or inactivating the proteins encoded by the genes in the uracil synthesis pathway in the Hansenula polymorpha starting strain to obtain uracil auxotroph Hansenula polymorpha; the Hansenula polymorpha starting strain contains the genes in the uracil synthesis pathway.

The Hansenula polymorpha starting strain can be Hansenula polymorpha (Hansenula polymorpha) HP20110424, and the preservation number of the Hansenula polymorpha starting strain in the China general microbiological culture Collection center is CGMCC No. 7.89.

In the above method, the gene in the uracil synthesis pathway may be an orotidine-5' -phosphate decarboxylase gene.

In the above method, the orotidine-5' -phosphate decarboxylase gene may be a1) or a2) or A3) or a4) as follows:

A1) the coding sequence is a DNA molecule of a sequence 1 in a sequence table;

A2) the coding sequence is a DNA molecule at the 634-1425 th site of the sequence 1 in the sequence table;

A3) a DNA molecule having 75% or more 75% identity to the nucleotide sequence defined by a1) or a2) and encoding said orotidine-5' -phosphate decarboxylase;

A4) a DNA molecule which hybridizes with the nucleotide sequence defined by A1) or A2) under strict conditions and codes for the orotidine-5' -phosphate decarboxylase.

In the method, the genes in the uracil synthesis pathway in the knockout Hansenula polymorpha starting strain can be M1) and/or M2):

m1) premature termination of the coding for a gene in the uracil synthesis pathway;

m2) inserting a foreign DNA fragment into a gene in the uracil synthesis pathway.

M1) can be realized by inserting adenine nucleotide between the 5 th and 6 th positions of the coding sequence of the orotidine-5 '-phosphate decarboxylase encoding gene of the Hansenula polymorpha starting strain, namely, the sequence of the orotidine-5' -phosphate decarboxylase gene of the Hansenula polymorpha starting strain is changed from the 634 rd and 1425 th positions of the sequence 1 to the 620 nd and 1412 th positions of the sequence 2.

The insertion position of the exogenous DNA fragment is between restriction enzyme recognition sequences of genes in the uracil synthesis pathway. The restriction enzyme may be SacI. The insertion position of the exogenous DNA fragment is between 1075-1076 th position of the sequence 2 or 1088-1089 th position of the sequence 1. Insertion of the exogenous DNA fragment can result in loss of gene function in the uracil synthesis pathway.

In the embodiment of the invention, the sequence of the exogenous DNA fragment is CYC1TT and the upstream and downstream sequences thereof or position 1434-5590 of sequence 5 in the sequence table.

In the above method, the insertion of the foreign DNA fragment may be performed by a restriction enzyme.

In order to solve the technical problems, the invention also provides the uracil auxotroph Hansenula polymorpha prepared by the preparation method of the uracil auxotroph Hansenula polymorpha.

In order to solve the technical problems, the invention also provides a method for expressing the target protein.

The invention provides a method for expressing a target protein, which comprises the following steps: and introducing an expression vector containing a coding gene of a target protein into the uracil auxotroph Hansenula polymorpha to obtain the recombinant Hansenula polymorpha, and realizing the expression of the target protein.

In the above method for expressing a target protein, the expression vector contains the gene in the uracil synthesis pathway.

In one embodiment of the invention, the protein of interest is a glucanase.

In order to solve the technical problems, the invention also provides application of the uracil auxotroph Hansenula polymorpha in protein expression.

In order to solve the technical problems, the invention also provides a kit for expressing the protein.

The kit provided by the invention consists of the uracil auxotroph Hansenula polymorpha and the expression vector.

Hansenula polymorpha (Hansenula polymorpha) HP20110424 also belongs to the protection scope of the invention, and the preservation number of the Hansenula polymorpha (Hansenula polymorpha) HP20110424 in the China general microbiological culture Collection center of the China Committee for culture Collection of microorganisms is CGMCC No. 7.89.

The invention takes Hansenula polymorpha with independent intellectual property rights as a starting strain, constructs a Hansenula polymorpha strain with orotidine-5' -phosphate decarboxylase function deletion and genetic stability through PCR-mediated gene mutation and a mazF-zeoR expression cassette-mediated screening-free marker gene blocking technology, has the auxotrophic phenotype generated by uracil synthesis path blocking, has no obvious difference with other growth characteristics of wild strains, and can be used as a chassis cell for metabolic engineering or synthetic biology modification and a cell factory for efficiently expressing recombinant proteins.

Biological material preservation instructions

Classification nomenclature of biological materials: hansenula polymorpha (Hansenula polymorpha)

Strain number of biological material: HP20110424

Deposit name of biological material: china general microbiological culture Collection center

The preservation unit of the biological material is abbreviated as: CGMCC (China general microbiological culture Collection center)

Deposit unit address of biological material: west road No. 1, north west of the township, beijing, ministry of sciences, china, institute of microbiology, zip code: 100101

Preservation date of biological material: year 2017, month 05 and 02

Accession number to the collection of biological materials: CGMCC No.7.89

Drawings

FIG. 1 shows a comparison of growth spectra of wild type strain Hansenula polymorpha CGMCC7.89 and uracil-deficient strain.

FIG. 2 is a PCR validation of reverse screening for knockout selectable marker strains. Wherein M is a DNA molecular weight standard.

FIG. 3 shows growth curves of uracil auxotroph Hansenula polymorpha HP7.89-ura3 and wild type Hansenula polymorpha CGMCC 7.89.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The plasmid pEBCMZC (Song PP, Liu S, Guo XN, Bai XJ, He XP, Zhang BR. Scarless gene deletion in methyl chiral Hansenula polymorpha as counter-selectable marker. anal Biochem,2015,468:66-74) in the examples described below is publicly available to the applicant for use only in repeating the experiments relevant to the present invention and not for other uses.

The YEp352 vector (Hill JE, Meyers AM, Koerner TJ, et al. A. yeast/E. coli cut vectors with multiple unique restriction sites. Yeast,1993,9: 163-.

The antibiotic Zeocin in the following examples is Invitrogen, Catalogue No. R25001.

Various media used in the examples:

YPD solid Medium: the culture medium consists of solute and solvent; the solute is yeast powder, peptone, glucose and agar powder, and the solvent is water; the concentrations of solutes were as follows: 10g/L yeast powder, 20g/L peptone, 20g/L glucose and 10g/L agar powder, natural pH.

YPM solid Medium: the culture medium consists of solute and solvent; the solutes are yeast powder, peptone, methanol and agar powder, and the solvent is water; the concentrations of solutes were as follows: yeast powder 10g/L, peptone 20g/L, methanol 10ml/L and agar powder 10g/L, natural pH.

SC solid medium: the culture medium consists of solute and solvent; the solute is yeast nitrogen source culture medium (YNB) and glucose, and the solvent is water; the concentrations of solutes were as follows: 6.7g/L YNB, 10g/L glucose and 10g/L agar powder, natural pH.

SCM solid medium: the culture medium consists of solute and solvent; the solute is yeast nitrogen source culture medium (YNB) and methanol, and the solvent is water; the concentrations of solutes were as follows: 6.7g/L YNB, 10ml/L methanol and 10g/L agar powder, natural pH.

SCU solid medium: the culture medium consists of solute and solvent; the solutes are yeast nitrogen source culture medium (YNB), glucose and uracil, and the solvent is water; the concentrations of solutes were as follows: 6.7g/L YNB, 10g/L glucose, 30mg/L uracil and 10g/L agar powder, natural pH.

The liquid culture medium of the above culture medium is prepared from agar powder without adding, and the rest components and concentrations are the same.

Example 1 construction of uracil auxotroph Hansenula polymorpha HP7.89-ura3

In the embodiment, Hansenula polymorpha (Hansenula polymorpha) HP20110424 is used as a starting bacterium to construct uracil auxotroph Hansenula polymorpha, wherein the preservation number of the Hansenula polymorpha (Hansenula polymorpha) HP20110424 in China general microbiological culture Collection center (CGMCC) of the China Commission on culture Collection of microorganisms is CGMCC No.7.89, and the preservation number of the Hansenula polymorpha is CGMCC 7.89.

Construction of recombinant plasmid for destroying orotidine-5' -phosphate decarboxylase encoding gene URA3

Firstly, PCR amplification is carried out by using primers URA3-2K-F and URA3-2K-R and genomic DNA of Hansenula polymorpha CGMCC7.89 as a template to obtain URA3 gene shown as a sequence 1 in a sequence table, wherein the consistency of the URA3 gene and URA3 and flanking sequences thereof of Hansenula polymorpha DL-1 in NCBI is 95.93%. The URA3 gene was ligated to a cloning vector pEASY-blunt plasmid to obtain a recombinant plasmid pEASY-URA 3. Wherein the 634-1425 position of the sequence 1 is the coding sequence of the URA3 gene. The primer sequences are as follows:

URA3-2K-F：5’-AACCAGTGAATGAAAACGAAGAGC-3’；

URA3-2K-R：5’-GGTGAAGAAAACCGGGAAAAGAATT-3’。

(II) carrying out PCR amplification by using primers URA3RH-F1 and URA3RH-R1 and pEASY-URA3 as a template to obtain a DNA fragment URA3-1, carrying out PCR amplification by using primers URA3RH-F2 and URA3RH-R2 and pEASY-URA3 as a template to obtain a DNA fragment URA3-2, and carrying out PCR amplification by using primers URA3RH-F1 and URA3RH-R2 and URA3-1 and URA3-2 as templates to obtain a DNA fragment shown in a sequence 2. The sequence 2 contains a Sac I recognition sequence, and the 1071-1076 th position of the sequence 2 is the Sac I recognition sequence. The DNA fragment is inserted with a base A after the fifth base of the URA3 gene coding sequence, so that TATAA after the 620-nd-622-th ATG of the sequence 2 is mutated into two continuous stop codons TAATAA, and the DNA fragment is named as mURA 3. mURA3 was ligated into the cloning vector pEASY-blunt simple to obtain recombinant plasmid pEASY-mURA 3. The primer sequences used were as follows:

URA3RH-F1：5’-AACGAAGAGCCCAACTACTACAAG-3’；

URA3RH-R1：5’-TCGCCCTTTCTCCATAAGATTTAtTACATGTTGATTATTATTCAGGGAAATGTTG-3’；

URA3RH-F2：5’-CAACATTTCCCTGAATAATAATCAACATGTAaTAAATCTTATGGAGAAAGGGCGA-3’；

URA3RH-R2：5’-GGTGAAGAAAACCGGGAAAAG-3’。

(III) carrying out PCR amplification by using primers Ps-F and Ps-R and using a plasmid pEBCMZC as a template to obtain a DNA fragment C-mazF-zeoR shown in a sequence 3, wherein the 4 th-9 th site and the 3967 th-3975 th site of the sequence 3 are recognition sequences of SacI, the 22 th-392 th site and the 3580 th-3950 th site of the sequence 3 are sequences of CYC1TT, the 432 th-2725 th site of the sequence 3 is a sequence of a methanol-induced toxic gene mazF expression cassette, the 432 th-1959 th site of the sequence 3 is a sequence of a MOX promoter, the 2726 th-3950 th site of the sequence 3 is a sequence of a zeoR expression cassette, and the 3205 th-3579 th site of the sequence 3 is a sequence of zeoR. The primer sequences used were as follows:

Ps-F：5’-AGGGAGCTCATCCAATTGTGACACGTC-3' (recognition sequence for SacI is underlined);

Ps-R：5’-AGGGAGCTCGATGCCAGCAACGCG-3' (recognition sequence for SacI is underlined).

The DNA fragment of C-mazF-zeoR cut by SacI is connected with the vector skeleton of pEASY-mURA3 cut by SacI to obtain a recombinant plasmid pmURA3-CMMZC, wherein the C-mazF-zeoR in the recombinant plasmid is inserted into the SacI recognition sequence inside mURA3, and the recombinant plasmid is provided with zeocin resistance selection marker zeoR and a methanol-induced toxic gene mazF expression cassette.

Second, DNA fragment for destroying URA3 gene

The recombinant plasmid pmURA3-CMMZC is used as a template, and a DNA fragment of 4536bp correct sequence is obtained by PCR amplification of URA3RH-F1 and P37, wherein the DNA fragment comprises the 5 'end sequence of mURA3, CYC1TT, mazF expression cassette and the 5' end sequence of zeoR expression cassette, and is named mUCMZ-1.

PCR amplification was performed using the recombinant plasmid pmURA3-CMMZC as a template and using primer pairs ZEO-F and URA3RH-R2 to obtain a 1515bp DNA fragment of correct sequence containing the 3 'end sequence of the zeoR expression cassette and the 3' end sequence of mURA3, which was designated ZmU-2.

Wherein 259bp of overlapping region exist between the DNA fragments mUCMZ-1 and ZmU-2, the complete zeoR expression cassette can be formed through recombination, so that the transformed strain shows zeocin resistance.

Wherein, the primer P37 and the ZEO-F sequence are both positioned in the gene sequence of zeoR, and the sequences are as follows:

P37：5’-CGTCCCGGAAGTTCGTGG-3’；

ZEO-F：5’-AAGTTGACCAGTGCCGTTCC-3’。

thirdly, yeast transformation and recombinant strain screening and identification

Firstly, DNA fragments mUCMZ-1 and ZmU-2 are mixed in equal molar concentration, 10 mu g of the mixed DNA fragments are taken to be electrically transformed into Hansenula polymorpha CGMCC7.89, the transformed bacterial liquid is coated on YPD + zeocin solid culture medium, and the mixture is kept still for 3-5 days at 37 ℃. The single colony grown was inoculated in 1mL of sterile water, allowed to stand at room temperature for 2 hours, spotted on SC solid medium and YPD solid medium, respectively, and subjected to standing culture at 37 ℃ for 48 hours to obtain a transformant strain which grew normally on the YPD medium but did not grow on the SC medium, i.e., an auxotrophic strain. The YPD + zeocin solid medium was a zeocin concentration of 200. mu.g/mL obtained by adding zeocin to the YPD medium.

And (II) respectively inoculating the auxotrophic strain and the wild strain Hansenula polymorpha CGMCC7.89 obtained in the step (I) into 1mL of sterile water, standing at room temperature for 2h, then respectively spotting on SC, SCU, YPD and YPD + zeocin solid culture media, and standing and culturing at 37 ℃ for 48 h. The results showed that the wild strain grew normally on SC, SCU, YPD medium, but not on YPD + zeocin medium plates; the auxotrophic strain obtained in step (one) did not grow on SC medium, but grew normally on SCU, YPD and YPD + zeocin medium. Indicating that the auxotrophic strain obtained in the step (one) is a uracil synthesis auxotrophic strain and carries a zeocin resistance selection marker.

And (3) strain identification:

primers URA3UP-F and URA3DOWN-R were designed and synthesized based on the upstream and downstream flanking sequences of Hansenula polymorpha URA3, wherein the sequences of primers URA3UP-F and URA3DOWN-R were located on the upstream and downstream flanking sequences of URA3, respectively, and the sequences of the primers were as follows:

URA3UP-F：5’-AGTCAGACGAGGGTAAGGAA-3’；

URA3DOWN-R：5’-CGATGATCCTAGCCCTGTCG-3’。

PCR amplification is respectively carried out on Hansenula polymorpha CGMCC7.89 and the genome DNA of the auxotroph strain obtained in the step (I) by utilizing primer pairs URA3UP-F and URA3DOWN-R, a 2719bp DNA fragment is amplified from the Hansenula polymorpha CGMCC7.89, the sequence of the DNA fragment is shown as sequence 4 in a sequence table by sequencing, and the sequence of the 544-2385 bit of the sequence 4 is completely consistent with the sequence of the URA3 gene shown as the sequence 1; and a 6683bp DNA fragment is amplified from the genome of the auxotrophic strain obtained in the step (one), and the sequence is shown as the sequence 5 in the sequence table by the sequencing result, the sequence 558, 1633 bit sequence of the sequence 5 is completely consistent with the sequence 1-1076 bit sequence of the sequence 2, the sequence 1634, 5590 bit sequence of the sequence 5 is a C-mazF-zeo sequence, and the sequence 5597, 6349 bit sequence of the sequence 5 is completely consistent with the sequence 1077, 1829 bit sequence of the sequence 2. Therefore, the sequence of the auxotrophic strain obtained in step (one) corresponding to the URA3 gene of Hansenula polymorpha CGMCC7.89 is a sequence obtained by inserting C-mazF-zeoR between the SacI recognition sequences of mURA 3. Indicating that the auxotrophic strain obtained in step (one) has C-mazF-zeoR inserted into URA3 site in the genome and further contains a partial fragment of mURA3 shown in 620-628 of SEQ ID NO. 2, so that the cell cannot synthesize orotidine-5' -phosphate decarboxylase and the cell produces the uracil auxotrophic phenotype. The auxotrophic strain obtained in step (one) was named HP-ura3:: MZ.

Fourthly, obtaining uracil-deficient strain HP7.89-ura3 by reverse screening and knockout screening marker

And (I) inoculating the uracil auxotrophic strain HP-ura3 of the third step into 2ml YPD liquid culture medium, culturing at 37 ℃ and 200rpm for 18h, centrifuging at 5000rpm for 5min to collect cells, washing once with sterile water, adding 2ml of sterile water, standing at room temperature for 2h, coating 100 mu L of bacterial suspension on a YPM solid culture medium, and standing at 37 ℃ for culturing until a single colony grows out.

Four single colonies (respectively named as delta U1, delta U2, delta U3 and delta U4) were randomly picked and inoculated in 1mL of sterile water, and after standing for 2 hours at room temperature, the colonies were respectively spotted on SC, SCU, YPD and YPD + zeocin solid culture media, and simultaneously, hansenula polymorpha CGMCC7.89 as a wild strain and HP-ura3 as a uracil auxotrophic strain were used as controls, and the colonies were subjected to standing culture for 48 hours at 37 ℃.

As shown in FIG. 1, all strains grew normally on YPD medium, but only strain HP-ura3:: MZ grew on YPD + zeocin medium; the wild type strain grew normally on both SC and SCU media, but strain HP-ura3:: MZ and single colonies derived from YPM plates (. DELTA.U 1,. DELTA.U 2,. DELTA.U 3 and. DELTA.U 4) did not grow on SC media, and grew normally on SCU media supplemented with uracil. It was shown that, in HP-ura3, MZ was cultured in YPM medium and only yeast cells that had knocked out the zeocin resistance selection marker and mazF expression cassette by CYC1 TT-mediated homologous recombination, developed a lethal effect on the cells and exhibited uracil auxotrophy, due to the expression of the methanol-induced toxic protein MazF.

Secondly, according to the nucleotide sequence of URA3 site of Hansenula polymorpha, the following primers are designed and synthesized:

URA3-mF：5’-CAGGCCGCAGAAGAAAGTAC-3’；

URA3HP-R：5’-TTAAGCAATGCGCCGCTTGTAAG-3’。

the strains were verified by extracting genomic DNAs of Δ U1, Δ U2, Δ U3 and Δ U4, respectively, and PCR-amplifying the DNAs as templates using primers URA3-mF and URA3 HP-R. Meanwhile, a wild strain CGMCC7.89 and a uracil-deficient strain HP-ura3 are respectively used as a control, and MZ genome is used as a control.

The results of the electrophoretic detection of the PCR amplification products are shown in FIG. 2, and the primers URA3-mF and URA3HP-R are used for amplifying about 800bp DNA fragments from genomes of the strains delta U1, delta U2, delta U3 and delta U4 after reverse screening, about 400bp DNA fragments from the genome of the wild strain CGMCC7.89 and about 4.4kb DNA fragments from the genome of the strain HP-URA 3-MZ. The PCR products were subjected to sequence analysis and alignment, and the results showed that the PCR products derived from strains Δ U1, Δ U2, Δ U3 and Δ U4 had completely identical nucleotide sequences, and they had a deletion of the mazF expression cassette and the zeocin resistance expression cassette compared to the PCR product of the wild-type strain CGMCC7.89, with a 405bp CYC1TT sequence inserted after the 57 th nucleotide, and compared to the PCR product of strain HP-ura3:: MZ. The above results show that the mutant strain with inserted CYC1TT sequence in the target gene URA3 is obtained by reverse screening, and the screening marker-free destruction of URA3 is realized, so that the yeast cell can generate uracil auxotrophic phenotype. Uracil auxotrophic strains obtained by reverse screening (i.e., Δ U1, Δ U2, Δ U3, and Δ U4) were designated HP7.89-ura 3.

Comparing the coding sequences of the wild strain CGMCC7.89 and the uracil auxotroph strain HP7.89-URA3 URA3 site:

designing and synthesizing a primer URA3ORF according to a sequence about 200bp upstream of a URA3 initiation codon of a wild strain CGMCC 7.89: 5'-GTCCACCAAACTGGTGTAG-3' are provided.

Wild strain CGMCC7.89 and uracil auxotrophic strain HP7.89-URA3 genome DNA are respectively used as templates, and primers URA3ORF and URA3HP-R are used for PCR amplification.

A991 bp DNA fragment (the sequence of the DNA fragment is shown as the sequence 6 in the sequence table) is amplified from the genome of the wild strain by using the primers URA3ORF and URA3HP-R, and a 1397bp DNA fragment is amplified from the genome of HP7.89-URA3 (the sequence of the DNA fragment is shown as the sequence 7 in the sequence table). The result shows that compared with the coding sequence of the wild strain URA3, the TATAA of the URA3 coding sequence of HP7.89-URA3 after the ATG at the 620-622 site of the sequence 2 is mutated into two continuous stop codons TAATAA; and CYC1TT (669-position 1039 of sequence 7) and 12bp and 22bp sequences respectively upstream and downstream thereof are inserted at 454bp after the 620-position 622-position ATG of the sequence 2.

Fifthly, genetic stability analysis of uracil-deficient strain HP7.89-ura3

The uracil auxotrophic Hansenula polymorpha strain HP7.89-ura3 was inoculated into 2ml YPD liquid medium, shake-cultured at 37 ℃ and 200rpm for 20 hours, and inoculated into fresh YPD medium at 10% inoculum size, and subcultured continuously for 10 times as above. 200. mu.L of the culture medium was taken at passages 1, 5, and 10, respectively, and diluted with a 10-fold gradient.

Respectively coating 100 mu L of undiluted bacterial liquid and different dilutions of bacterial liquid on SC, SCU and YPD medium plates, standing and culturing at 37 ℃ for 48h, and recording the growth conditions of colonies on different plates.

As a result, it was found that no colonies grew on all SC plates, while colonies grew normally on SCU and YPD plates, the number of colonies decreased with increasing dilution, and there was no significant difference in the number of colonies on SCU and YPD plates under the same treatment conditions. It was demonstrated that the uracil auxotrophic Hansenula polymorpha strain HP7.89-ura3 of the present invention is genetically stable.

Sixthly, comparison of growth characteristics of wild-type and uracil-deficient Strain HP7.89-ura3

Respectively inoculating wild type Hansenula polymorpha CGMCC7.89 and uracil auxotrophic Hansenula polymorpha HP7.89-ura3 into 2ml of YPD liquid culture medium, carrying out shaking culture at 37 ℃ and 200rpm for 16h, transferring the strain with the volume ratio of 10% into 10ml of YPD liquid culture medium, and carrying out shaking culture at 37 ℃ for 16 h; centrifugally collecting thallus cells, washing the cells twice by using sterile water, and suspending thallus in 5ml of sterile water to prepare a thallus suspension; transferring the bacterial suspension into SCU, YPD and YPM liquid culture medium respectively to make the culture medium start OD₆₀₀About 0.15, 37 ℃ and shaking culture at 200rpm for 36h, during which 2ml of sample was taken every 6h for determining OD₆₀₀And making a growth curve. As shown in FIG. 3, there was no significant difference in growth characteristics between the uracil auxotroph Hansenula polymorpha (Hansenula polymorpha) HP7.89-ura3 and the wild type Hansenula polymorpha CGMCC7.89 constructed in the present invention.

Example 2 expression of dextranase in Hansenula polymorpha (Hansenula polymorpha) HP7.89-ura3

First, construction of expression vector

The DNA fragment between EcoRI and XbaI recognition sequences of pMOXZ alpha-A (patent number: ZL200810101801.1) vector is replaced by a Sdada lipid yeast glucanase coding gene (LSD1 gene, the sequence of which is 1798-3624 site of the sequence 8) to obtain a recombinant vector, and the recombinant vector is named as pMOXZ alpha-LSD 1, and pMOXZ alpha-LSD 1 can express the Sdada lipid yeast glucanase coded by LSD1 gene shown in 1798-3624 site of the sequence 8.

The recombinant vector pMOXZ alpha-LSD 1 is taken as a template, primers MOXp-F and AOX1TT-R are utilized to carry out PCR amplification, a PCR product with correct sequence is named as DNA fragment 1, the sequence of the DNA fragment 1 is sequence 8, the 1 st to 1511 st sites of the sequence 8 are a methanol oxidase gene promoter MOXp sequence, the 1525 th and 1791 th sites of the sequence 8 are alpha signal peptide sequences, the 1798 th and 3624 th sites of the sequence 8 are LSD1 gene coding sequences, and the 3695 th and 4033 th sites of the sequence 8 are alcohol oxidase gene terminator AOX1TT sequences.

The primer sequences used were as follows:

MOXp-F：5'-TCTTCGACGCGGAGAACGATCTCCT-3'，

AOX1TT-R：5'-TCCGCACAAACGAAGGTCTC-3'。

the DNA fragment 1 was inserted into the SmaI site of YEp352 vector to obtain a recombinant vector, which was designated pMOXU α -LSD 1.

Second, yeast transformation and recombinant strain screening

The plasmid pMOXU alpha-LSD 1 is cut by restriction enzyme SacII to obtain a linearized plasmid pMOXU alpha-LSD 1; the linearized plasmid pMOXU α -LSD1 was transformed into uracil auxotrophic Hansenula polymorpha (Hansenula polymorpha) HP7.89-ura3 (host strain HP7.89-ura3) of example 1 by an electrical transformation method (Bio-Rad Gene-Pulser instrument, 1.5kV, 50 μ F, 200 Ω, 3mSec), the transformed bacterial liquid was spread on SC medium plates, and the plates were incubated at 37 ℃ for 3-5d to form single colonies.

Transferring single colony on SC plate into 1ml sterile water, standing at room temperature for 2-4h, inoculating on SC, SCU and YPD plate, culturing at 37 deg.C for 48 hr, and using host bacterium HP7.89-ura3 as control. As a result, the host bacterium HP7.89-URA3 can not grow on an SC plate, but only on an SCU plate and a YPD plate, while a single colony of the transformed pMOXU alpha-LSD 1 can normally grow on each culture medium plate, which shows that the linearized plasmid pMOXU alpha-LSD 1 is successfully transformed into the host bacterium HP7.89-URA3, the Saccharomyces cerevisiae URA3 gene carried by the linearized plasmid complements the uracil synthesis defect of the host bacterium, and a recombinant bacterium containing the linearized plasmid pMOXU alpha-LSD 1 is named as HP-LSD 1.

Analysis of the Activity of Tri-and dextranase

Respectively inoculating host bacteria HP7.89-ura3 and randomly picked 5 recombinant bacteria HP-LSD1 single colonies (HP-LSD 1-1-HP-LSD 1-5) into 5ml YPD culture medium, culturing at 37 ℃ and 200rpm for 20h, centrifugally collecting cells, washing twice with sterile water, then re-suspending the cells in 10ml YPM culture medium, inducing and culturing at 37 ℃ and 200rpm for 72h, and supplementing methanol every 12h until the volume percentage concentration of methanol is 1%. The glucanase activity in the fermentation broth and in the yeast cells was determined by the 3, 5-dinitrosalicylic acid method every 24h samples (Kang HK, Kim SH, Park JY, Jin XJ, Oh DK, Kang SS, Kim D. cloning catalysis of a protease gene from Lipomyces starkeyi and itexpression in Saccharomyces cerevisiae. Yeast,2005,22: 1239-. The total glucanase activity is the sum of the intracellular enzyme activity and the enzyme activity in the fermentation broth. The specific method comprises the following steps:

preparing a solution: accurately weighing 15mg of glucose, and dissolving the glucose in distilled water to obtain a glucose stock solution with the final concentration of 1 mg/ml; accurately weighing 7.16g of disodium hydrogen phosphate, dissolving in distilled water, adjusting pH to 5.5 with citric acid, and diluting with distilled water to 1000ml to obtain citric acid-disodium hydrogen phosphate buffer solution (50mM, pH 5.5); accurately weighing 2g of glucan T-70, dissolving in citric acid-disodium hydrogen phosphate buffer solution, and fixing the volume to 100 ml; accurately weighing 8g of sodium hydroxide, dissolving the sodium hydroxide in distilled water, and fixing the volume to 100ml to ensure that the final concentration is 2 mol/L; accurately weighing 1g of 3, 5-dinitrosalicylic acid (DNS), dissolving in 20ml of sodium hydroxide solution and 50ml of distilled water, adding 30g of potassium sodium tartrate tetrahydrate, dissolving, adding water to a constant volume of 100ml to obtain DNS solution, and storing in a lightproof closed container for later use.

Glucose standard curve: diluting glucose solution with concentration of 1mg/ml to obtain glucose solutions with concentrations of 0, 0.1, 0.3, 0.5, 0.7, 0.9 and 1.0mg/ml, respectively, adding 1ml of the above glucose solutions into test tubes, respectively, adding 1ml of DNS solution, mixing, boiling in boiling water bath for 5min, cooling to room temperature, adding distilled water to desired volume of 5ml, and measuring light absorption value (OD) at 540nm with glucose-free reaction solution as control₅₄₀) On the abscissa, OD₅₄₀Drawing a standard curve as a vertical coordinate to obtain the glucose concentration and OD₅₄₀Functional relationship between: glucose concentration (mg/ml) ═ OD₅₄₀+0.0317)/1.4602。

And (3) determining the activity of the glucanase in the fermentation liquor: taking 5ml of culture solution at different time points, centrifuging at 6000rpm for 5min, and respectively collecting supernatant and yeast cells; taking 0.5ml of supernatant liquid in a control test tube and a reaction tube respectively, wherein 0.5ml of 2% dextran solution preheated at 37 ℃ is added into the reaction tube; keeping the temperature of a control tube and a reaction tube at 37 ℃ for 30min, then respectively adding 1ml of DNS solution, uniformly mixing, and adding 0.5ml of 2% dextran solution into the control tube; boiling in boiling water bath for 5 min; after cooling to room temperature, adding distilled water into the control tube and the reaction tube respectively to reach a constant volume of 5 ml; to control withTube zeroing and determining reaction tube OD₅₄₀And calculating the concentration of reducing sugar in the reaction solution according to a standard curve function formula.

Intracellular glucanase activity assay: suspending the collected yeast cells with 5ml of distilled water, centrifuging at 6000rpm for 5min, resuspending the yeast cells in a citric acid-disodium hydrogen phosphate buffer solution in a proportion of 10ml of the buffer solution per gram of wet cells, and freezing at-80 ℃ overnight; after natural melting, taking 0.5ml of bacterial suspension, putting the bacterial suspension into a 1.5ml centrifuge tube, simultaneously adding 25mg of glass beads with the diameter of 0.45mm, carrying out vortex oscillation for 4 times, carrying out oscillation for 1min each time, and carrying out ice bath for 1 min; centrifuging at 4 deg.C and 6000rpm for 10min, and collecting supernatant; the dextranase activity in the supernatant was determined as described above.

The enzyme activity is defined as: under the above reaction conditions, the amount of enzyme required to catalyze hydrolysis of glucan to produce reducing sugar corresponding to 1. mu. mol of glucose per minute was one enzyme activity unit (IU).

As shown in Table 1, no glucanase activity was detected in the fermentation broth of the host strain, but glucanase activity was detected in the fermentation broth of the recombinant strain HP-LSD 1. After induction culture for 72h, the activity of the total glucanase reaches up to 2050IU/L, wherein the activity of the glucanase in the fermentation liquor is 720 IU/L.

The above results indicate that the dextranase is functionally expressed in the uracil auxotroph Hansenula polymorpha HP7.89-ura3 of the present invention.

TABLE 1 glucanase activity in fermentation broths of different strains and total enzyme activity at the end of fermentation

<110> institute of microbiology, college of sciences of China, university of college of sciences of China

<120> uracil auxotroph Hansenula polymorpha, preparation method and application thereof

<160>8

<170>PatentIn version 3.5

<210>1

<211>1842

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>1

aaccagtgaa tgaaaacgaa gagcccaact actacaagct aatacggcat cccgtggaca 60

ttaagagttt gggtaaagct attaggacgg gtgaaataaa gtcattcgac gagttggaat 120

ttgagcttca actgatgttc agcaacgcaa ttatgtacaa cgatatgaat cagacagaaa 180

cttacaaatg gacgattgaa atgatggaag aaacgcaaaa cttgttgagc ctattccggg 240

aatcatccag caattaaagc tcattaattg ccgcctctca tctggttcat caacatctgg 300

ttctgttcct ggaatcttaa accaactctt tcggagtgct tgaggaactt ttcagcgcac 360

ttgttcaaac atgtttcttc tctagagcta agtttgttgg aggtgaagtc gttgacgcaa 420

tcattaaaac atctgtccac caaactggtg tagagctgca atgttagttt tcagaaggcg 480

ttcacttact ctcatgaagt cattcatttg cttctgctcc acaattttct ggaattcttg 540

ctgttcttta tagttgagtt gatccatggt gtatcaaaaa taaactaatg aattatcgaa 600

aaattttcaa catttccctg aataataatc aacatgtata aatcttatgg agaaagggcg 660

aagtctcacc catctaaggt cgccagcaga ctacttaatt tgatggaatc caagcaaaca 720

aacctctgcg cttctgtgga tgtgactaaa actcaggaat tattggagct tcttgataaa 780

ctgggccctt acatctgcct tgtcaaaact catattgaca tagtagagga cttctcttat 840

gaacacacca ttttaccatt acaaggactt gcaaagaaac acaacttcat gatttttgaa 900

gacagaaagt ttgctgatat aggaaacaca gtcaaactac agtataaggg aggaatttat 960

cgaacatcca agtgggccga tatcacgaat gcacacggag tgactggcgc aggaattgtt 1020

gaaggtctta aacaggccgc agaagaaagt acagatgagc cacgtgggct tttgatgctt 1080

gctgagctct cttcaaaggg atcattagct accggtgagt atactcaaaa aactgtggaa 1140

atagcgaaaa gcgataaaga atttgtcatt ggatttattg cacagagaga catgggaggt 1200

cgtgaggaag gctttgactg gctgatcatg actccaggag ttggtttaga tgataaaggt 1260

gattctctgg gccaacagta cagaactgtt gatgaagtga tgcaaacagg aaccgatgtc 1320

attatcgttg gaagaggttt attcggaaaa ggaagagatc ctgaagtgga agggaagaga 1380

tacagaaatg ctgggtggga agcttacaag cggcgcattg cttaacggct ttcagttcta 1440

tatacatcgt caaaattgat tttcgctaaa atgctgacgg gatatttcga atacgaaaag 1500

cccaatagaa gtcgcgggaa tactagtgaa ggacgatctg aaaaagcctc tatagcagaa 1560

gccaaagagg gagaggtgag attttcgcca tcgttgtaga ataatatcaa atgtctcaat 1620

gtaagaatta tagtagagtt tgaagaagcg acgccgatcc agttgatgtg cttcgttgta 1680

gagatctaga gattcgagtc tagtcaggtg gaccttttga attttattga gtggatattg 1740

gattgcaagc agtgtagttg cggcggaagc tccagcaaga aggataaacg tcaaattcaa 1800

agctttgaaa aatcttgaat tcttttcccg gttttcttca cc 1842

<210>2

<211>1829

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>2

aacgaagagc ccaactacta caagctaata cggcatcccg tggacattaa gagtttgggt 60

aaagctatta ggacgggtga aataaagtca ttcgacgagt tggaatttga gcttcaactg 120

atgttcagca acgcaattat gtacaacgat atgaatcaga cagaaactta caaatggacg 180

attgaaatga tggaagaaac gcaaaacttg ttgagcctat tccgggaatc atccagcaat 240

taaagctcat taattgccgc ctctcatctg gttcatcaac atctggttct gttcctggaa 300

tcttaaacca actctttcgg agtgcttgag gaacttttca gcgcacttgt tcaaacatgt 360

ttcttctcta gagctaagtt tgttggaggt gaagtcgttg acgcaatcat taaaacatct 420

gtccaccaaa ctggtgtaga gctgcaatgt tagttttcag aaggcgttca cttactctca 480

tgaagtcatt catttgcttc tgctccacaa ttttctggaa ttcttgctgt tctttatagt 540

tgagttgatc catggtgtat caaaaataaa ctaatgaatt atcgaaaaat tttcaacatt 600

tccctgaata ataatcaaca tgtaataaat cttatggaga aagggcgaag tctcacccat 660

ctaaggtcgc cagcagacta cttaatttga tggaatccaa gcaaacaaac ctctgcgctt 720

ctgtggatgt gactaaaact caggaattat tggagcttct tgataaactg ggcccttaca 780

tctgccttgt caaaactcat attgacatag tagaggactt ctcttatgaa cacaccattt 840

taccattaca aggacttgca aagaaacaca acttcatgat ttttgaagac agaaagtttg 900

ctgatatagg aaacacagtc aaactacagt ataagggagg aatttatcga acatccaagt 960

gggccgatat cacgaatgca cacggagtga ctggcgcagg aattgttgaa ggtcttaaac 1020

aggccgcaga agaaagtaca gatgagccac gtgggctttt gatgcttgct gagctctctt 1080

caaagggatc attagctacc ggtgagtata ctcaaaaaac tgtggaaata gcgaaaagcg 1140

ataaagaatt tgtcattgga tttattgcac agagagacat gggaggtcgt gaggaaggct 1200

ttgactggct gatcatgact ccaggagttg gtttagatga taaaggtgat tctctgggcc 1260

aacagtacag aactgttgat gaagtgatgc aaacaggaac cgatgtcatt atcgttggaa 1320

gaggtttatt cggaaaagga agagatcctg aagtggaagg gaagagatac agaaatgctg 1380

ggtgggaagc ttacaagcgg cgcattgctt aacggctttc agttctatat acatcgtcaa 1440

aattgatttt cgctaaaatg ctgacgggat atttcgaata cgaaaagccc aatagaagtc 1500

gcgggaatac tagtgaagga cgatctgaaa aagcctctat agcagaagcc aaagagggag 1560

aggtgagatt ttcgccatcg ttgtagaata atatcaaatg tctcaatgta agaattatag 1620

tagagtttga agaagcgacg ccgatccagt tgatgtgctt cgttgtagag atctagagat 1680

tcgagtctag tcaggtggac cttttgaatt ttattgagtg gatattggat tgcaagcagt 1740

gtagttgcgg cggaagctcc agcaagaagg ataaacgtca aattcaaagc tttgaaaaat 1800

cttgaattct tttcccggtt ttcttcacc 1829

<210>3

<211>3975

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>3

agggagctca tccaattgtg acacgtccga cggcggccca cgggtcccag gcctcggaga 60

tccgtccccc ttttcctttg tcgatatcat gtaattagtt atgtcacgct tacattcacg 120

ccctcccccc acatccgctc taaccgaaaa ggaaggagtt agacaacctg aagtctaggt 180

ccctatttat ttttttatag ttatgttagt attaagaacg ttatttatat ttcaaatttt 240

tctttttttt ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga 300

gaaggttttg ggacgctcga aggctttaat ttgcaagctg gagaccaaca tgtgagcaaa 360

aggccagcaa aaggccagga accgtaaaaa ggaagggcaa ttctgcagat atccatcaca 420

ctggcggccg ctcatgcatg agatcagatc ttcgacgcgg agaacgatct cctcgagctg 480

ctcgcggatc agcttgtggc ccggtaatgg aaccaggccg acgcgacgct ccttgcggac 540

cacggtggct ggcgagccca gtttgtgaac gaggtcgttt agaacgtcct gcgcaaagtc 600

cagtgtcaga tgaatgtcct cctcggacca attcagcatg ttctcgagca gccatctgtc 660

tttggagtag aagcgtaatc tctgctcctc gttactgtac cggaagaggt agtttgcctc 720

gccgcccata atgaacaggt tctctttctg gtggcctgtg agcagcgggg acgtctggac 780

ggcgtcgatg aggcccttga ggcgctcgta gtacttgttc cgtcgctgta gccggccgcg 840

gtgacgatac ccacatagag gtccttggcc attagtttga tgaggtgggg caggatgggc 900

gactcggcat cgaaattttt gccgtcgtcg tacagtgtga tgtcaccatc gaatgtaatg 960

agctgcagct tgcgatctcg gatggttttg gaatggaaga accgcgacat ctccaacagc 1020

tgggccgtgt tgagaatgag ccggacgtcg ttgaacgagg gggccacaag ccggcgtttg 1080

ctgatggcgc ggcgctcgtc ctcgatgtag aaggcctttt ccagaggcag tctcgtgaag 1140

aagctgccaa cgctcggaac cagctgcacg agccgagaca attcgggggt gccggctttg 1200

gtcatttcaa tgttgtcgtc gatgaggagt tcgaggtcgt ggaagatttc cgcgtagcgg 1260

cgttttgcct cagagtttac catgaggtcg tccactgcag agatgccgtt gctcttcacc 1320

gcgtacagga cgaacggcgt ggccagcagg cccttgatcc attctatgag gccatctcga 1380

cggtgttcct tgagtgcgta ctccactctg tagcgactgg acatctcgag actgggcttg 1440

ctgtgctgga tgcaccaatt aattgttgcc gcatgcatcc ttgcaccgca agtttttaaa 1500

acccactcgc tttagccgtc gcgtaaaact tgtgaatctg gcaactgagg gggttctgca 1560

gccgcaaccg aacttttcgc ttcgaggacg cagctggatg gtgtcatgtg aggctctgtt 1620

tgctggggta gcctacaacg tgaccttgcc taaccggacg gcgctaccca ctgctgtctg 1680

tgcctgctac cagaaaatca ccagagcagc agagggccga tgtggcaact ggtggggtgt 1740

cggacaggct gtttctccac agtgcaaatg cgggtgaacc ggccagaaag taaattctta 1800

tgctaccgtg cagcgactcc gacatcccca gtttttgccc tacttgatca cagatggggt 1860

cagcgctgcc gctaagtgta cccaaccgtc cccacacggt ccatctataa atactgctgc 1920

cagtgcacgg tggtgacatc aatctaaagt acaaaaacaa agcttaggaa gtctggtaat 1980

ggtaagccga tacgtacccg atatgggcga tctgatttgg gttgattttg acccgacaaa 2040

aggtagcgag caagctggac atcgtccagc tgttgtcctg agtcctttca tgtacaacaa 2100

caaaacaggt atgtgtctgt gtgttccttg tacaacgcaa tcaaaaggat atccgttcga 2160

agttgtttta tccggtcagg aacgtgatgg cgtagcgtta gctgatcagg taaaaagtat 2220

cgcctggcgg gcaagaggag caacgaagaa aggaacagtt gccccagagg aattacaact 2280

cattaaagcc aaaattaacg tactgattgg gtagtctaga acaaaaactc atctcagaag 2340

aggatctgaa tagcgccgtc gaccatcatc atcatcatca ttgagtttta gccttagaca 2400

tgactgttcc tcagttcaag ttgggcactt acgagaagac cggtcttgct agattctaat 2460

caagaggatg tcagaatgcc atttgcctga gagatgcagg cttcattttt gatacttttt 2520

tatttgtaac ctatatagta taggattttt tttgtcattt tgtttcttct cgtacgagct 2580

tgctcctgat cagcctatct cgcagctgat gaatatcttg tggtaggggt ttgggaaaat 2640

cattcgagtt tgatgttttt cttggtattt cccactcctc ttcagagtac agaagattaa 2700

gtgagacctt cgtttgtgcg gatcccccac acaccatagc ttcaaaatgt ttctactcct 2760

tttttactct tccagatttt ctcggactcc gcgcatcgcc gtaccacttc aaaacaccca 2820

agcacagcat actaaatttt ccctctttct tcctctaggg tgtcgttaat tacccgtact 2880

aaaggtttgg aaaagaaaaa agagaccgcc tcgtttcttt ttcttcgtcg aaaaaggcaa 2940

taaaaatttt tatcacgttt ctttttcttg aaattttttt ttttagtttt tttctctttc 3000

agtgacctcc attgatattt aagttaataa acggtcttca atttctcaag tttcagtttc 3060

atttttcttg ttctattaca acttttttta cttcttgttc attagaaaga aagcatagca 3120

atctaatcta agggcggtgt tgacaattaa tcatcggcat agtatatcgg catagtataa 3180

tacgacaagg tgaggaacta aaccatggcc aagttgacca gtgccgttcc ggtgctcacc 3240

gcgcgcgacg tcgccggagc ggtcgagttc tggaccgacc ggctcgggtt ctcccgggac 3300

ttcgtggagg acgacttcgc cggtgtggtc cgggacgacg tgaccctgtt catcagcgcg 3360

gtccaggacc aggtggtgcc ggacaacacc ctggcctggg tgtgggtgcg cggcctggac 3420

gagctgtacg ccgagtggtc ggaggtcgtg tccacgaact tccgggacgc ctccgggccg 3480

gccatgaccg agatcggcga gcagccgtgg gggcgggagt tcgccctgcg cgacccggcc 3540

ggcaactgcg tgcacttcgt ggccgaggag caggactgac acgtccgacg gcggcccacg 3600

ggtcccaggc ctcggagatc cgtccccctt ttcctttgtc gatatcatgt aattagttat 3660

gtcacgctta cattcacgcc ctccccccac atccgctcta accgaaaagg aaggagttag 3720

acaacctgaa gtctaggtcc ctatttattt ttttatagtt atgttagtat taagaacgtt 3780

atttatattt caaatttttc ttttttttct gtacagacgc gtgtacgcat gtaacattat 3840

actgaaaacc ttgcttgaga aggttttggg acgctcgaag gctttaattt gcaagctgga 3900

gaccaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct 3960

ggcatcgagc tccct 3975

<210>4

<211>2719

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>4

agtcagacga gggtaaggaa attacaaagg ttcttcaaga tctctcggat aaccagaaga 60

aagacggcca gattgtttta gatgaagaac agttggagaa aactttggaa atggccaaag 120

gtgacgcaca agaacctgaa gagaacgtgg acgataatga cgcagacaaa gagatcgatg 180

aaggtgtcga gcccgaggca gaatcatcgg ctcaatctca accggtcact gctttggaaa 240

aaagcagaac agagccatcg gaaacgcatt ccgaacctca agaaggccca gcgccaagct 300

ccgagttgaa tgtagaatca caaccccaaa cgaaattgga atccaagtcg gcttctaaag 360

aaataccatc gccaactcca gaacctgcta ccccatccac gccagcaagt ggagatgaag 420

aacgtgggag caagcgacgc ggatccgaaa gcgtcccccc tggttgtact aagcgcttta 480

atgctctttc tgcacaactt ctcacacaga tatcatccaa ccggtttgca tccatgttca 540

tgcaaccagt gaatgaaaac gaagagccca actactacaa gctaatacgg catcccgtgg 600

acattaagag tttgggtaaa gctattagga cgggtgaaat aaagtcattc gacgagttgg 660

aatttgagct tcaactgatg ttcagcaacg caattatgta caacgatatg aatcagacag 720

aaacttacaa atggacgatt gaaatgatgg aagaaacgca aaacttgttg agcctattcc 780

gggaatcatc cagcaattaa agctcattaa ttgccgcctc tcatctggtt catcaacatc 840

tggttctgtt cctggaatct taaaccaact ctttcggagt gcttgaggaa cttttcagcg 900

cacttgttca aacatgtttc ttctctagag ctaagtttgt tggaggtgaa gtcgttgacg 960

caatcattaa aacatctgtc caccaaactg gtgtagagct gcaatgttag ttttcagaag 1020

gcgttcactt actctcatga agtcattcat ttgcttctgc tccacaattt tctggaattc 1080

ttgctgttct ttatagttga gttgatccat ggtgtatcaa aaataaacta atgaattatc 1140

gaaaaatttt caacatttcc ctgaataata atcaacatgt ataaatctta tggagaaagg 1200

gcgaagtctc acccatctaa ggtcgccagc agactactta atttgatgga atccaagcaa 1260

acaaacctct gcgcttctgt ggatgtgact aaaactcagg aattattgga gcttcttgat 1320

aaactgggcc cttacatctg ccttgtcaaa actcatattg acatagtaga ggacttctct 1380

tatgaacaca ccattttacc attacaagga cttgcaaaga aacacaactt catgattttt 1440

gaagacagaa agtttgctga tataggaaac acagtcaaac tacagtataa gggaggaatt 1500

tatcgaacat ccaagtgggc cgatatcacg aatgcacacg gagtgactgg cgcaggaatt 1560

gttgaaggtc ttaaacaggc cgcagaagaa agtacagatg agccacgtgg gcttttgatg 1620

cttgctgagc tctcttcaaa gggatcatta gctaccggtg agtatactca aaaaactgtg 1680

gaaatagcga aaagcgataa agaatttgtc attggattta ttgcacagag agacatggga 1740

ggtcgtgagg aaggctttga ctggctgatc atgactccag gagttggttt agatgataaa 1800

ggtgattctc tgggccaaca gtacagaact gttgatgaag tgatgcaaac aggaaccgat 1860

gtcattatcg ttggaagagg tttattcgga aaaggaagag atcctgaagt ggaagggaag 1920

agatacagaa atgctgggtg ggaagcttac aagcggcgca ttgcttaacg gctttcagtt 1980

ctatatacat cgtcaaaatt gattttcgct aaaatgctgacgggatattt cgaatacgaa 2040

aagcccaata gaagtcgcgg gaatactagt gaaggacgat ctgaaaaagc ctctatagca 2100

gaagccaaag agggagaggt gagattttcg ccatcgttgt agaataatat caaatgtctc 2160

aatgtaagaa ttatagtaga gtttgaagaa gcgacgccga tccagttgat gtgcttcgtt 2220

gtagagatct agagattcga gtctagtcag gtggaccttt tgaattttat tgagtggata 2280

ttggattgca agcagtgtag ttgcggcgga agctccagca agaaggataa acgtcaaatt 2340

caaagctttg aaaaatcttg aattcttttc ccggttttct tcaccatgaa aaagccttga 2400

gcgccaatat tgataccact gtataactgc ttttgttttg tggaacccct ggtttttcac 2460

aagctcgaat actgaaaagt agaatgcaaa tccaaggctt tcctttatga aatttaaact 2520

aaagcctgca aatattccaa ctaaaccaat ttgttttagt ttgtataaag catactccca 2580

catgctcttc tgtttaccgc tgacaagctc tgagtaattc gatcgggcgt aaagtgcatc 2640

tagcggtgac gcagccacgc tagcagcagc tcccgcaaca aaaccagctt tgaaggtgtc 2700

gacagggcta ggatcatcg 2719

<210>5

<211>6683

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>5

agtcagacga gggtaaggaa attacaaagg ttcttcaaga tctctcggat aaccagaaga 60

aagacggcca gattgtttta gatgaagaac agttggagaa aactttggaa atggccaaag 120

gtgacgcaca agaacctgaa gagaacgtgg acgataatga cgcagacaaa gagatcgatg 180

aaggtgtcga gcccgaggca gaatcatcgg ctcaatctca accggtcact gctttggaaa 240

aaagcagaac agagccatcg gaaacgcatt ccgaacctca agaaggccca gcgccaagct 300

ccgagttgaa tgtagaatca caaccccaaa cgaaattgga atccaagtcg gcttctaaag 360

aaataccatc gccaactcca gaacctgcta ccccatccac gccagcaagt ggagatgaag 420

aacgtgggag caagcgacgc ggatccgaaa gcgtcccccc tggttgtact aagcgcttta 480

atgctctttc tgcacaactt ctcacacaga tatcatccaa ccggtttgca tccatgttca 540

tgcaaccagt gaatgaaaac gaagagccca actactacaa gctaatacgg catcccgtgg 600

acattaagag tttgggtaaa gctattagga cgggtgaaat aaagtcattc gacgagttgg 660

aatttgagct tcaactgatg ttcagcaacg caattatgta caacgatatg aatcagacag 720

aaacttacaa atggacgatt gaaatgatgg aagaaacgca aaacttgttg agcctattcc 780

gggaatcatc cagcaattaa agctcattaa ttgccgcctc tcatctggtt catcaacatc 840

tggttctgtt cctggaatct taaaccaact ctttcggagt gcttgaggaa cttttcagcg 900

cacttgttca aacatgtttc ttctctagag ctaagtttgt tggaggtgaa gtcgttgacg 960

caatcattaa aacatctgtc caccaaactg gtgtagagct gcaatgttag ttttcagaag 1020

gcgttcactt actctcatga agtcattcat ttgcttctgc tccacaattt tctggaattc 1080

ttgctgttct ttatagttga gttgatccat ggtgtatcaa aaataaacta atgaattatc 1140

gaaaaatttt caacatttcc ctgaataata atcaacatgt aataaatctt atggagaaag 1200

ggcgaagtct cacccatcta aggtcgccag cagactactt aatttgatgg aatccaagca 1260

aacaaacctc tgcgcttctg tggatgtgac taaaactcag gaattattgg agcttcttga 1320

taaactgggc ccttacatct gccttgtcaa aactcatatt gacatagtag aggacttctc 1380

ttatgaacac accattttac cattacaagg acttgcaaag aaacacaact tcatgatttt 1440

tgaagacaga aagtttgctg atataggaaa cacagtcaaa ctacagtata agggaggaat 1500

ttatcgaaca tccaagtggg ccgatatcac gaatgcacac ggagtgactg gcgcaggaat 1560

tgttgaaggt cttaaacagg ccgcagaaga aagtacagat gagccacgtg ggcttttgat 1620

gcttgctgag ctcatccaat tgtgacacgt ccgacggcgg cccacgggtc ccaggcctcg 1680

gagatccgtc ccccttttcc tttgtcgata tcatgtaatt agttatgtca cgcttacatt 1740

cacgccctcc ccccacatcc gctctaaccg aaaaggaagg agttagacaa cctgaagtct 1800

aggtccctat ttattttttt atagttatgt tagtattaag aacgttattt atatttcaaa 1860

tttttctttt ttttctgtac agacgcgtgt acgcatgtaa cattatactg aaaaccttgc 1920

ttgagaaggt tttgggacgc tcgaaggctt taatttgcaa gctggagacc aacatgtgag 1980

caaaaggcca gcaaaaggcc aggaaccgta aaaaggaagg gcaattctgc agatatccat 2040

cacactggcg gccgctcatg catgagatca gatcttcgac gcggagaacg atctcctcga 2100

gctgctcgcg gatcagcttg tggcccggta atggaaccag gccgacgcga cgctccttgc 2160

ggaccacggt ggctggcgag cccagtttgt gaacgaggtc gtttagaacg tcctgcgcaa 2220

agtccagtgt cagatgaatg tcctcctcgg accaattcag catgttctcg agcagccatc 2280

tgtctttgga gtagaagcgt aatctctgct cctcgttact gtaccggaag aggtagtttg 2340

cctcgccgcc cataatgaac aggttctctt tctggtggcc tgtgagcagc ggggacgtct 2400

ggacggcgtc gatgaggccc ttgaggcgct cgtagtactt gttccgtcgc tgtagccggc 2460

cgcggtgacg atacccacat agaggtcctt ggccattagt ttgatgaggt ggggcaggat 2520

gggcgactcg gcatcgaaat ttttgccgtc gtcgtacagt gtgatgtcac catcgaatgt 2580

aatgagctgc agcttgcgat ctcggatggt tttggaatgg aagaaccgcg acatctccaa 2640

cagctgggcc gtgttgagaa tgagccggac gtcgttgaac gagggggcca caagccggcg 2700

tttgctgatg gcgcggcgct cgtcctcgat gtagaaggcc ttttccagag gcagtctcgt 2760

gaagaagctg ccaacgctcg gaaccagctg cacgagccga gacaattcgg gggtgccggc 2820

tttggtcatt tcaatgttgt cgtcgatgag gagttcgagg tcgtggaaga tttccgcgta 2880

gcggcgtttt gcctcagagt ttaccatgag gtcgtccact gcagagatgc cgttgctctt 2940

caccgcgtac aggacgaacg gcgtggccag caggcccttg atccattcta tgaggccatc 3000

tcgacggtgt tccttgagtg cgtactccac tctgtagcga ctggacatct cgagactggg 3060

cttgctgtgc tggatgcacc aattaattgt tgccgcatgc atccttgcac cgcaagtttt 3120

taaaacccac tcgctttagc cgtcgcgtaa aacttgtgaa tctggcaact gagggggttc 3180

tgcagccgca accgaacttt tcgcttcgag gacgcagctg gatggtgtca tgtgaggctc 3240

tgtttgctgg ggtagcctac aacgtgacct tgcctaaccg gacggcgcta cccactgctg 3300

tctgtgcctg ctaccagaaa atcaccagag cagcagaggg ccgatgtggc aactggtggg 3360

gtgtcggaca ggctgtttct ccacagtgca aatgcgggtg aaccggccag aaagtaaatt 3420

cttatgctac cgtgcagcga ctccgacatc cccagttttt gccctacttg atcacagatg 3480

gggtcagcgc tgccgctaag tgtacccaac cgtccccaca cggtccatct ataaatactg 3540

ctgccagtgc acggtggtga catcaatcta aagtacaaaa acaaagctta ggaagtctgg 3600

taatggtaag ccgatacgta cccgatatgg gcgatctgat ttgggttgat tttgacccga 3660

caaaaggtag cgagcaagct ggacatcgtc cagctgttgt cctgagtcct ttcatgtaca 3720

acaacaaaac aggtatgtgt ctgtgtgttc cttgtacaac gcaatcaaaa ggatatccgt 3780

tcgaagttgt tttatccggt caggaacgtg atggcgtagc gttagctgat caggtaaaaa 3840

gtatcgcctg gcgggcaaga ggagcaacga agaaaggaac agttgcccca gaggaattac 3900

aactcattaa agccaaaatt aacgtactga ttgggtagtc tagaacaaaa actcatctca 3960

gaagaggatc tgaatagcgc cgtcgaccat catcatcatc atcattgagt tttagcctta 4020

gacatgactg ttcctcagtt caagttgggc acttacgaga agaccggtct tgctagattc 4080

taatcaagag gatgtcagaa tgccatttgc ctgagagatg caggcttcat ttttgatact 4140

tttttatttg taacctatat agtataggat tttttttgtc attttgtttc ttctcgtacg 4200

agcttgctcc tgatcagcct atctcgcagc tgatgaatat cttgtggtag gggtttggga 4260

aaatcattcg agtttgatgt ttttcttggt atttcccact cctcttcaga gtacagaaga 4320

ttaagtgaga ccttcgtttg tgcggatccc ccacacacca tagcttcaaa atgtttctac 4380

tcctttttta ctcttccaga ttttctcgga ctccgcgcat cgccgtacca cttcaaaaca 4440

cccaagcaca gcatactaaa ttttccctct ttcttcctct agggtgtcgt taattacccg 4500

tactaaaggt ttggaaaaga aaaaagagac cgcctcgttt ctttttcttc gtcgaaaaag 4560

gcaataaaaa tttttatcac gtttcttttt cttgaaattt ttttttttag tttttttctc 4620

tttcagtgac ctccattgat atttaagtta ataaacggtc ttcaatttct caagtttcag 4680

tttcattttt cttgttctat tacaactttt tttacttctt gttcattaga aagaaagcat 4740

agcaatctaa tctaagggcg gtgttgacaa ttaatcatcg gcatagtata tcggcatagt 4800

ataatacgac aaggtgagga actaaaccat ggccaagttg accagtgccg ttccggtgct 4860

caccgcgcgc gacgtcgccg gagcggtcga gttctggacc gaccggctcg ggttctcccg 4920

ggacttcgtg gaggacgact tcgccggtgt ggtccgggac gacgtgaccc tgttcatcag 4980

cgcggtccag gaccaggtgg tgccggacaa caccctggcc tgggtgtggg tgcgcggcct 5040

ggacgagctg tacgccgagt ggtcggaggt cgtgtccacg aacttccggg acgcctccgg 5100

gccggccatg accgagatcg gcgagcagcc gtgggggcgg gagttcgccc tgcgcgaccc 5160

ggccggcaac tgcgtgcact tcgtggccga ggagcaggac tgacacgtcc gacggcggcc 5220

cacgggtccc aggcctcgga gatccgtccc ccttttcctt tgtcgatatc atgtaattag 5280

ttatgtcacg cttacattca cgccctcccc ccacatccgc tctaaccgaa aaggaaggag 5340

ttagacaacc tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa 5400

cgttatttat atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca 5460

ttatactgaa aaccttgctt gagaaggttt tgggacgctc gaaggcttta atttgcaagc 5520

tggagaccaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt 5580

tgctggcatcgagctctctt caaagggatc attagctacc ggtgagtata ctcaaaaaac 5640

tgtggaaata gcgaaaagcg ataaagaatt tgtcattgga tttattgcac agagagacat 5700

gggaggtcgt gaggaaggct ttgactggct gatcatgact ccaggagttg gtttagatga 5760

taaaggtgat tctctgggcc aacagtacag aactgttgat gaagtgatgc aaacaggaac 5820

cgatgtcatt atcgttggaa gaggtttatt cggaaaagga agagatcctg aagtggaagg 5880

gaagagatac agaaatgctg ggtgggaagc ttacaagcgg cgcattgctt aacggctttc 5940

agttctatat acatcgtcaa aattgatttt cgctaaaatg ctgacgggat atttcgaata 6000

cgaaaagccc aatagaagtc gcgggaatac tagtgaagga cgatctgaaa aagcctctat 6060

agcagaagcc aaagagggag aggtgagatt ttcgccatcg ttgtagaata atatcaaatg 6120

tctcaatgta agaattatag tagagtttga agaagcgacg ccgatccagt tgatgtgctt 6180

cgttgtagag atctagagat tcgagtctag tcaggtggac cttttgaatt ttattgagtg 6240

gatattggat tgcaagcagt gtagttgcgg cggaagctcc agcaagaagg ataaacgtca 6300

aattcaaagc tttgaaaaat cttgaattct tttcccggtt ttcttcacca tgaaaaagcc 6360

ttgagcgcca atattgatac cactgtataa ctgcttttgt tttgtggaac ccctggtttt 6420

tcacaagctc gaatactgaa aagtagaatg caaatccaag gctttccttt atgaaattta 6480

aactaaagcc tgcaaatatt ccaactaaac caatttgttt tagtttgtat aaagcatact 6540

cccacatgct cttctgttta ccgctgacaa gctctgagta attcgatcgg gcgtaaagtg 6600

catctagcgg tgacgcagcc acgctagcag cagctcccgc aacaaaacca gctttgaagg 6660

tgtcgacagg gctaggatca tcg 6683

<210>6

<211>991

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>6

gtccaccaaa ctggtgtaga gctgcaatgt tagttttcag aaggcgttca cttactctca 60

tgaagtcatt catttgcttc tgctccacaa ttttctggaa ttcttgctgt tctttatagt 120

tgagttgatc catggtgtat caaaaataaa ctaatgaatt atcgaaaaat tttcaacatt 180

tccctgaata ataatcaaca tgtataaatc ttatggagaa agggcgaagt ctcacccatc 240

taaggtcgcc agcagactac ttaatttgat ggaatccaag caaacaaacc tctgcgcttc 300

tgtggatgtg actaaaactc aggaattatt ggagcttctt gataaactgg gcccttacat 360

ctgccttgtc aaaactcata ttgacatagt agaggacttc tcttatgaac acaccatttt 420

accattacaa ggacttgcaa agaaacacaa cttcatgatt tttgaagaca gaaagtttgc 480

tgatatagga aacacagtca aactacagta taagggagga atttatcgaa catccaagtg 540

ggccgatatc acgaatgcac acggagtgac tggcgcagga attgttgaag gtcttaaaca 600

ggccgcagaa gaaagtacag atgagccacg tgggcttttg atgcttgctg agctctcttc 660

aaagggatca ttagctaccg gtgagtatac tcaaaaaact gtggaaatag cgaaaagcga 720

taaagaattt gtcattggat ttattgcaca gagagacatg ggaggtcgtg aggaaggctt 780

tgactggctg atcatgactc caggagttgg tttagatgat aaaggtgatt ctctgggcca 840

acagtacaga actgttgatg aagtgatgca aacaggaacc gatgtcatta tcgttggaag 900

aggtttattc ggaaaaggaa gagatcctga agtggaaggg aagagataca gaaatgctgg 960

gtgggaagct tacaagcggc gcattgctta a 991

<210>7

<211>1397

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>7

gtccaccaaa ctggtgtaga gctgcaatgt tagttttcag aaggcgttca cttactctca 60

tgaagtcatt catttgcttc tgctccacaa ttttctggaa ttcttgctgt tctttatagt 120

tgagttgatc catggtgtat caaaaataaa ctaatgaatt atcgaaaaat tttcaacatt 180

tccctgaata ataatcaaca tgtaataaat cttatggaga aagggcgaag tctcacccat 240

ctaaggtcgc cagcagacta cttaatttga tggaatccaa gcaaacaaac ctctgcgctt 300

ctgtggatgt gactaaaact caggaattat tggagcttct tgataaactg ggcccttaca 360

tctgccttgt caaaactcat attgacatag tagaggactt ctcttatgaa cacaccattt 420

taccattaca aggacttgca aagaaacaca acttcatgat ttttgaagac agaaagtttg 480

ctgatatagg aaacacagtc aaactacagt ataagggagg aatttatcga acatccaagt 540

gggccgatat cacgaatgca cacggagtga ctggcgcagg aattgttgaa ggtcttaaac 600

aggccgcaga agaaagtaca gatgagccac gtgggctttt gatgcttgct gagctcatcc 660

aattgtgaca cgtccgacgg cggcccacgg gtcccaggcc tcggagatcc gtcccccttt 720

tcctttgtcg atatcatgta attagttatg tcacgcttac attcacgccc tccccccaca 780

tccgctctaa ccgaaaagga aggagttaga caacctgaag tctaggtccc tatttatttt 840

tttatagtta tgttagtatt aagaacgtta tttatatttc aaatttttct tttttttctg 900

tacagacgcg tgtacgcatg taacattata ctgaaaacct tgcttgagaa ggttttggga 960

cgctcgaagg ctttaatttg caagctggag accaacatgt gagcaaaagg ccagcaaaag 1020

gccaggaacc gtaaaaaggc cgcgttgctg gcatcgagct ctcttcaaag ggatcattag 1080

ctaccggtga gtatactcaa aaaactgtgg aaatagcgaa aagcgataaa gaatttgtca 1140

ttggatttat tgcacagaga gacatgggag gtcgtgagga aggctttgac tggctgatca 1200

tgactccagg agttggttta gatgataaag gtgattctct gggccaacag tacagaactg 1260

ttgatgaagt gatgcaaaca ggaaccgatg tcattatcgt tggaagaggt ttattcggaa 1320

aaggaagaga tcctgaagtg gaagggaaga gatacagaaa tgctgggtgg gaagcttaca 1380

agcggcgcat tgcttaa 1397

<210>8

<211>4033

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>8

tcttcgacgc ggagaacgat ctcctcgagc tgctcgcgga tcagcttgtg gcccggtaat 60

ggaaccaggc cgacgcgacg ctccttgcgg accacggtgg ctggcgagcc cagtttgtga 120

acgaggtcgt ttagaacgtc ctgcgcaaag tccagtgtca gatgaatgtc ctcctcggac 180

caattcagca tgttctcgag cagccatctg tctttggagt agaagcgtaa tctctgctcc 240

tcgttactgt accggaagag gtagtttgcc tcgccgccca taatgaacag gttctctttc 300

tggtggcctg tgagcagcgg ggacgtctgg acggcgtcga tgaggccctt gaggcgctcg 360

tagtacttgt tccgtcgctg tagccggccg cggtgacgat acccacatag aggtccttgg 420

ccattagttt gatgaggtgg ggcaggatgg gcgactcggc atcgaaattt ttgccgtcgt 480

cgtacagtgt gatgtcacca tcgaatgtaa tgagctgcag cttgcgatct cggatggttt 540

tggaatggaa gaaccgcgac atctccaaca gctgggccgt gttgagaatg agccggacgt 600

cgttgaacga gggggccaca agccggcgtt tgctgatggc gcggcgctcg tcctcgatgt 660

agaaggcctt ttccagaggc agtctcgtga agaagctgcc aacgctcgga accagctgca 720

cgagccgaga caattcgggg gtgccggctt tggtcatttc aatgttgtcg tcgatgagga 780

gttcgaggtc gtggaagatt tccgcgtagc ggcgttttgc ctcagagttt accatgaggt 840

cgtccactgc agagatgccg ttgctcttca ccgcgtacag gacgaacggc gtggccagca 900

ggcccttgat ccattctatg aggccatctc gacggtgttc cttgagtgcg tactccactc 960

tgtagcgact ggacatctcg agactgggct tgctgtgctg gatgcaccaa ttaattgttg 1020

ccgcatgcat ccttgcaccg caagttttta aaacccactc gctttagccg tcgcgtaaaa 1080

cttgtgaatc tggcaactga gggggttctg cagccgcaac cgaacttttc gcttcgagga 1140

cgcagctgga tggtgtcatg tgaggctctg tttgctgggg tagcctacaa cgtgaccttg 1200

cctaaccgga cggcgctacc cactgctgtc tgtgcctgct accagaaaat caccagagca 1260

gcagagggcc gatgtggcaa ctggtggggt gtcggacagg ctgtttctcc acagtgcaaa 1320

tgcgggtgaa ccggccagaa agtaaattct tatgctaccg tgcagcgact ccgacatccc 1380

cagtttttgc cctacttgat cacagatggg gtcagcgctg ccgctaagtg tacccaaccg 1440

tccccacacg gtccatctat aaatactgct gccagtgcac ggtggtgaca tcaatctaaa 1500

gtacaaaaac aaagcttcga aacgatgaga tttccttcaa tttttactgc tgttttattc 1560

gcagcatcct ccgcattagc tgctccagtc aacactacaa cagaagatga aacggcacaa 1620

attccggctg aagctgtcat cggttactca gatttagaag gggatttcga tgttgctgtt 1680

ttgccatttt ccaacagcac aaataacggg ttattgttta taaatactac tattgccagc 1740

attgctgcta aagaagaagg ggtatctctc gagaaaagag aggctgaagc tgaattcatg 1800

acattaatct acgtgccttc aatatttaca atggtcccct caatcacacg gattgtactg 1860

gttaacattc tgttggcgac gttggttttg ggagctgcag tccttccacg agacaacaga 1920

actgtttgcg ggagtcaact ctgcacatgg tggcacgact ccggcgagat aaacaccggt 1980

actcctgtac aggcaggaaa cgttcgacaa tcccgaaagt actctgtcca tgtgagcctg 2040

gcagaccgta accaattcta cgactctttc gtatatgaat cgatacctag gaacggcaat 2100

ggcagaattt attctcccac cgacccacct aacagcaata cattgaatag tagcattgac 2160

gacggtatat caatcgaacc atctctcggc atcaacatgg cttggtccca gttcgaatat 2220

agacgagatg tcgacattaa gattactaca atcgatggct caatattgga tggccctttg 2280

gacattgtta ttcggccgac ttctgttaag tactcagtca aaagatgtgt gggtggtatc 2340

attattagag tcccttatga tcccaatggt cgaaaattct ctgttgagtt aaagagtgac 2400

ctttacagtt acctctccga cggttcgcaa tatgtgacct ctggagggag cgtggttggt 2460

gtggagccaa aaaatgccct ggtgatcttt gccagccctt tcttgccacg ggatatggtt 2520

cctcatatga caccacacga cacccagaca atgaagccgg gcccaatcaa taatggggac 2580

tggggttcaa agcctatact ctacttcccg cctggcgtat actggatgaa cgaggatacc 2640

tctggtaacc ccgggaagct cggctcaaat catatgcggc tggatcccaa tacctactgg 2700

gtccatctag ccccaggagc ctatgtgaaa ggagccattg agtatttcac gaagcaaaat 2760

ttctatgcaa cgggtcatgg cgttctctca ggtgagaact atgtttatca ggccaatgca 2820

gctgataact actatgccgt caagagtgat ggcacaagct tgagaatgtg gtggcacaac 2880

aaccttggag gcggtcaaac atggttttgc atggggccca ccattaatgc accgccgttt 2940

aatacgatgg acttcaacgg aaactctaat atttccagcc ggattagtga ctataagcag 3000

gttggcgctt attttttcca aacagacgga ccggagatct acgaggacag tgttgtccat 3060

gacgtcttct ggcatgttaa tgatgatgcc atcaagacat attattccgg agcttcaatt 3120

tcacgagcaa ccatctggag gtgtcacaat gacccgatca tacagatggg ctggacgtca 3180

cgaaatctca ccggaatcag cattgataac ctgcacgtca tccacacgag atatttcaaa 3240

tctgaaacag tggttccttc agcaatcatt ggagcgtctc cattctacgc aagtggaatg 3300

actgttgatc ccagcgagtc catcagcatg accatctcta acgtggtgtg tgagggtcta 3360

tgcccctcac tgttccgtat cactccgctt cagagctaca acaaccttgt tgtcaagaac 3420

gtggcctttc ccgatggact gcagacaaat ccaatcggaa taggagagag cattatacca 3480

gcagcttccg gctgtacaat ggacttggaa atcacaaact ggaccgtcaa aggacaaaaa 3540

gtcaccatgc aaaactttca gtccgggtca cttggccagt tcgatatcga tggttcatac 3600

tggggtcaat ggtccataaa ctaatctaga acaaaaactc atctcagaag aggatctgaa 3660

tagcgccgtc gaccatcatc atcatcatca ttgagtttgt agccttagac atgactgttc 3720

ctcagttcaa gttgggcact tacgagaaga ccggtcttgc tagattctaa tcaagaggat 3780

gtcagaatgc catttgcctg agagatgcag gcttcatttt tgatactttt ttatttgtaa 3840

cctatatagt ataggatttt ttttgtcatt ttgtttcttc tcgtacgagc ttgctcctga 3900

tcagcctatc tcgcagctga tgaatatctt gtggtagggg tttgggaaaa tcattcgagt 3960

ttgatgtttt tcttggtatt tcccactcct cttcagagta cagaagatta agtgagacct 4020

tcgtttgtgc gga 4033

Claims (2)

1. Hansenula polymorpha auxotrophic for uracil characterized by: the uracil auxotrophic Hansenula polymorpha is prepared according to a method comprising the following steps: hansenula polymorpha (Hansenula polymorpha)) (Hansenula polymorpha) The sequence of the HP20110424 orotidine-5' -phosphate decarboxylase gene is changed from 634-1425 th of the sequence 1 to 620-1412 th of the sequence 2, and an exogenous DNA fragment is inserted between 1075-1076 th of the sequence 2 to obtain the uracil auxotroph Hansenula polymorpha;

the Hansenula polymorpha (A), (B), (C), (Hansenula polymorpha) HP20110424 has a preservation number of CGMCC No.7.89 in China general microbiological culture Collection center, and contains the orotidine-5' -phosphate decarboxylase gene;

the sequence of the exogenous DNA fragment is No. 6 of the sequence 769-1039 bits showCYC1TT and the upstream and downstream sequences thereof, wherein the upstream sequence is atcc aattgtga, and the downstream sequence is c cgcgttgctg gcatcgagct c.

2. A method of expressing a glucanase comprising: introducing an expression vector containing a gene encoding glucanase into the uracil auxotrophic Hansenula polymorpha of claim 1 to obtain recombinant Hansenula polymorpha, and expressing the glucanase.

Images