CN112481235B - Application of Trdrs2 protein and related biological material thereof in regulation of protein synthesis and secretion capacity of Trichoderma reesei - Google Patents

Abstract

The invention discloses application of Trdrs2 protein and related biological materials thereof in regulating and controlling the protein synthesis and secretion capacity of Trichoderma reesei. The Trdrs2 gene in the Trichoderma reesei starting strain is knocked out to obtain the Trdrs2 gene knocked-out strain with obviously increased extracellular protein secretion amount. The Trdrs2 is a regulatory gene related to the extracellular protein secretion of Trichoderma reesei (Trichoderma reesei), and the Trdrs2 gene is knocked out to improve the protein synthesis and secretion capacity of Trichoderma reesei. The invention provides a technical basis for constructing trichoderma reesei host bacteria and engineering bacteria with increased extracellular protein secretion.

Description

Application of Trdrs2 protein and related biological material thereof in regulation of protein synthesis and secretion capacity of Trichoderma reesei

Technical Field

The invention relates to the technical field of biology, in particular to application of Trdrs2 protein and related biomaterials in regulation of protein synthesis and secretion capacity of Trichoderma reesei.

Background

The method has quite wide application prospect in producing biofuel or other bulk chemicals by degrading cheap and abundant plant biomass materials into simple glycogen which can be used for microbial fermentation by using cellulase. Currently, the main industrial strain for industrial production of cellulase is the filamentous fungus Trichoderma reesei (Trichoderma reesei), which is a mesophilic saprophytic fungus and can be used for producing cellulose and hemicellulase for industries such as food, feed, textile, pulping and paper making. Has become an important model strain for researching cellulose degradation. Trichoderma reesei is an FDA-certified safe production strain, has strong protein secretion capacity, and has a glycosylation system similar to that of higher mammals, so Trichoderma reesei is also a very ideal recombinant protein expression host, and is widely used as an excellent heterologous protein expression host in recent years. At present, the cost of biomass degrading enzymes is too high, which is one of the main obstacles for effective utilization of lignocellulose substances, and in order to further improve the yield of cellulase hemicellulase of trichoderma reesei and improve the secretion amount of heterologous protein expressed by the cellulase, how to improve the extracellular protein synthesis secretion amount of trichoderma reesei becomes a research hotspot in recent years.

The current research shows that the expression regulation of the Trichoderma reesei cellulase gene is performed at the transcription level and is promoted by a transcription activator and repressed by a carbon metabolism inhibitor protein, and in the previous research, only 3 transcription activators (Ace2, Hap2/3/5 and Xyr1) and 2 repressor proteins (Cre I and Ace I) are separated and identified by adopting traditional methods such as gene cloning, yeast hybridization and the like. Meanwhile, researches show that the deletion of the repressor protein can obviously improve the expression level of the trichoderma reesei exocrine protein. Based on the complexity of the regulation of Trichoderma reesei cellulase expression, many key regulatory factors should remain in the transcriptional regulation process. By analyzing the functions of some proteins with typical structures of transcription factors, the research on the functions of the proteins in the cellulose hemicellulase biosynthesis is expected to further improve the capability of trichoderma reesei in synthesizing and secreting proteins from the mechanism.

Trichoderma reesei Trdrs2 gene (GenBank accession number: NCU00352) encodes phospholipid-transferring ATPase (phospholipid-transferring ATPase), participates in ribosome assembly, and reports related to protein secretion pathways are not found at present.

Disclosure of Invention

The invention aims to provide application of Trdrs2 protein derived from Trichoderma reesei and related biological materials thereof in regulation of protein synthesis and secretion capacity of Trichoderma reesei (Trichoderma reesei).

In order to achieve the aim, the invention provides the application of any one of the following substances A-C in regulating and controlling the secretion amount of extracellular proteins of Trichoderma reesei (Trichoderma reesei);

A. trdrs2 protein;

B. nucleic acid molecules encoding the Trdrs2 protein;

C. an expression cassette or recombinant vector or recombinant cell containing the nucleic acid molecule;

the Trdrs2 protein is any one of the following a1) -a 4):

a1) protein shown as a sequence 6 in a sequence table;

a2) a fusion protein obtained by connecting labels to the N terminal or/and the C terminal of the protein of a 1);

a3) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in a1) and is related to the secretion amount of the trichoderma reesei extracellular protein;

a4) protein with more than 98% of identity with a1) and related to the secretion amount of the trichoderma reesei extracellular protein.

In order to achieve the purpose, the invention also provides application of the substance shown in b1) or b2) in improving the secretion amount of extracellular proteins of Trichoderma reesei (Trichoderma reesei):

b1) substances which cause the loss of the activity of the Trdrs2 protein in Trichoderma reesei (Trichoderma reesei);

b2) a substance for knocking out a nucleic acid molecule encoding a Trdrs2 protein in Trichoderma reesei (Trichoderma reesei);

the Trdrs2 protein is any one of a1) -a4) as follows:

a1) protein shown as a sequence 6 in a sequence table;

a2) a fusion protein obtained by connecting labels to the N terminal or/and the C terminal of the protein of a 1);

a3) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in a1) and is related to the secretion amount of the trichoderma reesei extracellular protein;

a4) protein with more than 98% of identity with a1) and related to the secretion amount of the trichoderma reesei extracellular protein.

In the application, the nucleic acid molecule encoding the Trdrs2 protein is any one of c1) -c 3):

c1) DNA molecules shown in a sequence 1 or a sequence 2 in a sequence table;

c2) a DNA molecule having 95% identity or more to c1) and encoding the protein;

c3) a DNA molecule which hybridizes with the nucleotide sequence defined by any one of c1) or c2) under strict conditions and codes the protein.

Wherein the DNA molecule shown in the sequence 1 in the sequence table is a cDNA sequence of Trichoderma reesei Trdrs2 gene and consists of 4188 bases; the DNA molecule shown in the sequence 2 in the sequence table is Trichoderma reesei Trdrs2 gene and genome DNA sequences of 2500bp at the upstream and the downstream of the Trichoderma reesei Trdrs2 gene, the 1 st to 2500 th sites of the sequence 2 in the sequence table are the upstream 2500bp sequences of the Trdrs2 gene, the 6689 nd-9188 th sites of the sequence 2 in the sequence table are the downstream 2500bp sequences of the Trdrs2 gene, and the Trdrs2 gene and the upstream and downstream sequences thereof can be seen in the following websites: https:// www.ncbi.nlm.nih.gov/nucleotide/CP 016236.1? report & log $ ═ nuclear & blast _ rank ═ 1& RID ═ G7GAV51W 014.

In the application, the substance for knocking out the nucleic acid molecule coding for the Trdrs2 protein in the Trichoderma reesei is a DNA fragment for knocking out the nucleic acid molecule coding for the Trdrs2 protein in the Trichoderma reesei (Trichoderma reesei), or a recombinant vector containing the DNA fragment or a recombinant cell containing the DNA fragment.

Further, the DNA fragment of the nucleic acid molecule encoding the Trdrs2 protein in the knocked-out Trichoderma reesei (Trichoderma reesei) contains an upstream homology arm of the Trdrs2 gene and a downstream homology arm of the Trdrs2 gene.

Wherein, the upstream homology arm used in the homologous recombination can be selected from the upstream sequence of the Trdrs2 gene and has the length of at least 1000bp, and the downstream homology arm used in the homologous recombination can be selected from the Trdrs2 gene and the downstream sequence thereof and has the length of at least 1000 bp. In the embodiment of the present invention, the nucleotide sequence of the upstream homology arm used in the homologous recombination can be the 1 st-2000 st position (i.e. the 501 st-2501 st position of the sequence 2) of the sequence 3 in the sequence table, and the nucleotide sequence of the downstream homology arm used in the homologous recombination can be the 6189 st-8188 th position (i.e. the 6689 nd-8688 th position of the sequence 2) of the sequence 3 in the sequence table.

Furthermore, the DNA fragment of the nucleic acid molecule for knocking out the Trdrs2 protein in the Trichoderma reesei (Trichoderma reesei) is the DNA fragment shown in the sequence 4 in the sequence table.

In order to realize the aim, the invention also provides a construction method of the recombinant trichoderma reesei.

The construction method of the recombinant trichoderma reesei provided by the invention is m1) or m 2):

m1) comprises the following steps: the activity of Trdrs2 protein in Trichoderma reesei (Trichoderma reesei) is lost to obtain the recombinant Trichoderma reesei;

m2) comprises the following steps: knocking out nucleic acid molecules encoding Trdrs2 protein in Trichoderma reesei (Trichoderma reesei) to obtain the recombinant Trichoderma reesei.

In the above method, m2), the method for knocking out the nucleic acid molecule encoding the Trdrs2 protein in Trichoderma reesei (Trichoderma reesei) can be homologous recombination, random insertion mutation or RNAi.

Further, the nucleotide sequence of the upstream homology arm adopted in the homologous recombination is 1 st to 2000 th of the sequence 3 in the sequence table, and the nucleotide sequence of the downstream homology arm adopted in the homologous recombination is 6189-8188 th of the sequence 3 in the sequence table.

Furthermore, the module for homologous recombination (knock-out module) consists of a selection marker gene inserted into the upstream and downstream homology arms of the Trdrs2 gene to facilitate selection of transformants. In the embodiment of the invention, the homologous recombination is realized by introducing a DNA fragment shown in a sequence 4 in a sequence table into the Trichoderma reesei (Trichoderma reesei). The 1 st-2000 th homology arm of Trdrs2, the 3914 th-5913 th homology arm of Trdrs2 and the 2001 th-3913 th homology arm of the sequence 4 in the sequence table are pyr4 genes. Among them, pyr4 is a selection marker gene and is a gene of the nutritional selection marker gene orotidine-5' -monophosphate decarboxylase.

To achieve the above object, the present invention finally provides a biomaterial as described in any one of the following n1) -n 6):

n1) recombinant Trichoderma reesei constructed by the above method;

n2) the above substance which causes the loss of the activity of Trdrs2 protein in Trichoderma reesei (Trichoderma reesei);

n3) the above substance for knocking out a nucleic acid molecule encoding a Trdrs2 protein in Trichoderma reesei (Trichoderma reesei);

n4) the above DNA fragment which knocks out the nucleic acid molecule encoding the Trdrs2 protein in Trichoderma reesei (Trichoderma reesei);

n5) a recombinant vector containing the DNA fragment of n 4); the recombinant vector is used for storing the knockout component;

n6) recombinant cells containing the DNA fragment of n 4); the recombinant cells are used to preserve knock-out components.

The application of the method or the biological material in preparing or synthesizing or expressing extracellular protein also belongs to the protection scope of the invention.

In any of the above applications or methods, the recombinant cell may be a non-human animal cell, a microbial cell, or a plant cell.

In any of the above applications or methods, the extracellular proteins include endogenous proteins of Trichoderma reesei (Trichoderma reesei), such as cellulases and/or hemicellulases, and may further include exogenous proteins introduced into Trichoderma reesei (Trichoderma reesei). Wherein, in Trichoderma reesei strains which do not contain foreign proteins, the regulation and control of the secretion amount of extracellular proteins of Trichoderma reesei (Trichoderma reesei) can be embodied as the regulation and control of the secretion amount of cellulase and/or hemicellulase.

In any of the above uses or methods, the trichoderma reesei is trichoderma reesei strain TU6 Δ tku 70.

Experiments prove that after the Trdrs2 gene in the Trichoderma reesei starting strain is knocked out, a Trdrs2 gene knocked-out strain with obviously increased extracellular protein secretion is obtained, which indicates that the Trdrs2 is a regulatory gene related to the extracellular protein secretion of Trichoderma reesei (Trichoderma reesei), and the ability of synthesizing and secreting the protein of Trichoderma reesei can be improved by knocking out the Trdrs2 gene. The invention provides a technical basis for constructing trichoderma reesei host bacteria and engineering bacteria with increased extracellular protein secretion.

Drawings

FIG. 1 is a PCR identification map of Trdrs2 knock-out strain. PA: starting plants; T1-T7: and (3) a transformant.

FIG. 2 is an SDS-PAGE analysis of the Trdrs2 knock-out strain and the fermentation supernatants of the starting strains. 1-3: t. reesei primary strain; 4-6: t.reesei Δ drs 2; m: and (4) protein molecule standard.

FIG. 3 shows the results of protein concentration determination of fermentation supernatants of Trdrs2 knockout strain and starting strain.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention.

The test methods in the following examples are conventional methods unless otherwise specified.

The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

All primers in the following examples were synthesized by Shanghai.

Trichoderma reesei strain TU 6. DELTA. tku70 referred to in the following examples is a uracil auxotrophic strain as presented by the Monika Schmoll laboratory, university of Vienna, Austria, and TU 6. DELTA. tku70 is a KU70.4 transformant (obtained by deleting tku70 from Hypocrea jecoriana (a sexual form of Trichoderma reesei)) TU-6 strain as described in the following references: gene targeting in a nonhomologous end joining in a scientific Hypopocrea j ecina Zhang Guangtaoa et al journal of Biotechnology 139(2009) 146- & 151.

The formulations of the media and reagents involved in the following examples are as follows:

1) potato medium PDA (100 mL): cutting 20g peeled potato, adding 90mL water, boiling for 30min, filtering with double-layer gauze, adding 2g glucose and 1.8g agar powder, adding water to 100mL, and sterilizing with 115 deg.C high-pressure steam.

2) Minimal Medium (MM): the solvent is water, and solutes and the mass thereof in each liter of culture medium are as follows: 0.05g (NH) ₄ ) ₂ SO ₄ ，0.15g KH ₂ PO ₄ ，0.006g MgSO ₄ ，0.006g CaCl ₂ ，0.00005g FeSO ₄ ·7H ₂ O，0.000016g MnSO ₄ ·H ₂ O，0.000014g ZnSO ₄ ·7H ₂ O，0.00002g CoCl ₂ 。

3) Fermentation medium: one of the following carbon sources (e.g., 2% cellulose, 2% lactose, 2% glucose, 2% glycerol, final concentration) was added to MM medium at pH 5.2. + -. 0.1.

A1, MM media plates containing 1.0M sorbitol but no uridine: sorbitol was added to MM to a final concentration of 1.0M, and agar was added to prepare a solid medium.

Plates of a2, MM + 0.1% Triton X100: triton X100 was added to MM with 2% glucose to a final concentration of 0.1% by volume, and agar was added to make a solid medium.

A3, MM liquid medium with 2% glucose: the resulting liquid medium was added with glucose to a final concentration of 2% (mass percent concentration) to MM.

A4, MM + 2% microcrystalline cellulose liquid medium: adding microcrystalline cellulose to MM to a final concentration of 2% (mass% concentration) to obtain a liquid medium.

4) LB medium: the solvent is water, and solutes in each liter of culture medium and the mass percentage content are as follows: 1% peptone, 1% sodium chloride, 0.5% yeast extract.

5) Trichoderma reesei chromosomal DNA extraction buffer (pH 7.5):

EDTA 1mM

phosphate buffer 50mM

5 percent of glycerin

6) Protoplast preparation and transformation-related reagents:

0.2M phosphate buffer pH 7.4 (per 100mL)

0.2M Na ₂ HPO ₄ 81mL

0.2M NaH ₂ PO ₄ 19mL

1.2mol/L MgSO ₄ Solutions of

MgSO ₄ 1.2M

Phosphate buffer pH 7.410 mM

0.6M sorbitol solution

Sorbitol 0.6M

Tris.Cl pH 7.0 0.01M

1.0M sorbitol solution

Sorbitol 1.0M

CaCl ₂ 0.01M

Tris.Cl pH 7.5 0.01M

PEG solution

PEG4000 50％

CaCl ₂ 0.05M

Tris.Cl pH 7.5 0.01M

Example 1 knock-out of Trichoderma reesei Trdrs2 Gene to construct recombinant Trichoderma reesei with increased extracellular protein secretion

In this example, a Trdrs2 gene was knocked out by introducing a DNA fragment (knock-out module) shown in sequence 4 in the sequence table into trichoderma reesei starting strain trichoderma reesei strain TU6 Δ tku70 through homologous recombination to obtain a Trdrs2 gene knock-out strain (recombinant trichoderma reesei) with significantly increased extracellular protein secretion.

Construction of Trdrs2 gene-knocked-out recombinant Trichoderma reesei

1. PCR amplification of Trdrs2 gene (containing two homologous arms) and pyr4 gene expression cassette

1) Taking Trichoderma reesei strain TU6 delta tku70 genome DNA as a template, respectively adopting a pDrs2-1F/pDrs2-1R primer pair and a pDrs2-3F/pDrs2-3R primer pair to carry out PCR amplification, and respectively obtaining a Trdrs2 upstream homologous arm with the size of 2000bp and a Trdrs2 downstream homologous arm with the size of 2000 bp.

The amplification procedure was: pre-denaturation at 98 ℃ for 30s, denaturation at 98 ℃ for 10s, annealing at 68 ℃ for 20s, extension at 72 ℃ for 1min, and 30 cycles; finally, extension at 72 ℃ was performed for 5 min.

2) The genomic DNA of Trichoderma reesei strain QM9414(ATCC 26921) is used as a template, and pDrs2-2F/pDrs2-2R primer pair is adopted for PCR amplification to obtain the pyr4 gene of the nutritional selective marker gene orotidine-5' -monophosphate decarboxylase with the size of 1913 bp.

The amplification procedure was: pre-denaturation at 98 ℃ for 30s, denaturation at 98 ℃ for 10s, annealing at 68 ℃ for 20s, extension at 72 ℃ for 1min, and 30 cycles; finally, extension at 72 ℃ for 5 min.

3) The PCR products obtained in the steps 1) and 2) are respectively subjected to 1% agarose gel electrophoresis for size identification and sequencing, and the result shows that the amplified upstream homology arm is a sequence shown in the 1 st-2055 th site of the sequence 4 in the sequence table, the amplified pyr4 gene is a sequence shown in the 1978 th-3933 th site of the sequence 4 in the sequence table, and the amplified downstream homology arm is a sequence shown in the 3914 th-5913 th site of the sequence 4 in the sequence table.

The primer sequences used were as follows:

pDrs2-1F：ctccaaggtgttggggatcgtgtgccgcgtttcttgggcgttgctgg；

pDrs2-1R：gatacccgatattgcgactttgggggccggaggacgagcagtggttag；

pDrs2-2F：ctaaccactgctcgtcctccggcccccaaagtcgcaatatcgggtatc；

pDrs2-2R：caattttttctttgctttttcaactgcatccaaaccatcctac；

pDrs2-3F：gtaggatggtttggatgcagttgaaaaagcaaagaaaaaattg；

pDrs2-3R：tttggtgtgaagaggggagggggatatgtaaggggaaattggggtc。

2. PCR amplification of PSK frameworks

PCR amplification was performed using a commercial plasmid pBluescript II SK (+) (Stratagene) as a template and pSK-F/pSK-R primer pairs to obtain a 2899bp PSK scaffold, the ends of which contained 25bp upstream and 25bp downstream homology arms of Trdrs2 and 2, respectively.

The amplification procedure was: pre-denaturation at 98 ℃ for 30s, denaturation at 98 ℃ for 10s, annealing at 68 ℃ for 20s, extension at 72 ℃ for 1min, and 30 cycles; finally, extension at 72 ℃ for 5 min.

The primer sequences used were as follows:

pSK-F：ccaccacatacatacagacagaccccaatttccccttacatatcc；

pSK-R：gcacacgatccccaacaccttggagcaattcgccctatagtgagt。

3. construction of trichoderma reesei pDRs2 knockout vector and obtaining of knockout component

1) By NEB Gibson

The Master Mix enzyme mixes the amplified upstream homologous arm fragment of Trdrs2 with the size of 2000bp, the pyr4 gene fragment with the size of 1913bp, the downstream homologous arm fragment of Trdrs2 with the size of 2000bp and the PSK skeleton with the size of 2899bp, and the specific method is as follows:

1-1) the amount of backbone fragment added was determined on the basis of 30-50ng of backbone sample addition.

1-2) converting the size of the backbone segment into moles based on the volume added.

1-3) taking the skeleton as a standard, ensuring that the molar ratio of the insert fragment to the skeleton fragment is 1:2-1:3 and the molar ratio between the insert fragments is 1:1 during sample addition, thereby obtaining the molar number of each fragment.

1-4) dividing the number of moles by the corresponding concentration to obtain the loading volume required for each fragment.

1-5) Add the corresponding volume of each fragment to the PCR tube, followed by equal amounts (total fragment volume) of Gibson

The Master Mix enzyme was gently mixed by pipetting with a gun.

1-6) incubating the mixed solution at 50 ℃ for 60min, and finally taking 2 mu L of reaction solution to transform the escherichia coli competent cells.

2) And connecting the four mixed fragments, then transforming escherichia coli, and selecting a transformant for sequencing identification to obtain a knockout vector pDRs2 of the Trdrs2 gene.

3) Carrying out PCR amplification by taking the plasmid pDrs2 as a template and adopting a pDrs2-1F/pDrs2-3R primer pair, wherein the amplification conditions are as follows: pre-denaturation at 98 ℃ for 30s, denaturation at 98 ℃ for 10s, annealing at 68 ℃ for 20s, extension at 72 ℃ for 3.6min, and 30 cycles; finally, extension at 72 ℃ was performed for 5 min. The product obtained by PCR amplification is a knockout component fragment containing upstream and downstream homologous arms of the Trdrs2 gene and an expression frame of the pyr4 gene, the sequence of the knockout component fragment is shown as a sequence 4 in a sequence table, the 1 st to 47 th sites of the sequence 4 are pDRs2-1F, the 5868 th and 5913 th sites are reverse complementary sequences of pDRs2-3R, the 1 st to 2000 th sites are upstream homologous arms of the Trdrs2, the 3914 th and 5913 th sites are downstream homologous arms of the Trdrs2, and the 2001 th and 3913 th sites are pyr4 gene fragments.

4. Protoplast preparation of Trichoderma reesei strain Tu 6. delta. tku70

A. Taking freshly cultured Trichoderma reesei strain Tu6 delta tku70 spores on a slant or a plate (the culture medium is PDA), washing the spores with a proper amount of sterile water to prepare a spore suspension, and filtering with a 200-mesh sieve to remove residual hyphae. The filtered spore suspension was inoculated into a 500mL Erlenmeyer flask containing 100mL MM medium and incubated at 28 ℃ for 13-14h until the hyphae stretch.

B. Filtering the culture solution with 200 mesh sieve, collecting thallus, washing with sterile water for 2-3 times, and adding 1.2M MgSO ₄ The solution is washed once, and the solution is naturally drained.

C. The cells on the sieve were washed into a flask containing 15mL of a lysate (1.2M MgSO 2 containing 150mg of lyase and 15mg of cellulase) ₄ Solution) at 30 ℃ for 1.5h, observing the generation of protoplast under a microscope, and sampling and observing once every 10min after 1 h.

D. When the protoplast is produced in large quantity and a large amount of hypha still exists, adding equal volume of 0.6M sorbitol solution to stop the reaction, filtering with a 200-mesh sieve to remove residual hypha, centrifuging at 3000rpm for 10min at room temperature, and collecting the protoplast precipitate.

E. The supernatant was decanted along the pellet side and the protoplast pellet was resuspended in 1.0M sorbitol and centrifuged at 3000rpm for 10min at room temperature.

F. Step E was repeated, the supernatant was discarded and the protoplasts were suspended in 200. mu.L of 1.0M sorbitol solution to give protoplasts of Trichoderma reesei strain Tu 6. delta. tku70, which were observed and counted in a hemocytometer.

5. Transformation of Trichoderma reesei strain Tu 6. delta. tku70 protoplast by Trdrs2 knock-out module

A. Recovering the knockout component (the sequence of which is shown as sequence 4 in the sequence table) obtained by performing PCR amplification by using the pDRs2-1F/pDRs2-3R primer pair in the step 3, precipitating the knockout component by using 2 times of volume of absolute ethyl alcohol and 1/10 volume of 3.0M sodium acetate solution (pH5.2) overnight, washing the knockout component by using 70% of ethanol solution for 2 times, and sterilizing ddH ₂ O dissolves, bringing the concentration of the knock-out component to the order of micrograms per microliter.

B. Adding a certain amount (the volume is not more than 20 mu L) of prepared knockout assembly into the trichoderma reesei strain Tu6 delta tku70 protoplast prepared in the step 3, gently mixing the components uniformly, adding 50 mu L of PEG4000 into the protoplast, mixing the components uniformly again, and standing the mixture on ice for 30 min; while the DNA was replaced with an equal volume of sterile water as a control.

C. Then, 1mL of PEG4000 was added to each of the tubes, and the mixture was mixed well and left at room temperature for 20 min.

D. 1mL of 1.0M sorbitol solution was added, mixed well and mixed with four 4mL portions of thawed MM medium (below 58 ℃) in four portions, immediately plated on MM medium plates containing 1.0M sorbitol but no uridine, and cultured at 30 ℃ for 4 to 7 days. In MM medium without uridine, only the strain transformed with pyr4 grew.

6. Screening of transformants and molecular identification

After the transformant grows out, the transformant is transferred to a PDA plate, after the transformant is cultured at 28 ℃ for 3-5 days and spores are generated, the spores on the plate are washed down by sterile water to prepare spore suspension, and after gradient dilution, the spore suspension is coated on a MM + 0.1% Triton X100 plate for single spore division. After hyphae grow out, extracting genome DNA, and identifying positive transformants by PCR, wherein the identification primers are as follows:

pDrs2-4-F：TGTACATGTTGAGCTATGAC；

pDrs2-pyr4-R：GAGATGGCACAATTCTGCTGTG；

pDrs2-drs2-R：CCAGGTCGTCGTCATTGAG。

the sequence 2 in the sequence table is Trdrs2 gene and the 2500bp fragment of the upstream and downstream thereof. pDRs2-4-F corresponds to position 372-391 of sequence 2 and pDRs2-drs2-R corresponds to position 2612-2630 of sequence 2. Sequence 5 in the sequence table is a genome sequence of a Trichoderma reesei Trdrs2 knockout strain with the Trdrs2 gene replaced by pyr 4. pDrs2-4-F corresponds to position 372-391 of sequence 2 and pDrs2-pyr4-R corresponds to position 2743-2764 of sequence 5.

Wherein, the pDrs2-4-F primer is combined with the outer sequence of the homologous arm in the knockout module, pDrs2-pyr4-R is positioned in pyr4 gene sequence, pDrs2-drs2-R is positioned in drs2 gene sequence, if the Trdrs2 knockout module is integrated in a site of Trdrs2, the pDrs2-4-F/pDrs2-pyr4-R primer pair theoretically should amplify a fragment with the size of 2393bp, and the pDrs2-4-F/pDrs2-drs2-R primer pair should not amplify a fragment. And the starting strain Trichoderma reesei strain Tu6 delta tku70 is a primer pair pDrs2-4-F/pDrs2-pyr4-R which cannot amplify fragments, and a primer pair pDrs2-4-F/pDrs2-drs2-R theoretically should amplify fragments with the size of 2259 bp. The PCR product with the size of 2393bp is amplified by pDrs2-4-F/pDrs2-pyr4-R, the strain which cannot amplify the PCR product by using the pDrs2-4-F/pDrs2-drs2-R primer pair is the Trdrs2 knockout strain (recorded as T.reesei. delta. drs2), and the PCR identification result is shown in figure 1. Wherein PA is Trichoderma reesei strain Tu6 delta tku70DNA as a template, and T-1-T-7 are transformant screening DNA as a template. P1: PCR amplification products using a primer pair of pDrs2-4-F/pDrs2-pyr 4-R; p2: PCR amplification products using a primer pair pDRs2-4-F/pDRs2-drs 2-R. Finally, T-1, T-2, T-3, T-5 and T-7 obtained by screening are target Trichoderma reesei delta drs2 homokaryons, and T-4 and T-6 are heterozygotes.

The genome sequence of the Trdrs2 knockout strain (denoted as t.reesei Δ drs2) is obtained by replacing the Trdrs2 gene sequence in the genome sequence of trichoderma reesei strain Tu6 Δ tku70 with pyr4 gene sequence.

Second, analysis of differences in protein expression and secretion of fermentation liquids of control strains and knockout strains

After the genetically stable transformant is obtained in the first step, Trichoderma reesei strain Tu 6. delta. tku70(T. reesei WT for short) and Trds2 knock-out strain (T. reesei. delta. drs2 for short. delta. drs2) are transferred to a PDA plate to produce spores, the spores are washed with sterile water and filtered through a 200-mesh sieve to prepare a spore suspension, and the spore suspension is added into a 250mL Erlenmeyer flask containing 50mL MM liquid medium containing 2% glucose to make the final concentration 10 ⁸ The cells were pre-cultured at 28 ℃ and 200rpm for 48 hours in a 20% microcrystalline cellulose liquid medium (5 mL) and shake-cultured at 28 ℃ and 200rpm for 168 hours, during which the fermentation supernatant (extracellular fermentation broth) was collected every 24 hours from 48 hours and analyzed by SDS-PAGE. The culture conditions and the inoculation amounts of Trichoderma reesei strain Tu6 delta tku70 and Trdrs2 knockout strain are completely the same. The volume of fermentation supernatants of Trichoderma reesei strain Tu 6. delta. tku70 and Trdrs2 knock-out strain were the same for each sampling. Three bottles of each of the Trichoderma reesei strain Tu 6. delta. tku70 and Trdrs2 knock-out strain were taken for each sampling. SDS-PAGE (figure 2) is carried out on secretory proteins of the Trichoderma reesei strain Tu6 delta tku70 and the Trdrs2 knockout strain after 168h of fermentation, and the result shows that the amount of the exocrine proteins of the Trdrs2 knockout strain is obviously higher than that of the Trichoderma reesei strain Tu6 delta tku 70.

The total protein concentration of 168h fermentation supernatant was determined by the following method:

(1) mu.L of appropriately diluted sample solution was added to the microplate, and 1 replicate control was set up. And simultaneously setting a standard group: for 7 standards, 20. mu.L of BSA (bovine serum albumin) standard solutions at concentrations of 0. mu.g/mL, 50. mu.g/mL, 100. mu.g/mL, 150. mu.g/mL, 200. mu.g/mL, 250. mu.g/mL, and 300. mu.g/mL were added to each of the 1 replicates.

(2) 200. mu.L of Bradford working solution was added to each well simultaneously and mixed immediately.

(3) After reaction at room temperature (25-30 ℃) for 5min, the reading value of a sample well of 0 mug/mL is taken as a blank reference, and the A595 value of each well is read by a microplate reader.

(4) And drawing a standard curve by taking the A595 two-comparison average value in the standard group as an ordinate and the corresponding protein concentration as an abscissa.

(5) And calculating the concentration value of the protein after dilution by taking the standard curve as a reference, and calculating the concentration of the protein of the original sample according to the dilution times.

The detection result shows that: the protein concentration of the Trichoderma reesei Trdrs2 knockout strain delta drs2 is 158.21 mug/mL, the protein concentration of the Trichoderma reesei strain Tu6 delta tku70 is 55.54 mug/mL (figure 3), after the Trdrs2 gene is knocked out, the exocrine protein concentration of the Trichoderma reesei is 3 times of the protein concentration of the original strain, and the exocrine protein secretion amount of the Trdrs2 knockout strain is obviously improved compared with that of the Trichoderma reesei strain Tu6 delta tku 70. The Trdrs2 gene is proved to have the function of regulating the secretion amount of the trichoderma reesei extracellular protein.

The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, it is possible to make various improvements and modifications without departing from the technical principle of the present invention, and these improvements and modifications should also be considered as the protection scope of the present invention.

Sequence listing

<110> university of Fujian profession

Application of <120> Trdrs2 protein and related biological material thereof in regulation and control of protein synthesis and secretion capacity of trichoderma reesei

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 4188

<212> DNA

<213> Artificial Sequence

<400> 1

atggctggac gacatcccat aggaggccat ggcgggccct cgaccaccga cgacctgctg 60

ctcgacctgg acaatgagca gcccgtctac aacgccggcc agcggtcggc cctcaatgac 120

gacgacctgg cgcgggccta cgagcacgac cacgacaacg acccccagag ccgcccgtcg 180

gtgtcgtacg acgactttgt cggcgccgag ccgtcatatc ccccagcagg gcgccccggc 240

ctggcgcagg cagcgcagcc gtcggggcag tcgtcgggcc cgtaccacgc tcagcagttc 300

agccagtcgt cggacctcga caacttcccg cgctacgccg acgacttcga cgacgacgac 360

atgtactacc agcacggcgg cgcggcgggc gcggggccgg cgtcggctgg cagggacaat 420

gcgagggccc gcaacagcgt gctgtcgctg ggaggcggcc tctttggcaa gctgaagcac 480

cgcctgggca tgggccaggg ctactccgag atggacctcc ccttgacgga gccgggccac 540

gatcgaggcg gccccatagc gggctcgtcg cagccgccgg accagcagcc cgcgggcaag 600

aaggcgggca acttcaagtt tggctttggc cgcggcaagc ccgatcccgc gtccctgggc 660

ccgagaatca tccacctcaa caacccgccc gccaacgcgg ccaacaagta cgtcggcaac 720

cacatctcga cggcaaagta caacgtcgcc acgttcctcc ccaagttcct ctttgagcag 780

ttctccaagg tcgccaacat cttcttcctc ttcacggccg cgttgcagca gatccccgga 840

ctgtcgccca ccaacaagta caccacaatc ggacccctgg ctgttgtgct cctggtttct 900

gctggcaagg aattggtgga ggattaccgg agaagagtgg cggacaatgc cctcaacaca 960

tccaaggcgc gagtcctgcg cggctcgacg tttacggaaa cgaaatggaa caccgtggcc 1020

gtgggcgacg tggttagggt cgagtccgag gagccgttcc ccgccgatct ggtgcttctg 1080

gcaagttccg agcccgaggg tctctgttat atcgaaacgg cgaacctgga tggcgagacc 1140

aacttgaaga tcaagcaggc cctccccgag acgtcgacgc tggtgtcccc cagcgaagtc 1200

agccggctgg gaggtcgcat caagtcggag cagcccaaca gcagtctgta cacgtacgaa 1260

gcgacgctga tcatgcaagc cggaggagga gaaaaggagc tggcactgaa ccctgagcag 1320

ctgcttctcc gaggtgccac tctgagaaac actccctgga tccacggcat cgtcgtcttc 1380

accggccacg agaccaagct gatgcgaaac gcgaccgcga cgccgatcaa gcggaccaag 1440

gtcgagaggc agctcaactg gctcgtgctc atgctggtcg gcatgctgct ggtgctcagc 1500

gtcatcagta ccattggaga cttggtgatg cgaggcgcca ccggcgattc gctttcgtat 1560

ctctacctgg acaagatcga cagcgctggc gttgcggcct cgacgttctt caaggacatg 1620

gtcacgtact gggtgctctt ctccgcgctg gtccccatct ccctctttgt cacggtggaa 1680

ttggtcaagt attggcacgg catcctcatc aacgacgacc tcgacatgta ctacgacaag 1740

acggatacgc cggccacttg ccgaacgtcg agtctggtcg aggagcttgg catggtcgag 1800

tacgtgttct ctgacaagac tggcacgctc acttgcaaca tgatggagtt caagcagtgc 1860

tcgattggcg gcatcatgta tgccgaagag gttcccgagg accgccgagc gagcggcgcc 1920

gacgacgaag agacggctat ttacgacttc aaggcgctcc aggccaacct gacccaaggc 1980

catccgaccg cgggcatgat tgatcatttc ctttcgctgc tcgcaacctg ccacacggtc 2040

atccccgaga tggatgaaaa gggtcagatc aagtaccaag cggcctctcc cgacgaaggt 2100

gccctggtgg ccggagcggt taccatggga tacaagttta ctgcacgaaa gccaaagtcg 2160

gtcattatag aagccaacgg gcgagagatg gaatacgagc tgctggccgt ctgcgaattc 2220

aactcgacgc gcaagcgaat gtctgccatc ttccgctgcc cggacggaaa gattcgagtc 2280

tactgcaaag gtgccgacac cgtcattctt gagcggctca acgatcagaa cccccacgtc 2340

gaaatcaccc tgcggcacct ggaggagtac gcctcggagg ggctgcggac gctctgcttg 2400

gccatgcgcg aggtgcccga acaggagtac cgcgaatggc gccagatctt tgacacggcg 2460

gcgacgacgg tgggcggcaa ccgagccgat gagctggaca aggctgccga aatcattgaa 2520

cacgactttt acctcctggg agctactgcc attgaggacc gcctgcaaga cggcgttccg 2580

gagacgatcc acacgctgca gcaagccaac atcaaggtct gggttctgac aggagaccga 2640

caggaaacgg ccatcaacat tggcatgagt tgcaagctcc tgagcgagga catgatgctc 2700

ttgattgtca acgaagagtc gtcggccgca actcgtgata acatccaaaa gaagctcgat 2760

gccatcagga cgcaaggcga cggtaccatt gagatggagt ccctggcgct cgtcattgac 2820

ggcaagtccc tgacatatgc gctcgagaag gacatggaga agcttttcct cgatctcgcc 2880

atcatgtgca aggccgtcat ctgctgccgt gtgtcccccc tgcaaaaggc cctggtcgtc 2940

aagctcgtca agaagtacca gaagcagtcg attctcctcg ccattggcga cggggccaac 3000

gacgtctcca tgatccaggc ggcgcacatt ggcgtcggca tcagcggtgt tgaaggtctg 3060

caggccgctc ggagcgccga cgtggccatt gcccagttca ggtacctccg gaagctgctg 3120

cttgtccacg gcgcgtggag ttaccagcgc gtgagcaaga cgattctgtt ttcgttctac 3180

aagaacattg ccctgtatct gacgcagttc tggtacacgt tccaaaacgt cttctccggc 3240

caggtcattt acgagtcgtg gacgttgtcc ttctacaacg tcttctacac cgttcttccg 3300

ccgctggcca ttggcattct ggaccagttc atctctgcgc gcctgctcga tcgctacccc 3360

cagctgtaca tgatgggcca gcagaattcc gccttcaagc tcaaggtctt tgcgcagtgg 3420

atcgccaacg ccatctacca ctccctcctc ctctacgtct ttgccgagct catctggtac 3480

ggcgacgtga ttgacggcca ggggcagacc gacggccact gggtgtgggg aaccgccctg 3540

tacggctccg tcctgctcac cgtgctgggc aaggcggcct tggtgaccaa caactggacc 3600

aagtaccatg tcatggccat cccgggcagc atggtcatct ggtgggtgtt catcgccgtg 3660

tacggcactg tggcgcccaa ggtcaagatt tcccccgagt actttggcgt catccccaag 3720

ctgtacagca gccccgtctt ctggctgcag atattcgtcc ttgccctgct gtgtctgtcg 3780

cgcgatattg cttggaagta cgccaagcgc atgtactggc cgcagacgta ccaccacatt 3840

caggagattc aaaaatacaa cattcaggac taccggccta ggtatgtaca cgtgcccagc 3900

acagcccctc tcctcccctc ttcttgcccc aggaatccat ctgcggtttg aatagaggca 3960

tgtctatata tgagagagag ccacgcgcta acgtgccatg acaggatgga gcaattccag 4020

aaagccatcc gcaaggttcg gcaggtgcag cgtatgcgca agcagcgtgg ctatgccttt 4080

tcgcaggccg acgagagcca gacgcgcgtg cttcaggcat acgacacgac caagcaccga 4140

ggccgatatg gagaaatggc cagctcacga cctatagacg ggatataa 4188

<210> 2

<211> 12500

<212> DNA

<213> Artificial Sequence

<400> 2

aaaggacgag atggaccgcg ccaagaacgg gccgccgctg aggtttgaga tgccggcgct 60

gtttgttgcg gcgagcaagg acaatgcttt gccgccggcc atgtccaagg gcatggacgc 120

tttctacaag gaccttacca gggccgaggt ggatgctacg cattgggctt tgacgcaggc 180

tggggatgag gtcaatcggg tgattggaga gtggttgaac aaggcgctca atggtgcgac 240

caaggctgcg ttgtagaaat cgaggagaat attcaaatga tcatgaattg ggctaacata 300

aggaaacccc cgacttgctt ggatctcagc atttgctaga catctggtag cagcttgctg 360

taactccctt ttgtacatgt tgagctatga ccgtataccc ctgaatatag ttcccgtaga 420

atctagttgt gccgtccata tcgtttcgag gttgacaggt atcaagtaaa catttcttcg 480

tgactctgcc tccaacatgt ctccaaggtg ttggggatcg tgtgccgcgt ttcttgggcg 540

ttgctggtgt tgaacaaaca tgctgttgct ttgtggccac acgcacatac acacacacgc 600

cgctttgggg agattccgtt cactgcttcg cgccccttct gctttagtac cttcaagagt 660

ccattaattg attcattcct ggcgagtcat ttcacttcag agtgtttttg taagcatcaa 720

cagtcggtgc cttggaggtg gactttttgt ttggctttcc acacatggga catgctgtgt 780

gctaatgtga gcttgggtgt tcatgtgaag ggggaaaagg cggagagact cacagtccgt 840

ctggtaggca cacttctggc aataggaatg gccttgagtg attttggttt tgcactttga 900

gcacgaacta ttcccactgt cagtcaaaag cgcaatgcac atatagagaa tgcgattgcg 960

taggtaggat ggtgcacata cctggagtac tgtgcgtatg gattctttgc tgcttttgac 1020

agcagcttgc tctggaggcc cgttagcgag cattatcgag gaatgacggg aagcagtctt 1080

cgtttacctt tgacactccg gtgttgccca gagttgctga tttggagctg cctgcctttg 1140

cgctggctgg cgagccgtag tacatttcgc tcttcttctt gacctctgga gtcgcaagct 1200

tggtgctctt ggtgagcttc agacacttgc tgcacaccat cgcggcgtct gaatgggggg 1260

tttatctgat tgagtcgggt tgagtatcga tggatttgat aaggaatatg tcagatagcg 1320

ttcgatacta ttgtccgtgg ttcagcttga tggccgcatg ctcgactttc tggtgtttga 1380

tgggtgaatc gcagtggcaa ggctgacatc aacggcaacg cgaaacccgg cactccgtac 1440

ggcttccgcg gccatactgt tccgaattcc caacgaccag ctgcaaagta tcctcaaccg 1500

tgctctggca ttcggcaagg taccatgctc gcacaatctc gctggtgggg gactttgtcg 1560

caaaagggac aacgctcagg gggacccgcc aaacaggcct ctcagcagtg gagcagcagc 1620

agcacatcag tgcagttcaa ggcgaggtcc agcctgtggc atccccccaa gcgatccatg 1680

gatgcgctag agcacttgca gagagagcgc tggagccctt ggacgacgtt gaccccggac 1740

ggcccccttt caggccactt ggcgcaagag agcttccagg tcatcaaggg ttcaagacgg 1800

gctcgtatgc atcagatcaa atcaaacagc atcccagggg agcgctggag aacttgagct 1860

tacaggtgtt tggcattgat ccgtgctccc agtctataat tattacccta cgggggacct 1920

ctcgggtatc agcgccttgg tcgcagaact gcactgagct ttcgtgcccc caagattcaa 1980

atcgtcgggt ccaactgcgc ctctgtttca ctgccgacag tgctgacgta ccaaacgcct 2040

gagcctcgac agcgtcccgc tacggagtgg gagcgattta gcggcagctc gccgaaacga 2100

ggctgtgcag ggacgggaac cttcattgga ttggaacacc ttctcgaacg ctttttttta 2160

gcggaacagc atcagactct acagcgagcg gccctgccct atcgatatcg cgggaccaga 2220

ccaggtgtcg accccgatcg ttctcgagct gctgtgcgag tccgtctcct gcatacctaa 2280

cctaaggaac ctctacctat agacatccaa tacattcgca tccacccgcg agcggctgcg 2340

gtttcacatt ccagccctcc cacggacgca gcgaaacagc cgcgaaacat ccaaaaacac 2400

cacaacacac acagcttctc gggctggccc accctcatcg aagcccgcat gcgttgcccc 2460

tccgcctcag cgaccgccta accactgctc gtcctccggc atggctggac gacatcccat 2520

aggaggccat ggcgggccct cgaccaccga cgacctgctg ctcgacctgg acaatgagca 2580

gcccgtctac aacgccggcc agcggtcggc cctcaatgac gacgacctgg cgcgggccta 2640

cgagcacgac cacgacaacg acccccagag ccgcccgtcg gtgtcgtacg acgactttgt 2700

cggcgccgag ccgtcatatc ccccagcagg gcgccccggc ctggcgcagg cagcgcagcc 2760

gtcggggcag tcgtcgggcc cgtaccacgc tcagcagttc agccagtcgt cggacctcga 2820

caacttcccg cgctacgccg acgacttcga cgacgacgac atgtactacc agcacggcgg 2880

cgcggcgggc gcggggccgg cgtcggctgg cagggacaat gcgagggccc gcaacagcgt 2940

gctgtcgctg ggaggcggcc tctttggcaa gctgaagcac cgcctgggca tgggccaggg 3000

ctactccgag atggacctcc ccttgacgga gccgggccac gatcgaggcg gccccatagc 3060

gggctcgtcg cagccgccgg accagcagcc cgcgggcaag aaggcgggca acttcaagtt 3120

tggctttggc cgcggcaagc ccgatcccgc gtccctgggc ccgagaatca tccacctcaa 3180

caacccgccc gccaacgcgg ccaacaagta cgtcggcaac cacatctcga cggcaaagta 3240

caacgtcgcc acgttcctcc ccaagttcct ctttgagcag ttctccaagg tcgccaacat 3300

cttcttcctc ttcacggccg cgttgcagca gatccccgga ctgtcgccca ccaacaagta 3360

caccacaatc ggacccctgg ctgttgtgct cctggtttct gctggcaagg aattggtgga 3420

ggattaccgg agaagagtgg cggacaatgc cctcaacaca tccaaggcgc gagtcctgcg 3480

cggctcgacg tttacggaaa cgaaatggaa caccgtggcc gtgggcgacg tggttagggt 3540

cgagtccgag gagccgttcc ccgccgatct ggtgcttctg gcaagttccg agcccgaggg 3600

tctctgttat atcgaaacgg cgaacctgga tggcgagacc aacttgaaga tcaagcaggc 3660

cctccccgag acgtcgacgc tggtgtcccc cagcgaagtc agccggctgg gaggtcgcat 3720

caagtcggag cagcccaaca gcagtctgta cacgtacgaa gcgacgctga tcatgcaagc 3780

cggaggagga gaaaaggagc tggcactgaa ccctgagcag ctgcttctcc gaggtgccac 3840

tctgagaaac actccctgga tccacggcat cgtcgtcttc accggccacg agaccaagct 3900

gatgcgaaac gcgaccgcga cgccgatcaa gcggaccaag gtcgagaggc agctcaactg 3960

gctcgtgctc atgctggtcg gcatgctgct ggtgctcagc gtcatcagta ccattggaga 4020

cttggtgatg cgaggcgcca ccggcgattc gctttcgtat ctctacctgg acaagatcga 4080

cagcgctggc gttgcggcct cgacgttctt caaggacatg gtcacgtact gggtgctctt 4140

ctccgcgctg gtccccatct ccctctttgt cacggtggaa ttggtcaagt attggcacgg 4200

catcctcatc aacgacgacc tcgacatgta ctacgacaag acggatacgc cggccacttg 4260

ccgaacgtcg agtctggtcg aggagcttgg catggtcgag tacgtgttct ctgacaagac 4320

tggcacgctc acttgcaaca tgatggagtt caagcagtgc tcgattggcg gcatcatgta 4380

tgccgaagag gttcccgagg accgccgagc gagcggcgcc gacgacgaag agacggctat 4440

ttacgacttc aaggcgctcc aggccaacct gacccaaggc catccgaccg cgggcatgat 4500

tgatcatttc ctttcgctgc tcgcaacctg ccacacggtc atccccgaga tggatgaaaa 4560

gggtcagatc aagtaccaag cggcctctcc cgacgaaggt gccctggtgg ccggagcggt 4620

taccatggga tacaagttta ctgcacgaaa gccaaagtcg gtcattatag aagccaacgg 4680

gcgagagatg gaatacgagc tgctggccgt ctgcgaattc aactcgacgc gcaagcgaat 4740

gtctgccatc ttccgctgcc cggacggaaa gattcgagtc tactgcaaag gtgccgacac 4800

cgtcattctt gagcggctca acgatcagaa cccccacgtc gaaatcaccc tgcggcacct 4860

ggaggagtac gcctcggagg ggctgcggac gctctgcttg gccatgcgcg aggtgcccga 4920

acaggagtac cgcgaatggc gccagatctt tgacacggcg gcgacgacgg tgggcggcaa 4980

ccgagccgat gagctggaca aggctgccga aatcattgaa cacgactttt acctcctggg 5040

agctactgcc attgaggacc gcctgcaaga cggcgttccg gagacgatcc acacgctgca 5100

gcaagccaac atcaaggtct gggttctgac aggagaccga caggaaacgg ccatcaacat 5160

tggcatgagt tgcaagctcc tgagcgagga catgatgctc ttgattgtca acgaagagtc 5220

gtcggccgca actcgtgata acatccaaaa gaagctcgat gccatcagga cgcaaggcga 5280

cggtaccatt gagatggagt ccctggcgct cgtcattgac ggcaagtccc tgacatatgc 5340

gctcgagaag gacatggaga agcttttcct cgatctcgcc atcatgtgca aggccgtcat 5400

ctgctgccgt gtgtcccccc tgcaaaaggc cctggtcgtc aagctcgtca agaagtacca 5460

gaagcagtcg attctcctcg ccattggcga cggggccaac gacgtctcca tgatccaggc 5520

ggcgcacatt ggcgtcggca tcagcggtgt tgaaggtctg caggccgctc ggagcgccga 5580

cgtggccatt gcccagttca ggtacctccg gaagctgctg cttgtccacg gcgcgtggag 5640

ttaccagcgc gtgagcaaga cgattctgtt ttcgttctac aagaacattg ccctgtatct 5700

gacgcagttc tggtacacgt tccaaaacgt cttctccggc caggtcattt acgagtcgtg 5760

gacgttgtcc ttctacaacg tcttctacac cgttcttccg ccgctggcca ttggcattct 5820

ggaccagttc atctctgcgc gcctgctcga tcgctacccc cagctgtaca tgatgggcca 5880

gcagaattcc gccttcaagc tcaaggtctt tgcgcagtgg atcgccaacg ccatctacca 5940

ctccctcctc ctctacgtct ttgccgagct catctggtac ggcgacgtga ttgacggcca 6000

ggggcagacc gacggccact gggtgtgggg aaccgccctg tacggctccg tcctgctcac 6060

cgtgctgggc aaggcggcct tggtgaccaa caactggacc aagtaccatg tcatggccat 6120

cccgggcagc atggtcatct ggtgggtgtt catcgccgtg tacggcactg tggcgcccaa 6180

ggtcaagatt tcccccgagt actttggcgt catccccaag ctgtacagca gccccgtctt 6240

ctggctgcag atattcgtcc ttgccctgct gtgtctgtcg cgcgatattg cttggaagta 6300

cgccaagcgc atgtactggc cgcagacgta ccaccacatt caggagattc aaaaatacaa 6360

cattcaggac taccggccta ggtatgtaca cgtgcccagc acagcccctc tcctcccctc 6420

ttcttgcccc aggaatccat ctgcggtttg aatagaggca tgtctatata tgagagagag 6480

ccacgcgcta acgtgccatg acaggatgga gcaattccag aaagccatcc gcaaggttcg 6540

gcaggtgcag cgtatgcgca agcagcgtgg ctatgccttt tcgcaggccg acgagagcca 6600

gacgcgcgtg cttcaggcat acgacacgac caagcaccga ggccgatatg gagaaatggc 6660

cagctcacga cctatagacg ggatataaaa aaagcaaaga aaaaattggg gggaggaaag 6720

agcaacagtt ttgtgtttta ggggtgggct gtaatgattt ttatctgcca tcacgtctca 6780

tgtcatcaag agagagagaa aaaaacagag gagggtggtg ttactccttg ggggggtgaa 6840

aggacgagga ggagagggca agcggcacac aagggaggtg cgtccctttt gtcctcgtta 6900

tgccgattcg gaagccagac gagggctatg atggttgatt ttgtttgctg tttgcggttt 6960

ttctgaaact agctattatg ccatatatga tgtctttgtc tggggtgtct cttgttgggt 7020

gttcttttct tgacatttat tatcatggct tgttactgaa ggggatgtga gatttctagg 7080

tagaaggata ggaaggcggt tgaatggaaa tttacattga catgagatgc ttggttattt 7140

gaagtgagga gaggtaagag tgatggtagt gttggtatat ggatgatgtt gcacggtgcg 7200

atgcattgag cttgaaatga aacagccgtg gagattcgat gttcactgag aagagttggc 7260

ttgtatactg gttgggtata gatatctcgt atgtcttgtg cctcattcgc acgatgtcta 7320

ccgtacgatg aagaggaagc ttccgcctgc cggacgagct tcccatgccg gagagtaact 7380

ctctctctct aatctataat aggtactttg ccttgggcct tacggtggca ccgtttgaag 7440

cttatatcaa gtcactgaca aaagtgtgta aaggatggat aaatctccat aaacagattg 7500

tttcgaacgg accttgggtg aatatcccgt agcagatggg acaatacgac actagattat 7560

tgacaaagag tttcggagac acaatgtcac acaggacaac aacagactcc tcccccacgg 7620

ataagataga ttagagtggc ggagatccgg agatgcaccc ttctgcatga cttgacgaga 7680

agcgcaagag tctctaccag gtatttctgt aaggggactc gtcgtacgag tttgaacagc 7740

aaatacctaa gcaagagagg agtatgaact tgcacagcat tatatgtgcg actacctaga 7800

tacgctgtgt cacatgttta tatgccgcga tgctgttgta tcggcatctg ttgcattgta 7860

tacctaatta gttgtcttga tgtccttaat actatcttct aaagtactag gtagttgata 7920

ctatgaatag tctacctact ttatatcgca cgcaaggggc gaagacaatg cgtggcgttg 7980

catgaggcag tctcgcgcac cacgacacga cacaaagagc actttatagg taggtatgta 8040

cctagttttt tggctcctgt tcatcccgag gcaggtgcac tctagataga agaggactag 8100

gcagtgctgc gtttccatgg cttcagatag gtacctatct acctacctac caaccaaggt 8160

gttaccttat tttgtgtatg acagctttta ccttaggtaa tgagcagcac ttcaagacgg 8220

actctttaga agaaatcaga attcgagagc cagctcaaca acggcaagag tgatactggt 8280

atttgtcatc tgcctacatt gctggatgtg ttaaatcagg caaacctgac acaatatcgg 8340

tacacagtct caatgcctga tgcaaagcca actgatatca catccgattc tacctaaaag 8400

cagcatcatg tacgagacgg tattcttgac ctgcatcaag ctttcgcccc cccccccccc 8460

cccccccccc cccccccccc ccccccatat gcgtacgtcc cgtatcacag gcatcaaaat 8520

cccaccgata tcccatgcag gtcccccttc catctctcac agcttccccc cctctgtaac 8580

accacatgat gtacagtaca agccacgctg caccgcagct ctcctacata atgatactac 8640

tactaacacc accacataca tacagacaga ccccaatttc cccttacata tccccctccc 8700

ctcttcacac caaaaacgga aagaaaaaaa aataagagga gagagagata aggtccgtat 8760

cattggtatg agagataaca gctctgtagc aaaagattga catcttgcat gcttatcagc 8820

tggttctctt gattctgaat cctcaggcca gaagacgcgc cgacatcgct gatgtactcg 8880

agacgattgc aacccaaacc aatcacatcc atcacacttg tgcagaatgc tgcctttcag 8940

cgaaaattta accatgttca ataacattat cctttattca ttgatttctc aattgcttcc 9000

ttgccatcta tgggttctgt tcgcgtcccc agagatgcat cgccgtcttt tgataaagta 9060

tatacataag ttgactccca tgtacagttg cccaccaaac atcaaattac catccaagta 9120

cccatatgcc gtgctttata tctaacccag tggacgtgta ataatcttgt gccaagaggc 9180

cataacagtc tttgtgaagt actaagagaa acaggaggaa aagggaagtg aagaaaagga 9240

aaagaaaaag aatccacaag tcgagttcga caagatgtcg aagcgaggcg acgtaacgct 9300

ccggggtcag gattggtgga ttgcagtcac actatgcggt gcatggtgac aagcaagagc 9360

ggctgataag agaagctcga gttgggatgt tgaaaaagcg ccgtgagggg cccagattga 9420

agccgtccaa agtgggaaag gatccgaaat cccctcgctg ccggaccact aatgacagtg 9480

atcgaacagt gaaaacagtt gaaaacatca aaacttttgt tgtgcgtaag tgtgtatctc 9540

cctgaagaac gccaaaggga aaaaaaaaga aaggaagaat agaagaataa cagttgtgcg 9600

gagtgtggtg cgaatgggct cggcaacagc aaaggagccg gacgagacca ggacctcaag 9660

tcggttggag gtggcacaac agcgtgctgc cagtcgacgg cgagaccctt gccgctgggc 9720

atccgcaccc ctgtaacccc gcagtccgaa tcaatgcgcc gtttggccag aattctggca 9780

aaatgcggag gcgcggtgtg cgtcggaggt cccatcacga catctgcacg cgccagtcct 9840

tgttcgtctg cgtcttattg cctggccacc cccacagcgg tggccgacgc tcccaggcca 9900

gtctggtgat aggccgctgc gagcccagct gctgctagcc ggcgtgccgt gcgcaagggg 9960

ggggaaaggg gccgctagag acgctcgagg cggatgggac tgcagccaac cgcttcgtcc 10020

catctcaggg cctcaaacaa ttaacccccc cgccagcaca cccacctggc tgcgtccgaa 10080

atcaccgagt cagcatgggg atgacaagct cgacgctctt tggccgcgag ctgccgcctg 10140

gggtcctcga gggcagcggc cggtccatgg ccccagaccc tgcctcgtgc gagtaggtgc 10200

ccccgtaggc caggtcgagg gtgctcgggt ggctgtacag aaggctggcc gatggtcgcg 10260

tgtacgagtt gttggggctg gtagctgagc tgcggctgaa gggccagatg ccactccccg 10320

acggcgacgg ggggctgggt ggcctcacgt tgagggatcg cagggcagac atggccgagg 10380

tgtggtagtt gagcgcggtg tctggtgaag ccggcggaga gttggtgaag tgcatcgagc 10440

tgggccgtga gggcgaggcc cgtggcacaa tgtctcgcgg ctcggacccg gccaaggact 10500

cggtcaggat gcggcgctgg ttgacgtaga cagaggagta atagctgcga accgacttgg 10560

cctgcgcgga cgagtcttgg tctacccggc ggcatctaca cacatgtgtg ttagtggacg 10620

tgatcaaccc agctcctcca aggttcgtcg tcaagaagag aaacatacgc atcggagcag 10680

tacagaacca gctcgtcgtg ggtgtggaat tccttttcgc aaatcatgct gcaggaacac 10740

aaaaggtcag ttacatggcc tcagcagcgt cacaaacaac aggagtggct tccataccag 10800

tactgaggga agctctctcg ctcgtcgttg tcccaaatct ccgtgtcggt ctcgcgacca 10860

cctcgcccca acttctgggc ggcggacgga gtgtgtcgtc gagtcatggt tggtcgcttg 10920

tactgagcgg gtgttgcggt cactgccttt cgcacgtctg ttgtcgatgc ggtggcagtg 10980

taagggccgg acttgcgtcg ctggtgaggc atttggaatg cagatagaag aggagcaagg 11040

gaaaaagtgc gtgggcgaac tcgaggtgtt atcctggcag ctcggagagc gtgggggaaa 11100

actaccagga ccgtccaagg cgtgagacga ccaaaatcag ggaagccaga cagaacgctg 11160

tgctggcttt atctccggca ggcagcgcag ccaaatcagg cgggtgtatg cgacacgtcg 11220

tattggagag tgcgcgagat taataagaga gtgacgcttt gctcgacagg cgtgacttgg 11280

gctgaagaat gacgggaggt cacaccggcg tagagagggt gaagattgat cgacaggacc 11340

cggaagatgg aaggatgctg cagatcgatt cgtcgggcag atttgctgtt atccactctt 11400

ggtgttcagt tgacaggagc agagcgtcga ctgctgagta gcttaaaagg gccaaatata 11460

gcagtggtat cgacggtcag atgataagca ccgcagaggg tgagatgagg tggatgggag 11520

ggcgtttggt gtaagtggtg gcacgggatg aaggtctagt gctgggttga ccggaggctg 11580

agctggactg tgatgtgtcg tcgataatgg ggtggtggtg taaggcgtat tcgcagattg 11640

atggaggaag ggaaaagaac ggatgaggaa gtagatttga acgagagtga gaggaggaag 11700

aggaggagga agaggtcgga aaagactggc gtgtgagacg cttttgttgt cgtgcttctg 11760

cttctccgta tttgtgcagg ctgtaagagg tacttgtata atatgcaatc tgatggcagc 11820

cgaaagcgga gactcgcagt tcactgcttg gtgacaaagt ttccagcagg gcgatcggcg 11880

cggacgggag taactttgcg tccagggcgg gtgccagcag cagcagcagg taccgatggt 11940

gacacactgt cgacgccggg ctccacaatg tcgcgatagt ggtactttgg ccctcgactc 12000

ggactttgct tggggggggc aggcagcgat gactcttttg tttttgtggg ctctcttgtc 12060

tccttttttc tttcttgcgt taagcttctt tttgtgaatg ctattttttt ttcttctcct 12120

ttattccgct ttaatatatt ttccccttca gaaacagaaa gaagctttcc aatgtttcaa 12180

aataaaacgt aaattgtgga acacagtctg gcaggctctt gtcgaagtcg ggcgtggtgc 12240

gaatcgctcg gatgaagcct cggtggtagg gctggactcg ttcgggcgga tgtactaccc 12300

agtactcgtg tggaggtacc tgtaagacgg gatcgcgccg gagaggtact tgtgtgcaca 12360

ggtgggagcg gtcgcaaggc cgtagcgttt attgagttgc tgacgtgctt atgggccaag 12420

attcgtacag tattagaagc tggagcacga ataataccca agcatggggt gcagcagttg 12480

gtttcagttg cttgtcttgc 12500

<210> 3

<211> 8188

<212> DNA

<213> Artificial Sequence

<400> 3

ctccaaggtg ttggggatcg tgtgccgcgt ttcttgggcg ttgctggtgt tgaacaaaca 60

tgctgttgct ttgtggccac acgcacatac acacacacgc cgctttgggg agattccgtt 120

cactgcttcg cgccccttct gctttagtac cttcaagagt ccattaattg attcattcct 180

ggcgagtcat ttcacttcag agtgtttttg taagcatcaa cagtcggtgc cttggaggtg 240

gactttttgt ttggctttcc acacatggga catgctgtgt gctaatgtga gcttgggtgt 300

tcatgtgaag ggggaaaagg cggagagact cacagtccgt ctggtaggca cacttctggc 360

aataggaatg gccttgagtg attttggttt tgcactttga gcacgaacta ttcccactgt 420

cagtcaaaag cgcaatgcac atatagagaa tgcgattgcg taggtaggat ggtgcacata 480

cctggagtac tgtgcgtatg gattctttgc tgcttttgac agcagcttgc tctggaggcc 540

cgttagcgag cattatcgag gaatgacggg aagcagtctt cgtttacctt tgacactccg 600

gtgttgccca gagttgctga tttggagctg cctgcctttg cgctggctgg cgagccgtag 660

tacatttcgc tcttcttctt gacctctgga gtcgcaagct tggtgctctt ggtgagcttc 720

agacacttgc tgcacaccat cgcggcgtct gaatgggggg tttatctgat tgagtcgggt 780

tgagtatcga tggatttgat aaggaatatg tcagatagcg ttcgatacta ttgtccgtgg 840

ttcagcttga tggccgcatg ctcgactttc tggtgtttga tgggtgaatc gcagtggcaa 900

ggctgacatc aacggcaacg cgaaacccgg cactccgtac ggcttccgcg gccatactgt 960

tccgaattcc caacgaccag ctgcaaagta tcctcaaccg tgctctggca ttcggcaagg 1020

taccatgctc gcacaatctc gctggtgggg gactttgtcg caaaagggac aacgctcagg 1080

gggacccgcc aaacaggcct ctcagcagtg gagcagcagc agcacatcag tgcagttcaa 1140

ggcgaggtcc agcctgtggc atccccccaa gcgatccatg gatgcgctag agcacttgca 1200

gagagagcgc tggagccctt ggacgacgtt gaccccggac ggcccccttt caggccactt 1260

ggcgcaagag agcttccagg tcatcaaggg ttcaagacgg gctcgtatgc atcagatcaa 1320

atcaaacagc atcccagggg agcgctggag aacttgagct tacaggtgtt tggcattgat 1380

ccgtgctccc agtctataat tattacccta cgggggacct ctcgggtatc agcgccttgg 1440

tcgcagaact gcactgagct ttcgtgcccc caagattcaa atcgtcgggt ccaactgcgc 1500

ctctgtttca ctgccgacag tgctgacgta ccaaacgcct gagcctcgac agcgtcccgc 1560

tacggagtgg gagcgattta gcggcagctc gccgaaacga ggctgtgcag ggacgggaac 1620

cttcattgga ttggaacacc ttctcgaacg ctttttttta gcggaacagc atcagactct 1680

acagcgagcg gccctgccct atcgatatcg cgggaccaga ccaggtgtcg accccgatcg 1740

ttctcgagct gctgtgcgag tccgtctcct gcatacctaa cctaaggaac ctctacctat 1800

agacatccaa tacattcgca tccacccgcg agcggctgcg gtttcacatt ccagccctcc 1860

cacggacgca gcgaaacagc cgcgaaacat ccaaaaacac cacaacacac acagcttctc 1920

gggctggccc accctcatcg aagcccgcat gcgttgcccc tccgcctcag cgaccgccta 1980

accactgctc gtcctccggc atggctggac gacatcccat aggaggccat ggcgggccct 2040

cgaccaccga cgacctgctg ctcgacctgg acaatgagca gcccgtctac aacgccggcc 2100

agcggtcggc cctcaatgac gacgacctgg cgcgggccta cgagcacgac cacgacaacg 2160

acccccagag ccgcccgtcg gtgtcgtacg acgactttgt cggcgccgag ccgtcatatc 2220

ccccagcagg gcgccccggc ctggcgcagg cagcgcagcc gtcggggcag tcgtcgggcc 2280

cgtaccacgc tcagcagttc agccagtcgt cggacctcga caacttcccg cgctacgccg 2340

acgacttcga cgacgacgac atgtactacc agcacggcgg cgcggcgggc gcggggccgg 2400

cgtcggctgg cagggacaat gcgagggccc gcaacagcgt gctgtcgctg ggaggcggcc 2460

tctttggcaa gctgaagcac cgcctgggca tgggccaggg ctactccgag atggacctcc 2520

ccttgacgga gccgggccac gatcgaggcg gccccatagc gggctcgtcg cagccgccgg 2580

accagcagcc cgcgggcaag aaggcgggca acttcaagtt tggctttggc cgcggcaagc 2640

ccgatcccgc gtccctgggc ccgagaatca tccacctcaa caacccgccc gccaacgcgg 2700

ccaacaagta cgtcggcaac cacatctcga cggcaaagta caacgtcgcc acgttcctcc 2760

ccaagttcct ctttgagcag ttctccaagg tcgccaacat cttcttcctc ttcacggccg 2820

cgttgcagca gatccccgga ctgtcgccca ccaacaagta caccacaatc ggacccctgg 2880

ctgttgtgct cctggtttct gctggcaagg aattggtgga ggattaccgg agaagagtgg 2940

cggacaatgc cctcaacaca tccaaggcgc gagtcctgcg cggctcgacg tttacggaaa 3000

cgaaatggaa caccgtggcc gtgggcgacg tggttagggt cgagtccgag gagccgttcc 3060

ccgccgatct ggtgcttctg gcaagttccg agcccgaggg tctctgttat atcgaaacgg 3120

cgaacctgga tggcgagacc aacttgaaga tcaagcaggc cctccccgag acgtcgacgc 3180

tggtgtcccc cagcgaagtc agccggctgg gaggtcgcat caagtcggag cagcccaaca 3240

gcagtctgta cacgtacgaa gcgacgctga tcatgcaagc cggaggagga gaaaaggagc 3300

tggcactgaa ccctgagcag ctgcttctcc gaggtgccac tctgagaaac actccctgga 3360

tccacggcat cgtcgtcttc accggccacg agaccaagct gatgcgaaac gcgaccgcga 3420

cgccgatcaa gcggaccaag gtcgagaggc agctcaactg gctcgtgctc atgctggtcg 3480

gcatgctgct ggtgctcagc gtcatcagta ccattggaga cttggtgatg cgaggcgcca 3540

ccggcgattc gctttcgtat ctctacctgg acaagatcga cagcgctggc gttgcggcct 3600

cgacgttctt caaggacatg gtcacgtact gggtgctctt ctccgcgctg gtccccatct 3660

ccctctttgt cacggtggaa ttggtcaagt attggcacgg catcctcatc aacgacgacc 3720

tcgacatgta ctacgacaag acggatacgc cggccacttg ccgaacgtcg agtctggtcg 3780

aggagcttgg catggtcgag tacgtgttct ctgacaagac tggcacgctc acttgcaaca 3840

tgatggagtt caagcagtgc tcgattggcg gcatcatgta tgccgaagag gttcccgagg 3900

accgccgagc gagcggcgcc gacgacgaag agacggctat ttacgacttc aaggcgctcc 3960

aggccaacct gacccaaggc catccgaccg cgggcatgat tgatcatttc ctttcgctgc 4020

tcgcaacctg ccacacggtc atccccgaga tggatgaaaa gggtcagatc aagtaccaag 4080

cggcctctcc cgacgaaggt gccctggtgg ccggagcggt taccatggga tacaagttta 4140

ctgcacgaaa gccaaagtcg gtcattatag aagccaacgg gcgagagatg gaatacgagc 4200

tgctggccgt ctgcgaattc aactcgacgc gcaagcgaat gtctgccatc ttccgctgcc 4260

cggacggaaa gattcgagtc tactgcaaag gtgccgacac cgtcattctt gagcggctca 4320

acgatcagaa cccccacgtc gaaatcaccc tgcggcacct ggaggagtac gcctcggagg 4380

ggctgcggac gctctgcttg gccatgcgcg aggtgcccga acaggagtac cgcgaatggc 4440

gccagatctt tgacacggcg gcgacgacgg tgggcggcaa ccgagccgat gagctggaca 4500

aggctgccga aatcattgaa cacgactttt acctcctggg agctactgcc attgaggacc 4560

gcctgcaaga cggcgttccg gagacgatcc acacgctgca gcaagccaac atcaaggtct 4620

gggttctgac aggagaccga caggaaacgg ccatcaacat tggcatgagt tgcaagctcc 4680

tgagcgagga catgatgctc ttgattgtca acgaagagtc gtcggccgca actcgtgata 4740

acatccaaaa gaagctcgat gccatcagga cgcaaggcga cggtaccatt gagatggagt 4800

ccctggcgct cgtcattgac ggcaagtccc tgacatatgc gctcgagaag gacatggaga 4860

agcttttcct cgatctcgcc atcatgtgca aggccgtcat ctgctgccgt gtgtcccccc 4920

tgcaaaaggc cctggtcgtc aagctcgtca agaagtacca gaagcagtcg attctcctcg 4980

ccattggcga cggggccaac gacgtctcca tgatccaggc ggcgcacatt ggcgtcggca 5040

tcagcggtgt tgaaggtctg caggccgctc ggagcgccga cgtggccatt gcccagttca 5100

ggtacctccg gaagctgctg cttgtccacg gcgcgtggag ttaccagcgc gtgagcaaga 5160

cgattctgtt ttcgttctac aagaacattg ccctgtatct gacgcagttc tggtacacgt 5220

tccaaaacgt cttctccggc caggtcattt acgagtcgtg gacgttgtcc ttctacaacg 5280

tcttctacac cgttcttccg ccgctggcca ttggcattct ggaccagttc atctctgcgc 5340

gcctgctcga tcgctacccc cagctgtaca tgatgggcca gcagaattcc gccttcaagc 5400

tcaaggtctt tgcgcagtgg atcgccaacg ccatctacca ctccctcctc ctctacgtct 5460

ttgccgagct catctggtac ggcgacgtga ttgacggcca ggggcagacc gacggccact 5520

gggtgtgggg aaccgccctg tacggctccg tcctgctcac cgtgctgggc aaggcggcct 5580

tggtgaccaa caactggacc aagtaccatg tcatggccat cccgggcagc atggtcatct 5640

ggtgggtgtt catcgccgtg tacggcactg tggcgcccaa ggtcaagatt tcccccgagt 5700

actttggcgt catccccaag ctgtacagca gccccgtctt ctggctgcag atattcgtcc 5760

ttgccctgct gtgtctgtcg cgcgatattg cttggaagta cgccaagcgc atgtactggc 5820

cgcagacgta ccaccacatt caggagattc aaaaatacaa cattcaggac taccggccta 5880

ggtatgtaca cgtgcccagc acagcccctc tcctcccctc ttcttgcccc aggaatccat 5940

ctgcggtttg aatagaggca tgtctatata tgagagagag ccacgcgcta acgtgccatg 6000

acaggatgga gcaattccag aaagccatcc gcaaggttcg gcaggtgcag cgtatgcgca 6060

agcagcgtgg ctatgccttt tcgcaggccg acgagagcca gacgcgcgtg cttcaggcat 6120

acgacacgac caagcaccga ggccgatatg gagaaatggc cagctcacga cctatagacg 6180

ggatataaaa aaagcaaaga aaaaattggg gggaggaaag agcaacagtt ttgtgtttta 6240

ggggtgggct gtaatgattt ttatctgcca tcacgtctca tgtcatcaag agagagagaa 6300

aaaaacagag gagggtggtg ttactccttg ggggggtgaa aggacgagga ggagagggca 6360

agcggcacac aagggaggtg cgtccctttt gtcctcgtta tgccgattcg gaagccagac 6420

gagggctatg atggttgatt ttgtttgctg tttgcggttt ttctgaaact agctattatg 6480

ccatatatga tgtctttgtc tggggtgtct cttgttgggt gttcttttct tgacatttat 6540

tatcatggct tgttactgaa ggggatgtga gatttctagg tagaaggata ggaaggcggt 6600

tgaatggaaa tttacattga catgagatgc ttggttattt gaagtgagga gaggtaagag 6660

tgatggtagt gttggtatat ggatgatgtt gcacggtgcg atgcattgag cttgaaatga 6720

aacagccgtg gagattcgat gttcactgag aagagttggc ttgtatactg gttgggtata 6780

gatatctcgt atgtcttgtg cctcattcgc acgatgtcta ccgtacgatg aagaggaagc 6840

ttccgcctgc cggacgagct tcccatgccg gagagtaact ctctctctct aatctataat 6900

aggtactttg ccttgggcct tacggtggca ccgtttgaag cttatatcaa gtcactgaca 6960

aaagtgtgta aaggatggat aaatctccat aaacagattg tttcgaacgg accttgggtg 7020

aatatcccgt agcagatggg acaatacgac actagattat tgacaaagag tttcggagac 7080

acaatgtcac acaggacaac aacagactcc tcccccacgg ataagataga ttagagtggc 7140

ggagatccgg agatgcaccc ttctgcatga cttgacgaga agcgcaagag tctctaccag 7200

gtatttctgt aaggggactc gtcgtacgag tttgaacagc aaatacctaa gcaagagagg 7260

agtatgaact tgcacagcat tatatgtgcg actacctaga tacgctgtgt cacatgttta 7320

tatgccgcga tgctgttgta tcggcatctg ttgcattgta tacctaatta gttgtcttga 7380

tgtccttaat actatcttct aaagtactag gtagttgata ctatgaatag tctacctact 7440

ttatatcgca cgcaaggggc gaagacaatg cgtggcgttg catgaggcag tctcgcgcac 7500

cacgacacga cacaaagagc actttatagg taggtatgta cctagttttt tggctcctgt 7560

tcatcccgag gcaggtgcac tctagataga agaggactag gcagtgctgc gtttccatgg 7620

cttcagatag gtacctatct acctacctac caaccaaggt gttaccttat tttgtgtatg 7680

acagctttta ccttaggtaa tgagcagcac ttcaagacgg actctttaga agaaatcaga 7740

attcgagagc cagctcaaca acggcaagag tgatactggt atttgtcatc tgcctacatt 7800

gctggatgtg ttaaatcagg caaacctgac acaatatcgg tacacagtct caatgcctga 7860

tgcaaagcca actgatatca catccgattc tacctaaaag cagcatcatg tacgagacgg 7920

tattcttgac ctgcatcaag ctttcgcccc cccccccccc cccccccccc cccccccccc 7980

ccccccatat gcgtacgtcc cgtatcacag gcatcaaaat cccaccgata tcccatgcag 8040

gtcccccttc catctctcac agcttccccc cctctgtaac accacatgat gtacagtaca 8100

agccacgctg caccgcagct ctcctacata atgatactac tactaacacc accacataca 8160

tacagacaga ccccaatttc cccttaca 8188

<210> 4

<211> 5913

<212> DNA

<213> Artificial Sequence

<400> 4

ctccaaggtg ttggggatcg tgtgccgcgt ttcttgggcg ttgctggtgt tgaacaaaca 60

tgctgttgct ttgtggccac acgcacatac acacacacgc cgctttgggg agattccgtt 120

cactgcttcg cgccccttct gctttagtac cttcaagagt ccattaattg attcattcct 180

ggcgagtcat ttcacttcag agtgtttttg taagcatcaa cagtcggtgc cttggaggtg 240

gactttttgt ttggctttcc acacatggga catgctgtgt gctaatgtga gcttgggtgt 300

tcatgtgaag ggggaaaagg cggagagact cacagtccgt ctggtaggca cacttctggc 360

aataggaatg gccttgagtg attttggttt tgcactttga gcacgaacta ttcccactgt 420

cagtcaaaag cgcaatgcac atatagagaa tgcgattgcg taggtaggat ggtgcacata 480

cctggagtac tgtgcgtatg gattctttgc tgcttttgac agcagcttgc tctggaggcc 540

cgttagcgag cattatcgag gaatgacggg aagcagtctt cgtttacctt tgacactccg 600

gtgttgccca gagttgctga tttggagctg cctgcctttg cgctggctgg cgagccgtag 660

tacatttcgc tcttcttctt gacctctgga gtcgcaagct tggtgctctt ggtgagcttc 720

agacacttgc tgcacaccat cgcggcgtct gaatgggggg tttatctgat tgagtcgggt 780

tgagtatcga tggatttgat aaggaatatg tcagatagcg ttcgatacta ttgtccgtgg 840

ttcagcttga tggccgcatg ctcgactttc tggtgtttga tgggtgaatc gcagtggcaa 900

ggctgacatc aacggcaacg cgaaacccgg cactccgtac ggcttccgcg gccatactgt 960

tccgaattcc caacgaccag ctgcaaagta tcctcaaccg tgctctggca ttcggcaagg 1020

taccatgctc gcacaatctc gctggtgggg gactttgtcg caaaagggac aacgctcagg 1080

gggacccgcc aaacaggcct ctcagcagtg gagcagcagc agcacatcag tgcagttcaa 1140

ggcgaggtcc agcctgtggc atccccccaa gcgatccatg gatgcgctag agcacttgca 1200

gagagagcgc tggagccctt ggacgacgtt gaccccggac ggcccccttt caggccactt 1260

ggcgcaagag agcttccagg tcatcaaggg ttcaagacgg gctcgtatgc atcagatcaa 1320

atcaaacagc atcccagggg agcgctggag aacttgagct tacaggtgtt tggcattgat 1380

ccgtgctccc agtctataat tattacccta cgggggacct ctcgggtatc agcgccttgg 1440

tcgcagaact gcactgagct ttcgtgcccc caagattcaa atcgtcgggt ccaactgcgc 1500

ctctgtttca ctgccgacag tgctgacgta ccaaacgcct gagcctcgac agcgtcccgc 1560

tacggagtgg gagcgattta gcggcagctc gccgaaacga ggctgtgcag ggacgggaac 1620

cttcattgga ttggaacacc ttctcgaacg ctttttttta gcggaacagc atcagactct 1680

acagcgagcg gccctgccct atcgatatcg cgggaccaga ccaggtgtcg accccgatcg 1740

ttctcgagct gctgtgcgag tccgtctcct gcatacctaa cctaaggaac ctctacctat 1800

agacatccaa tacattcgca tccacccgcg agcggctgcg gtttcacatt ccagccctcc 1860

cacggacgca gcgaaacagc cgcgaaacat ccaaaaacac cacaacacac acagcttctc 1920

gggctggccc accctcatcg aagcccgcat gcgttgcccc tccgcctcag cgaccgccta 1980

accactgctc gtcctccggc ccccaaagtc gcaatatcgg gtatcgccgc cggcattgaa 2040

tcgccttctc cgctagcatc gactactgct gctctgctct cgttgccagc gctgctccct 2100

agaattttga ccaggggacg agcccgacat taaagcaact ccctcgcctc gagacgactc 2160

ggatcgcacg aaattctccc aatcgccgac agttcctact cctcttcctc ccgcacggct 2220

gtcgcgcttc caacgtcatt cgcacagcag aattgtgcca tctctctctt ttttttcccc 2280

ccctctaaac cgccacaacg gcaccctaag ggttaaacta tccaaccagc cgcagcctca 2340

gcctctctca gcctcatcag ccatggcacc acacccgacg ctcaaggcca ccttcgcggc 2400

caggagcgag acggcgacgc acccgctgac ggcttacctg ttcaagctca tggacctcaa 2460

ggcgtccaac ctgtgcctga gcgccgacgt gccgacagcg cgcgagctgc tgtacctggc 2520

cgacaagatt ggcccgtcga ttgtcgtgct caagacgcac tacgacatgg tctcgggctg 2580

ggacttccac ccggagacgg gcacgggagc ccagctggcg tcgctggcgc gcaagcacgg 2640

cttcctcatc ttcgaggacc gcaagtttgg cgacattggc cacaccgtcg agctgcagta 2700

cacgggcggg tcggcgcgca tcatcgactg ggcgcacatt gtcaacgtca acatggtgcc 2760

cggcaaggcg tcggtggcct cgctggccca gggcgccaag cgctggctcg agcgctaccc 2820

ctgcgaggtc aagacgtccg tcaccgtcgg cacgcccacc atggactcgt ttgacgacga 2880

cgccgactcc agggacgccg agcccgccgg cgccgtcaac ggcatgggct ccattggcgt 2940

cctggacaag cccatctact cgaaccggtc cggcgacggc cgcaagggca gcatcgtctc 3000

catcaccacc gtcacccagc agtacgagtc cgtctcctcg ccccggttaa caaaggccat 3060

cgccgagggc gacgagtcgc tcttcccggg catcgaggag gcgccgctga gccgcggcct 3120

cctgatcctc gcccaaatgt ccagccaggg caacttcatg aacaaggagt acacgcaggc 3180

ctgcgtcgag gccgcccggg agcacaagga ctttgtcatg ggcttcatct cgcaggagac 3240

gctcaacacc gagcccgacg atgcctttat ccacatgacg cccggctgcc agctgccccc 3300

cgaagacgag gaccagcaga ccaacggatc ggtcggtgga gacggccagg gccagcagta 3360

caacacgccg cacaagctga ttggcatcgc cggcagcgac attgccattg tgggccgggg 3420

catcctcaag gcctcagacc ccgtagagga ggcagagcgg taccgatcag cagcgtggaa 3480

agcctacacc gagaggctgc tgcgataggg gagggaaggg aagaaagaag taaagaaagg 3540

catttagcaa gaagggggaa aagggaggga ggacaaacgg agctgagaaa gagctcttgt 3600

ccaaagcccg gcatcataga atgcagctgt atttaggcga cctctttttc catcttgtcg 3660

atttttgtta tgacgtacca gttgggatga tggatgattg taccccagct gcgattgatg 3720

tgtatctttg catgcaacaa cacgcgatgg cggaggcgaa ctgcacattg gaaggttcat 3780

atatggtcct gacatatctg gtggatctgg aagcatggaa ttgtattttt gatttggcat 3840

ttgcttttgc gcgtggaggg aacatatcac cctcgggcat ttttcatttg gtaggatggt 3900

ttggatgcag ttgaaaaagc aaagaaaaaa ttggggggag gaaagagcaa cagttttgtg 3960

ttttaggggt gggctgtaat gatttttatc tgccatcacg tctcatgtca tcaagagaga 4020

gagaaaaaaa cagaggaggg tggtgttact ccttgggggg gtgaaaggac gaggaggaga 4080

gggcaagcgg cacacaaggg aggtgcgtcc cttttgtcct cgttatgccg attcggaagc 4140

cagacgaggg ctatgatggt tgattttgtt tgctgtttgc ggtttttctg aaactagcta 4200

ttatgccata tatgatgtct ttgtctgggg tgtctcttgt tgggtgttct tttcttgaca 4260

tttattatca tggcttgtta ctgaagggga tgtgagattt ctaggtagaa ggataggaag 4320

gcggttgaat ggaaatttac attgacatga gatgcttggt tatttgaagt gaggagaggt 4380

aagagtgatg gtagtgttgg tatatggatg atgttgcacg gtgcgatgca ttgagcttga 4440

aatgaaacag ccgtggagat tcgatgttca ctgagaagag ttggcttgta tactggttgg 4500

gtatagatat ctcgtatgtc ttgtgcctca ttcgcacgat gtctaccgta cgatgaagag 4560

gaagcttccg cctgccggac gagcttccca tgccggagag taactctctc tctctaatct 4620

ataataggta ctttgccttg ggccttacgg tggcaccgtt tgaagcttat atcaagtcac 4680

tgacaaaagt gtgtaaagga tggataaatc tccataaaca gattgtttcg aacggacctt 4740

gggtgaatat cccgtagcag atgggacaat acgacactag attattgaca aagagtttcg 4800

gagacacaat gtcacacagg acaacaacag actcctcccc cacggataag atagattaga 4860

gtggcggaga tccggagatg cacccttctg catgacttga cgagaagcgc aagagtctct 4920

accaggtatt tctgtaaggg gactcgtcgt acgagtttga acagcaaata cctaagcaag 4980

agaggagtat gaacttgcac agcattatat gtgcgactac ctagatacgc tgtgtcacat 5040

gtttatatgc cgcgatgctg ttgtatcggc atctgttgca ttgtatacct aattagttgt 5100

cttgatgtcc ttaatactat cttctaaagt actaggtagt tgatactatg aatagtctac 5160

ctactttata tcgcacgcaa ggggcgaaga caatgcgtgg cgttgcatga ggcagtctcg 5220

cgcaccacga cacgacacaa agagcacttt ataggtaggt atgtacctag ttttttggct 5280

cctgttcatc ccgaggcagg tgcactctag atagaagagg actaggcagt gctgcgtttc 5340

catggcttca gataggtacc tatctaccta cctaccaacc aaggtgttac cttattttgt 5400

gtatgacagc ttttacctta ggtaatgagc agcacttcaa gacggactct ttagaagaaa 5460

tcagaattcg agagccagct caacaacggc aagagtgata ctggtatttg tcatctgcct 5520

acattgctgg atgtgttaaa tcaggcaaac ctgacacaat atcggtacac agtctcaatg 5580

cctgatgcaa agccaactga tatcacatcc gattctacct aaaagcagca tcatgtacga 5640

gacggtattc ttgacctgca tcaagctttc gccccccccc cccccatatg cgtacgtccc 5700

gtatcacagg catcaaaatc ccaccgatat cccatgcagg tcccccttcc atctctcaca 5760

gcttcccccc ctctgtaaca ccacatgatg tacagtacaa gccacgctgc accgcagctc 5820

tcctacataa tgatactact actaacacca ccacatacat acagacagac cccaatttcc 5880

ccttacatat ccccctcccc tcttcacacc aaa 5913

<210> 5

<211> 10225

<212> DNA

<213> Artificial Sequence

<400> 5

aaaggacgag atggaccgcg ccaagaacgg gccgccgctg aggtttgaga tgccggcgct 60

gtttgttgcg gcgagcaagg acaatgcttt gccgccggcc atgtccaagg gcatggacgc 120

tttctacaag gaccttacca gggccgaggt ggatgctacg cattgggctt tgacgcaggc 180

tggggatgag gtcaatcggg tgattggaga gtggttgaac aaggcgctca atggtgcgac 240

caaggctgcg ttgtagaaat cgaggagaat attcaaatga tcatgaattg ggctaacata 300

aggaaacccc cgacttgctt ggatctcagc atttgctaga catctggtag cagcttgctg 360

taactccctt ttgtacatgt tgagctatga ccgtataccc ctgaatatag ttcccgtaga 420

atctagttgt gccgtccata tcgtttcgag gttgacaggt atcaagtaaa catttcttcg 480

tgactctgcc tccaacatgt ctccaaggtg ttggggatcg tgtgccgcgt ttcttgggcg 540

ttgctggtgt tgaacaaaca tgctgttgct ttgtggccac acgcacatac acacacacgc 600

cgctttgggg agattccgtt cactgcttcg cgccccttct gctttagtac cttcaagagt 660

ccattaattg attcattcct ggcgagtcat ttcacttcag agtgtttttg taagcatcaa 720

cagtcggtgc cttggaggtg gactttttgt ttggctttcc acacatggga catgctgtgt 780

gctaatgtga gcttgggtgt tcatgtgaag ggggaaaagg cggagagact cacagtccgt 840

ctggtaggca cacttctggc aataggaatg gccttgagtg attttggttt tgcactttga 900

gcacgaacta ttcccactgt cagtcaaaag cgcaatgcac atatagagaa tgcgattgcg 960

taggtaggat ggtgcacata cctggagtac tgtgcgtatg gattctttgc tgcttttgac 1020

agcagcttgc tctggaggcc cgttagcgag cattatcgag gaatgacggg aagcagtctt 1080

cgtttacctt tgacactccg gtgttgccca gagttgctga tttggagctg cctgcctttg 1140

cgctggctgg cgagccgtag tacatttcgc tcttcttctt gacctctgga gtcgcaagct 1200

tggtgctctt ggtgagcttc agacacttgc tgcacaccat cgcggcgtct gaatgggggg 1260

tttatctgat tgagtcgggt tgagtatcga tggatttgat aaggaatatg tcagatagcg 1320

ttcgatacta ttgtccgtgg ttcagcttga tggccgcatg ctcgactttc tggtgtttga 1380

tgggtgaatc gcagtggcaa ggctgacatc aacggcaacg cgaaacccgg cactccgtac 1440

ggcttccgcg gccatactgt tccgaattcc caacgaccag ctgcaaagta tcctcaaccg 1500

tgctctggca ttcggcaagg taccatgctc gcacaatctc gctggtgggg gactttgtcg 1560

caaaagggac aacgctcagg gggacccgcc aaacaggcct ctcagcagtg gagcagcagc 1620

agcacatcag tgcagttcaa ggcgaggtcc agcctgtggc atccccccaa gcgatccatg 1680

gatgcgctag agcacttgca gagagagcgc tggagccctt ggacgacgtt gaccccggac 1740

ggcccccttt caggccactt ggcgcaagag agcttccagg tcatcaaggg ttcaagacgg 1800

gctcgtatgc atcagatcaa atcaaacagc atcccagggg agcgctggag aacttgagct 1860

tacaggtgtt tggcattgat ccgtgctccc agtctataat tattacccta cgggggacct 1920

ctcgggtatc agcgccttgg tcgcagaact gcactgagct ttcgtgcccc caagattcaa 1980

atcgtcgggt ccaactgcgc ctctgtttca ctgccgacag tgctgacgta ccaaacgcct 2040

gagcctcgac agcgtcccgc tacggagtgg gagcgattta gcggcagctc gccgaaacga 2100

ggctgtgcag ggacgggaac cttcattgga ttggaacacc ttctcgaacg ctttttttta 2160

gcggaacagc atcagactct acagcgagcg gccctgccct atcgatatcg cgggaccaga 2220

ccaggtgtcg accccgatcg ttctcgagct gctgtgcgag tccgtctcct gcatacctaa 2280

cctaaggaac ctctacctat agacatccaa tacattcgca tccacccgcg agcggctgcg 2340

gtttcacatt ccagccctcc cacggacgca gcgaaacagc cgcgaaacat ccaaaaacac 2400

cacaacacac acagcttctc gggctggccc accctcatcg aagcccgcat gcgttgcccc 2460

tccgcctcag cgaccgccta accactgctc gtcctccggc ccccaaagtc gcaatatcgg 2520

gtatcgccgc cggcattgaa tcgccttctc cgctagcatc gactactgct gctctgctct 2580

cgttgccagc gctgctccct agaattttga ccaggggacg agcccgacat taaagcaact 2640

ccctcgcctc gagacgactc ggatcgcacg aaattctccc aatcgccgac agttcctact 2700

cctcttcctc ccgcacggct gtcgcgcttc caacgtcatt cgcacagcag aattgtgcca 2760

tctctctctt ttttttcccc ccctctaaac cgccacaacg gcaccctaag ggttaaacta 2820

tccaaccagc cgcagcctca gcctctctca gcctcatcag ccatggcacc acacccgacg 2880

ctcaaggcca ccttcgcggc caggagcgag acggcgacgc acccgctgac ggcttacctg 2940

ttcaagctca tggacctcaa ggcgtccaac ctgtgcctga gcgccgacgt gccgacagcg 3000

cgcgagctgc tgtacctggc cgacaagatt ggcccgtcga ttgtcgtgct caagacgcac 3060

tacgacatgg tctcgggctg ggacttccac ccggagacgg gcacgggagc ccagctggcg 3120

tcgctggcgc gcaagcacgg cttcctcatc ttcgaggacc gcaagtttgg cgacattggc 3180

cacaccgtcg agctgcagta cacgggcggg tcggcgcgca tcatcgactg ggcgcacatt 3240

gtcaacgtca acatggtgcc cggcaaggcg tcggtggcct cgctggccca gggcgccaag 3300

cgctggctcg agcgctaccc ctgcgaggtc aagacgtccg tcaccgtcgg cacgcccacc 3360

atggactcgt ttgacgacga cgccgactcc agggacgccg agcccgccgg cgccgtcaac 3420

ggcatgggct ccattggcgt cctggacaag cccatctact cgaaccggtc cggcgacggc 3480

cgcaagggca gcatcgtctc catcaccacc gtcacccagc agtacgagtc cgtctcctcg 3540

ccccggttaa caaaggccat cgccgagggc gacgagtcgc tcttcccggg catcgaggag 3600

gcgccgctga gccgcggcct cctgatcctc gcccaaatgt ccagccaggg caacttcatg 3660

aacaaggagt acacgcaggc ctgcgtcgag gccgcccggg agcacaagga ctttgtcatg 3720

ggcttcatct cgcaggagac gctcaacacc gagcccgacg atgcctttat ccacatgacg 3780

cccggctgcc agctgccccc cgaagacgag gaccagcaga ccaacggatc ggtcggtgga 3840

gacggccagg gccagcagta caacacgccg cacaagctga ttggcatcgc cggcagcgac 3900

attgccattg tgggccgggg catcctcaag gcctcagacc ccgtagagga ggcagagcgg 3960

taccgatcag cagcgtggaa agcctacacc gagaggctgc tgcgataggg gagggaaggg 4020

aagaaagaag taaagaaagg catttagcaa gaagggggaa aagggaggga ggacaaacgg 4080

agctgagaaa gagctcttgt ccaaagcccg gcatcataga atgcagctgt atttaggcga 4140

cctctttttc catcttgtcg atttttgtta tgacgtacca gttgggatga tggatgattg 4200

taccccagct gcgattgatg tgtatctttg catgcaacaa cacgcgatgg cggaggcgaa 4260

ctgcacattg gaaggttcat atatggtcct gacatatctg gtggatctgg aagcatggaa 4320

ttgtattttt gatttggcat ttgcttttgc gcgtggaggg aacatatcac cctcgggcat 4380

ttttcatttg gtaggatggt ttggatgcag ttgaaaaagc aaagaaaaaa ttggggggag 4440

gaaagagcaa cagttttgtg ttttaggggt gggctgtaat gatttttatc tgccatcacg 4500

tctcatgtca tcaagagaga gagaaaaaaa cagaggaggg tggtgttact ccttgggggg 4560

gtgaaaggac gaggaggaga gggcaagcgg cacacaaggg aggtgcgtcc cttttgtcct 4620

cgttatgccg attcggaagc cagacgaggg ctatgatggt tgattttgtt tgctgtttgc 4680

ggtttttctg aaactagcta ttatgccata tatgatgtct ttgtctgggg tgtctcttgt 4740

tgggtgttct tttcttgaca tttattatca tggcttgtta ctgaagggga tgtgagattt 4800

ctaggtagaa ggataggaag gcggttgaat ggaaatttac attgacatga gatgcttggt 4860

tatttgaagt gaggagaggt aagagtgatg gtagtgttgg tatatggatg atgttgcacg 4920

gtgcgatgca ttgagcttga aatgaaacag ccgtggagat tcgatgttca ctgagaagag 4980

ttggcttgta tactggttgg gtatagatat ctcgtatgtc ttgtgcctca ttcgcacgat 5040

gtctaccgta cgatgaagag gaagcttccg cctgccggac gagcttccca tgccggagag 5100

taactctctc tctctaatct ataataggta ctttgccttg ggccttacgg tggcaccgtt 5160

tgaagcttat atcaagtcac tgacaaaagt gtgtaaagga tggataaatc tccataaaca 5220

gattgtttcg aacggacctt gggtgaatat cccgtagcag atgggacaat acgacactag 5280

attattgaca aagagtttcg gagacacaat gtcacacagg acaacaacag actcctcccc 5340

cacggataag atagattaga gtggcggaga tccggagatg cacccttctg catgacttga 5400

cgagaagcgc aagagtctct accaggtatt tctgtaaggg gactcgtcgt acgagtttga 5460

acagcaaata cctaagcaag agaggagtat gaacttgcac agcattatat gtgcgactac 5520

ctagatacgc tgtgtcacat gtttatatgc cgcgatgctg ttgtatcggc atctgttgca 5580

ttgtatacct aattagttgt cttgatgtcc ttaatactat cttctaaagt actaggtagt 5640

tgatactatg aatagtctac ctactttata tcgcacgcaa ggggcgaaga caatgcgtgg 5700

cgttgcatga ggcagtctcg cgcaccacga cacgacacaa agagcacttt ataggtaggt 5760

atgtacctag ttttttggct cctgttcatc ccgaggcagg tgcactctag atagaagagg 5820

actaggcagt gctgcgtttc catggcttca gataggtacc tatctaccta cctaccaacc 5880

aaggtgttac cttattttgt gtatgacagc ttttacctta ggtaatgagc agcacttcaa 5940

gacggactct ttagaagaaa tcagaattcg agagccagct caacaacggc aagagtgata 6000

ctggtatttg tcatctgcct acattgctgg atgtgttaaa tcaggcaaac ctgacacaat 6060

atcggtacac agtctcaatg cctgatgcaa agccaactga tatcacatcc gattctacct 6120

aaaagcagca tcatgtacga gacggtattc ttgacctgca tcaagctttc gccccccccc 6180

cccccccccc cccccccccc cccccccccc catatgcgta cgtcccgtat cacaggcatc 6240

aaaatcccac cgatatccca tgcaggtccc ccttccatct ctcacagctt ccccccctct 6300

gtaacaccac atgatgtaca gtacaagcca cgctgcaccg cagctctcct acataatgat 6360

actactacta acaccaccac atacatacag acagacccca atttcccctt acatatcccc 6420

ctcccctctt cacaccaaaa acggaaagaa aaaaaaataa gaggagagag agataaggtc 6480

cgtatcattg gtatgagaga taacagctct gtagcaaaag attgacatct tgcatgctta 6540

tcagctggtt ctcttgattc tgaatcctca ggccagaaga cgcgccgaca tcgctgatgt 6600

actcgagacg attgcaaccc aaaccaatca catccatcac acttgtgcag aatgctgcct 6660

ttcagcgaaa atttaaccat gttcaataac attatccttt attcattgat ttctcaattg 6720

cttccttgcc atctatgggt tctgttcgcg tccccagaga tgcatcgccg tcttttgata 6780

aagtatatac ataagttgac tcccatgtac agttgcccac caaacatcaa attaccatcc 6840

aagtacccat atgccgtgct ttatatctaa cccagtggac gtgtaataat cttgtgccaa 6900

gaggccataa cagtctttgt gaagtactaa gagaaacagg aggaaaaggg aagtgaagaa 6960

aaggaaaaga aaaagaatcc acaagtcgag ttcgacaaga tgtcgaagcg aggcgacgta 7020

acgctccggg gtcaggattg gtggattgca gtcacactat gcggtgcatg gtgacaagca 7080

agagcggctg ataagagaag ctcgagttgg gatgttgaaa aagcgccgtg aggggcccag 7140

attgaagccg tccaaagtgg gaaaggatcc gaaatcccct cgctgccgga ccactaatga 7200

cagtgatcga acagtgaaaa cagttgaaaa catcaaaact tttgttgtgc gtaagtgtgt 7260

atctccctga agaacgccaa agggaaaaaa aaagaaagga agaatagaag aataacagtt 7320

gtgcggagtg tggtgcgaat gggctcggca acagcaaagg agccggacga gaccaggacc 7380

tcaagtcggt tggaggtggc acaacagcgt gctgccagtc gacggcgaga cccttgccgc 7440

tgggcatccg cacccctgta accccgcagt ccgaatcaat gcgccgtttg gccagaattc 7500

tggcaaaatg cggaggcgcg gtgtgcgtcg gaggtcccat cacgacatct gcacgcgcca 7560

gtccttgttc gtctgcgtct tattgcctgg ccacccccac agcggtggcc gacgctccca 7620

ggccagtctg gtgataggcc gctgcgagcc cagctgctgc tagccggcgt gccgtgcgca 7680

agggggggga aaggggccgc tagagacgct cgaggcggat gggactgcag ccaaccgctt 7740

cgtcccatct cagggcctca aacaattaac ccccccgcca gcacacccac ctggctgcgt 7800

ccgaaatcac cgagtcagca tggggatgac aagctcgacg ctctttggcc gcgagctgcc 7860

gcctggggtc ctcgagggca gcggccggtc catggcccca gaccctgcct cgtgcgagta 7920

ggtgcccccg taggccaggt cgagggtgct cgggtggctg tacagaaggc tggccgatgg 7980

tcgcgtgtac gagttgttgg ggctggtagc tgagctgcgg ctgaagggcc agatgccact 8040

ccccgacggc gacggggggc tgggtggcct cacgttgagg gatcgcaggg cagacatggc 8100

cgaggtgtgg tagttgagcg cggtgtctgg tgaagccggc ggagagttgg tgaagtgcat 8160

cgagctgggc cgtgagggcg aggcccgtgg cacaatgtct cgcggctcgg acccggccaa 8220

ggactcggtc aggatgcggc gctggttgac gtagacagag gagtaatagc tgcgaaccga 8280

cttggcctgc gcggacgagt cttggtctac ccggcggcat ctacacacat gtgtgttagt 8340

ggacgtgatc aacccagctc ctccaaggtt cgtcgtcaag aagagaaaca tacgcatcgg 8400

agcagtacag aaccagctcg tcgtgggtgt ggaattcctt ttcgcaaatc atgctgcagg 8460

aacacaaaag gtcagttaca tggcctcagc agcgtcacaa acaacaggag tggcttccat 8520

accagtactg agggaagctc tctcgctcgt cgttgtccca aatctccgtg tcggtctcgc 8580

gaccacctcg ccccaacttc tgggcggcgg acggagtgtg tcgtcgagtc atggttggtc 8640

gcttgtactg agcgggtgtt gcggtcactg cctttcgcac gtctgttgtc gatgcggtgg 8700

cagtgtaagg gccggacttg cgtcgctggt gaggcatttg gaatgcagat agaagaggag 8760

caagggaaaa agtgcgtggg cgaactcgag gtgttatcct ggcagctcgg agagcgtggg 8820

ggaaaactac caggaccgtc caaggcgtga gacgaccaaa atcagggaag ccagacagaa 8880

cgctgtgctg gctttatctc cggcaggcag cgcagccaaa tcaggcgggt gtatgcgaca 8940

cgtcgtattg gagagtgcgc gagattaata agagagtgac gctttgctcg acaggcgtga 9000

cttgggctga agaatgacgg gaggtcacac cggcgtagag agggtgaaga ttgatcgaca 9060

ggacccggaa gatggaagga tgctgcagat cgattcgtcg ggcagatttg ctgttatcca 9120

ctcttggtgt tcagttgaca ggagcagagc gtcgactgct gagtagctta aaagggccaa 9180

atatagcagt ggtatcgacg gtcagatgat aagcaccgca gagggtgaga tgaggtggat 9240

gggagggcgt ttggtgtaag tggtggcacg ggatgaaggt ctagtgctgg gttgaccgga 9300

ggctgagctg gactgtgatg tgtcgtcgat aatggggtgg tggtgtaagg cgtattcgca 9360

gattgatgga ggaagggaaa agaacggatg aggaagtaga tttgaacgag agtgagagga 9420

ggaagaggag gaggaagagg tcggaaaaga ctggcgtgtg agacgctttt gttgtcgtgc 9480

ttctgcttct ccgtatttgt gcaggctgta agaggtactt gtataatatg caatctgatg 9540

gcagccgaaa gcggagactc gcagttcact gcttggtgac aaagtttcca gcagggcgat 9600

cggcgcggac gggagtaact ttgcgtccag ggcgggtgcc agcagcagca gcaggtaccg 9660

atggtgacac actgtcgacg ccgggctcca caatgtcgcg atagtggtac tttggccctc 9720

gactcggact ttgcttgggg ggggcaggca gcgatgactc ttttgttttt gtgggctctc 9780

ttgtctcctt ttttctttct tgcgttaagc ttctttttgt gaatgctatt tttttttctt 9840

ctcctttatt ccgctttaat atattttccc cttcagaaac agaaagaagc tttccaatgt 9900

ttcaaaataa aacgtaaatt gtggaacaca gtctggcagg ctcttgtcga agtcgggcgt 9960

ggtgcgaatc gctcggatga agcctcggtg gtagggctgg actcgttcgg gcggatgtac 10020

tacccagtac tcgtgtggag gtacctgtaa gacgggatcg cgccggagag gtacttgtgt 10080

gcacaggtgg gagcggtcgc aaggccgtag cgtttattga gttgctgacg tgcttatggg 10140

ccaagattcg tacagtatta gaagctggag cacgaataat acccaagcat ggggtgcagc 10200

agttggtttc agttgcttgt cttgc 10225

<210> 6

<211> 1354

<212> PRT

<213> Artificial Sequence

<400> 6

Met Ala Gly Arg His Pro Ile Gly Gly His Gly Gly Pro Ser Thr Thr

1 5 10 15

Asp Asp Leu Leu Leu Asp Leu Asp Asn Glu Gln Pro Val Tyr Asn Ala

20 25 30

Gly Gln Arg Ser Ala Leu Asn Asp Asp Asp Leu Ala Arg Ala Tyr Glu

35 40 45

His Asp His Asp Asn Asp Pro Gln Ser Arg Pro Ser Val Ser Tyr Asp

50 55 60

Asp Phe Val Gly Ala Glu Pro Ser Tyr Pro Pro Ala Gly Arg Pro Gly

65 70 75 80

Leu Ala Gln Ala Ala Gln Pro Ser Gly Gln Ser Ser Gly Pro Tyr His

85 90 95

Ala Gln Gln Phe Ser Gln Ser Ser Asp Leu Asp Asn Phe Pro Arg Tyr

100 105 110

Ala Asp Asp Phe Asp Asp Asp Asp Met Tyr Tyr Gln His Gly Gly Ala

115 120 125

Ala Gly Ala Gly Pro Ala Ser Ala Gly Arg Asp Asn Ala Arg Ala Arg

130 135 140

Asn Ser Val Leu Ser Leu Gly Gly Gly Leu Phe Gly Lys Leu Lys His

145 150 155 160

Arg Leu Gly Met Gly Gln Gly Tyr Ser Glu Met Asp Leu Pro Leu Thr

165 170 175

Glu Pro Gly His Asp Arg Gly Gly Pro Ile Ala Gly Ser Ser Gln Pro

180 185 190

Pro Asp Gln Gln Pro Ala Gly Lys Lys Ala Gly Asn Phe Lys Phe Gly

195 200 205

Phe Gly Arg Gly Lys Pro Asp Pro Ala Ser Leu Gly Pro Arg Ile Ile

210 215 220

His Leu Asn Asn Pro Pro Ala Asn Ala Ala Asn Lys Tyr Val Gly Asn

225 230 235 240

His Ile Ser Thr Ala Lys Tyr Asn Val Ala Thr Phe Leu Pro Lys Phe

245 250 255

Leu Phe Glu Gln Phe Ser Lys Val Ala Asn Ile Phe Phe Leu Phe Thr

260 265 270

Ala Ala Leu Gln Gln Ile Pro Gly Leu Ser Pro Thr Asn Lys Tyr Thr

275 280 285

Thr Ile Gly Pro Leu Ala Val Val Leu Leu Val Ser Ala Gly Lys Glu

290 295 300

Leu Val Glu Asp Tyr Arg Arg Arg Val Ala Asp Asn Ala Leu Asn Thr

305 310 315 320

Ser Lys Ala Arg Val Leu Arg Gly Ser Thr Phe Thr Glu Thr Lys Trp

325 330 335

Asn Thr Val Ala Val Gly Asp Val Val Arg Val Glu Ser Glu Glu Pro

340 345 350

Phe Pro Ala Asp Leu Val Leu Leu Ala Ser Ser Glu Pro Glu Gly Leu

355 360 365

Cys Tyr Ile Glu Thr Ala Asn Leu Asp Gly Glu Thr Asn Leu Lys Ile

370 375 380

Lys Gln Ala Leu Pro Glu Thr Ser Thr Leu Val Ser Pro Ser Glu Val

385 390 395 400

Ser Arg Leu Gly Gly Arg Ile Lys Ser Glu Gln Pro Asn Ser Ser Leu

405 410 415

Tyr Thr Tyr Glu Ala Thr Leu Ile Met Gln Ala Gly Gly Gly Glu Lys

420 425 430

Glu Leu Ala Leu Asn Pro Glu Gln Leu Leu Leu Arg Gly Ala Thr Leu

435 440 445

Arg Asn Thr Pro Trp Ile His Gly Ile Val Val Phe Thr Gly His Glu

450 455 460

Thr Lys Leu Met Arg Asn Ala Thr Ala Thr Pro Ile Lys Arg Thr Lys

465 470 475 480

Val Glu Arg Gln Leu Asn Trp Leu Val Leu Met Leu Val Gly Met Leu

485 490 495

Leu Val Leu Ser Val Ile Ser Thr Ile Gly Asp Leu Val Met Arg Gly

500 505 510

Ala Thr Gly Asp Ser Leu Ser Tyr Leu Tyr Leu Asp Lys Ile Asp Ser

515 520 525

Ala Gly Val Ala Ala Ser Thr Phe Phe Lys Asp Met Val Thr Tyr Trp

530 535 540

Val Leu Phe Ser Ala Leu Val Pro Ile Ser Leu Phe Val Thr Val Glu

545 550 555 560

Leu Val Lys Tyr Trp His Gly Ile Leu Ile Asn Asp Asp Leu Asp Met

565 570 575

Tyr Tyr Asp Lys Thr Asp Thr Pro Ala Thr Cys Arg Thr Ser Ser Leu

580 585 590

Val Glu Glu Leu Gly Met Val Glu Tyr Val Phe Ser Asp Lys Thr Gly

595 600 605

Thr Leu Thr Cys Asn Met Met Glu Phe Lys Gln Cys Ser Ile Gly Gly

610 615 620

Ile Met Tyr Ala Glu Glu Val Pro Glu Asp Arg Arg Ala Ser Gly Ala

625 630 635 640

Asp Asp Glu Glu Thr Ala Ile Tyr Asp Phe Lys Ala Leu Gln Ala Asn

645 650 655

Leu Thr Gln Gly His Pro Thr Ala Gly Met Ile Asp His Phe Leu Ser

660 665 670

Leu Leu Ala Thr Cys His Thr Val Ile Pro Glu Met Asp Glu Lys Gly

675 680 685

Gln Ile Lys Tyr Gln Ala Ala Ser Pro Asp Glu Gly Ala Leu Val Ala

690 695 700

Gly Ala Val Thr Met Gly Tyr Lys Phe Thr Ala Arg Lys Pro Lys Ser

705 710 715 720

Val Ile Ile Glu Ala Asn Gly Arg Glu Met Glu Tyr Glu Leu Leu Ala

725 730 735

Val Cys Glu Phe Asn Ser Thr Arg Lys Arg Met Ser Ala Ile Phe Arg

740 745 750

Cys Pro Asp Gly Lys Ile Arg Val Tyr Cys Lys Gly Ala Asp Thr Val

755 760 765

Ile Leu Glu Arg Leu Asn Asp Gln Asn Pro His Val Glu Ile Thr Leu

770 775 780

Arg His Leu Glu Glu Tyr Ala Ser Glu Gly Leu Arg Thr Leu Cys Leu

785 790 795 800

Ala Met Arg Glu Val Pro Glu Gln Glu Tyr Arg Glu Trp Arg Gln Ile

805 810 815

Phe Asp Thr Ala Ala Thr Thr Val Gly Gly Asn Arg Ala Asp Glu Leu

820 825 830

Asp Lys Ala Ala Glu Ile Ile Glu His Asp Phe Tyr Leu Leu Gly Ala

835 840 845

Thr Ala Ile Glu Asp Arg Leu Gln Asp Gly Val Pro Glu Thr Ile His

850 855 860

Thr Leu Gln Gln Ala Asn Ile Lys Val Trp Val Leu Thr Gly Asp Arg

865 870 875 880

Gln Glu Thr Ala Ile Asn Ile Gly Met Ser Cys Lys Leu Leu Ser Glu

885 890 895

Asp Met Met Leu Leu Ile Val Asn Glu Glu Ser Ser Ala Ala Thr Arg

900 905 910

Asp Asn Ile Gln Lys Lys Leu Asp Ala Ile Arg Thr Gln Gly Asp Gly

915 920 925

Thr Ile Glu Met Glu Ser Leu Ala Leu Val Ile Asp Gly Lys Ser Leu

930 935 940

Thr Tyr Ala Leu Glu Lys Asp Met Glu Lys Leu Phe Leu Asp Leu Ala

945 950 955 960

Ile Met Cys Lys Ala Val Ile Cys Cys Arg Val Ser Pro Leu Gln Lys

965 970 975

Ala Leu Val Val Lys Leu Val Lys Lys Tyr Gln Lys Gln Ser Ile Leu

980 985 990

Leu Ala Ile Gly Asp Gly Ala Asn Asp Val Ser Met Ile Gln Ala Ala

995 1000 1005

His Ile Gly Val Gly Ile Ser Gly Val Glu Gly Leu Gln Ala Ala

1010 1015 1020

Arg Ser Ala Asp Val Ala Ile Ala Gln Phe Arg Tyr Leu Arg Lys

1025 1030 1035

Leu Leu Leu Val His Gly Ala Trp Ser Tyr Gln Arg Val Ser Lys

1040 1045 1050

Thr Ile Leu Phe Ser Phe Tyr Lys Asn Ile Ala Leu Tyr Leu Thr

1055 1060 1065

Gln Phe Trp Tyr Thr Phe Gln Asn Val Phe Ser Gly Gln Val Ile

1070 1075 1080

Tyr Glu Ser Trp Thr Leu Ser Phe Tyr Asn Val Phe Tyr Thr Val

1085 1090 1095

Leu Pro Pro Leu Ala Ile Gly Ile Leu Asp Gln Phe Ile Ser Ala

1100 1105 1110

Arg Leu Leu Asp Arg Tyr Pro Gln Leu Tyr Met Met Gly Gln Gln

1115 1120 1125

Asn Ser Ala Phe Lys Leu Lys Val Phe Ala Gln Trp Ile Ala Asn

1130 1135 1140

Ala Ile Tyr His Ser Leu Leu Leu Tyr Val Phe Ala Glu Leu Ile

1145 1150 1155

Trp Tyr Gly Asp Val Ile Asp Gly Gln Gly Gln Thr Asp Gly His

1160 1165 1170

Trp Val Trp Gly Thr Ala Leu Tyr Gly Ser Val Leu Leu Thr Val

1175 1180 1185

Leu Gly Lys Ala Ala Leu Val Thr Asn Asn Trp Thr Lys Tyr His

1190 1195 1200

Val Met Ala Ile Pro Gly Ser Met Val Ile Trp Trp Val Phe Ile

1205 1210 1215

Ala Val Tyr Gly Thr Val Ala Pro Lys Val Lys Ile Ser Pro Glu

1220 1225 1230

Tyr Phe Gly Val Ile Pro Lys Leu Tyr Ser Ser Pro Val Phe Trp

1235 1240 1245

Leu Gln Ile Phe Val Leu Ala Leu Leu Cys Leu Ser Arg Asp Ile

1250 1255 1260

Ala Trp Lys Tyr Ala Lys Arg Met Tyr Trp Pro Gln Thr Tyr His

1265 1270 1275

His Ile Gln Glu Ile Gln Lys Tyr Asn Ile Gln Asp Tyr Arg Pro

1280 1285 1290

Arg Met Glu Gln Phe Gln Lys Ala Ile Arg Lys Val Arg Gln Val

1295 1300 1305

Gln Arg Met Arg Lys Gln Arg Gly Tyr Ala Phe Ser Gln Ala Asp

1310 1315 1320

Glu Ser Gln Thr Arg Val Leu Gln Ala Tyr Asp Thr Thr Lys His

1325 1330 1335

Arg Gly Arg Tyr Gly Glu Met Ala Ser Ser Arg Pro Ile Asp Gly

1340 1345 1350

Ile

Claims (10)

1. Knock-out of Trichoderma reesei (T. reesei) ((T. reesei))Trichoderma reesei) The substance of the nucleic acid molecule encoding the Trdrs2 protein can be used for increasing the expression level of Trichoderma reesei (T. reesei) ((T. reesei))Trichoderma reesei) Application in extracellular protein secretion amount;

the Trdrs2 protein is any one of the following a1) -a 4):

a1) protein shown as a sequence 6 in a sequence table;

a2) a fusion protein obtained by connecting labels to the N terminal or/and the C terminal of the protein of a 1);

a3) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in a1) and is related to the secretion amount of the trichoderma reesei extracellular protein;

a4) a protein which has 98% or more identity to a1) and is related to the secretion amount of the trichoderma reesei extracellular protein;

the knockout Trichoderma reesei (T. reesei) (M. reesei)Trichoderma reesei) The substance of the nucleic acid molecule encoding the Trdrs2 protein is a knockout Trichoderma reesei (T. reesei)Trichoderma reesei) The DNA fragment of the nucleic acid molecule encoding the Trdrs2 protein, or the recombinant vector containing the DNA fragmentAnd (4) group cells.

2. Use according to claim 1, characterized in that: the nucleic acid molecule encoding the Trdrs2 protein is any one of c1) -c3) as follows:

c1) DNA molecules shown in a sequence 1 or a sequence 2 in a sequence table;

c2) a DNA molecule having 95% or more identity to c1) and encoding the protein;

c3) a DNA molecule which hybridizes with the nucleotide sequence defined by any one of c1) or c2) under strict conditions and codes the protein.

3. Use according to claim 1 or 2, characterized in that: the knockout Trichoderma reesei (Trichoderma reesei) The DNA fragment of the nucleic acid molecule encoding the Trdrs2 protein containsTrdrs2Upstream homology arms of genes andTrdrs2downstream homology arms of genes, theTrdrs2The nucleotide sequence of the upstream homologous arm of the gene is 1 st to 2000 th of a sequence 3 in a sequence table, and the sequence isTrdrs2The nucleotide sequence of the downstream homology arm of the gene is 6189-8188 site of the sequence 3 in the sequence table.

4. Use according to claim 3, characterized in that: the knockout Trichoderma reesei (T. reesei) (M. reesei)Trichoderma reesei) The DNA fragment of the nucleic acid molecule of the Trdrs2 protein is shown as a sequence 4 in a sequence table.

5. A construction method of recombinant trichoderma reesei comprises the following steps: knockout of Trichoderma reesei (T. reesei) (T. reesei)Trichoderma reesei) The nucleic acid molecule of Trdrs2 protein to obtain the recombinant Trichoderma reesei; the recombinant trichoderma reesei has higher extracellular protein secretion amount than that of trichoderma reesei (Trichoderma reesei) (III)Trichoderma reesei）。

6. The method of claim 5, wherein: the knockout Trichoderma reesei (Trichoderma reesei) The method for coding the nucleic acid molecule of the Trdrs2 protein is homologous recombinationPanel, random insertion mutation or RNAi.

7. The method of claim 6, wherein: the nucleotide sequence of the upstream homology arm adopted in the homologous recombination is 1 st-2000 th of a sequence 3 in a sequence table, and the nucleotide sequence of the downstream homology arm adopted in the homologous recombination is 6189 th-8188 th of the sequence 3 in the sequence table.

8. The method of claim 7, wherein: the homologous recombination is carried out by introducing a DNA fragment shown in a sequence 4 in a sequence table into the trichoderma reesei (T. reesei)) (Trichoderma reesei) And (5) realizing.

9. A recombinant Trichoderma reesei constructed by the method of any one of claims 5 to 8.

10. Use of a method according to any one of claims 5 to 8 or a recombinant trichoderma reesei according to claim 9 in the preparation or synthesis or expression of extracellular proteins.

Images