CN110938614A

CN110938614A - High-activity β -galactosidase, plasmid for high-throughput screening of same and preparation method thereof

Info

Publication number: CN110938614A
Application number: CN201911237878.6A
Authority: CN
Inventors: 林丽春; 田�健; 张东风; 诸辉
Original assignee: Ningbo Xi Nuoya Marine Organisms Science And Technology Ltd
Current assignee: Ningbo Xi Nuoya Marine Organisms Science And Technology Ltd
Priority date: 2019-12-06
Filing date: 2019-12-06
Publication date: 2020-03-31

Abstract

The invention provides a high-activity β -galactosidase, the amino acid sequence of which is shown as SEQ ID NO. 2, or a derivative amino acid sequence of which the sequence shown as the SEQ ID NO. 2 is eliminated, substituted and added with one or more amino acids, the gene sequence for coding the high-activity β -galactosidase is shown as the SEQ ID NO. 1, or the sequence shown as the SEQ ID NO. 1 is eliminated, substituted and added with one or more basic groups and can code the gene sequence of β -galactosidase with the same function, the amino acid sequence shown as the SEQ ID NO. 2 and the derivative amino acid sequence of β -galactosidase have high enzyme activity, and simultaneously, the episomal plasmid containing the genes of SEQ ID NO. 1 and panARS can be used for high-throughput screening of β -galactosidase engineering bacteria, the engineering bacteria can be quickly obtained through the high-throughput screening, and the culture period of the strains can be shortened.

Description

High-activity β -galactosidase, plasmid for high-throughput screening of same and preparation method thereof

Technical Field

The invention relates to the technical field of biological medicines, in particular to β -galactosidase, an episomal plasmid for high-throughput screening of β -galactosidase activity and a preparation method of the plasmid.

Background

Lactase (also called β -galactosidase) can catalyze β -galactoside bond in β -galactoside compound to hydrolyze, so that excessive lactose in human body is decomposed into glucose and galactose, and the problem of lactose intolerance of patients eating dairy products is solved.

Most of the vectors for recombinant protein expression are integrated into the genome of pichia pastoris, and the advantages of integrated expression are mainly represented by good stability, but the disadvantages are also quite obvious, such as relatively low transformation efficiency, a certain degree of heterogeneity of protein production, nonspecific integration and genetic instability of multi-copy integration under stress conditions. Episomal expression has a simpler protocol and higher transformation efficiency. The copy number of a target gene can be obviously increased by transforming the pichia pastoris with the episomal plasmid, the influence on a thallus genome is relatively small, and the probability of causing adverse influence on the growth and metabolism of thallus is low.

With the continued development of high throughput efforts, Autonomously Replicating Sequences (ARS) have been explored for use in shuttle plasmids. ARS was first discovered as a genomic sequence in Saccharomyces cerevisiae (Saccharomyces cerevisiae) that was determined to be autonomously replicable as an episomal plasmid. Genomic ARS sequences, are believed to originate from DNA replication during mitosis. Sequences functionally similar to ARS sequences have been found on the Pichia pastoris and Kluyveromyces lactis genomes (PARS and panARS). The circular plasmid containing the autonomous replication sequence can be efficiently transformed into saccharomyces cerevisiae and pichia pastoris. So far, reports of expressing heterologous proteins by pichia pastoris through episomal plasmids are very rare, so that the development of episomal plasmids capable of being stably and efficiently expressed in pichia pastoris is of great significance.

The error-prone PCR technology for constructing random mutation libraries is the earliest method for directed evolution research. The error-prone PCR technology is mainly realized by increasing Mg in a PCR system²⁺Concentration, addition of Mn²⁺Random mutation is introduced by adopting Taq enzyme with low fidelity, adjusting the content of 4 dNTPs and the like. The technology is firstly proposed by Leung et al, and the key steps are to control mutation frequency, so that a satisfactory mutation library cannot be obtained when the mutation frequency is too high or too low.

The establishment of a high-throughput screening method is the key to rapidly obtain the recombinant engineering bacteria applicable to industrial production. The High Throughput Screening (HTS) technology is based on molecular level and cell level experimental methods, uses 96-well plate, microplate or chip form as experimental tool carrier, uses an automatic operation system to execute experimental process, and uses sensitive and rapid experimental instruments to detect experimental data, so as to test thousands or tens of thousands of samples in a short time. In order to realize high-throughput screening, the traditional strain culture needs to be changed into miniaturized culture, and a specific substrate chromogenic reaction plate prescreening or flow cytometry technology and the like are adopted to accelerate the screening efficiency.

Disclosure of Invention

In order to solve the technical problems, the invention provides β -galactosidase with high enzyme activity.

Another objective of the invention is to provide an episomal plasmid for high-throughput screening of highly active β -galactosidase.

The invention also aims to provide a preparation method of the free plasmid.

The technical scheme of the invention is to provide high-activity β -galactosidase, the amino acid sequence of which is shown as SEQ ID NO. 2, or a derivative amino acid sequence which is obtained by removing, substituting and adding one or more amino acids into the sequence shown as SEQ ID NO. 2 and has the same function with β -galactosidase represented by SEQ ID NO. 2, wherein X in the sequence shown as SEQ ID NO. 2 represents any one of 20 amino acids.

The gene sequence (lac0 gene) for coding high-activity β -galactosidase is shown as SEQ ID NO. 1, or the gene sequence which is obtained by eliminating, substituting and adding one or more bases to the sequence shown as SEQ ID NO. 1 and can code β -galactosidase with the same function, and the NCBI accession number of the sequence shown as SEQ ID NO. 1 is FM 955406.

The invention also provides an episomal plasmid for high-throughput screening of high-activity β -galactosidase, which comprises the sequences shown as SEQ ID NO. 1 and SEQ ID NO. 3.

The invention further provides a preparation method of the episomal plasmid for high-throughput screening of high-activity β -galactosidase, which comprises the following steps:

(1) construction of an episomal plasmid containing an autonomously replicating sequence (parsGAPz α A)

Synthesizing panARS gene sequence (SEQ ID NO: 3), cloning the panARS gene sequence to a puc57 cloning vector, carrying out enzyme digestion on puc57-ARS and pGAPz α A, connecting the vector and a target gene (panARS), transforming a connecting product to top10 competence, and carrying out screening verification by colony PCR and enzyme digestion;

(2) construction of β -galactosidase recombinant expression vector (parsGAPz α A-lac0)

Carrying out double enzyme digestion on the constructed parsGAPz α A and pPIC9K-lac0 with acid lactase gene (lac0 gene, the sequence is shown as SEQ ID NO: 1), connecting the vector and the lac gene, transforming top10, carrying out screening verification by using colony PCR and double enzyme digestion verification methods, and naming the correctly verified recombinant vector as parsGAPz α A-lac 0;

(3) β -galactosidase recombinant expression vector downstream cloning site correction

Designing a site-directed mutagenesis primer, carrying out whole plasmid PCR by taking parsGAPz α A-lac0 as a template, correcting the enzyme cutting site at the 3' end to be KpnI, treating a PCR product by DpnI enzyme to remove a plasmid template, purifying and converting the PCR product into top10, selecting a transformant, carrying out double enzyme digestion verification, and sending a sequence for further confirmation after the verification is correct;

(4) construction of random mutation library of β -galactosidase pichia pastoris expression bacteria

Taking pars GAPz α A-lac0 as a template, making three sequences (upstream, midstream and downstream) of an error-prone PCR amplification lac0 gene, recovering error-prone PCR products, taking three products of error-prone PCR as large primers, taking pars GAPz α A-lac0 as a template, making MegaWhop PCR amplification full-length plasmid, digesting the original plasmid template by DpnI enzyme to obtain a product, directly converting escherichia coli after purification, selecting a plurality of clones, carrying out sequencing, detecting the mutation rate, ensuring that the number of base mutations is between 1 and 3, extracting mutant plasmids by using mixed bacteria liquid after all conditions are met, and electrically converting pichia pastoris 115 GS, X33, SMD1168 and KM 71;

(5) high-throughput screening of recombinant bacteria with β -galactosidase activity

The transformed bacterial liquid is coated on a YPD plate containing Zeocin and 1 per mill X-gal; culturing at 28 deg.C for 2-3 days; observing the color development condition of the flat plate; selecting colonies with deep color, culturing and fermenting in a deep-hole plate, and finally screening out recombinant strains with higher enzyme activity through enzyme activity detection; and screening the obtained potential strains with high enzyme activity.

The invention has the advantages and beneficial effects that the amino acid sequence shown in SEQ ID NO. 2 and β -galactosidase derived from the amino acid sequence have high enzymatic activity, the free plasmid can be used for high-throughput screening of β -galactosidase engineering bacteria, the engineering bacteria can be rapidly obtained through the high-throughput screening, the culture period of the strain is shortened, the large-scale industrial popularization and application are facilitated, and the beneficial effect on improving the yield of β -galactosidase is achieved.

Drawings

FIG. 1 is a plasmid map of β -galactosidase episomal recombinant expression vector.

FIG. 2 shows the results of enzyme activities of β -galactosidase mutant bacteria with higher enzyme activity and control bacteria (lac gene) fermented for different times in the deep-well plate screening.

FIGS. 3a and 3b are the results of electrotransformation of an error-prone plasmid (parsGAPz α A-lac0 with random mutations) to Pichia pastoris on x-gal chromogenic plates.

FIG. 4 shows the results of MEGAWHOP PCR (Large primer PCR).

Detailed Description

The present invention will be further described with reference to the following embodiments.

The raw materials and reagents used in the examples are listed mainly below, wherein the concentrations of the substances are mass concentrations unless otherwise specified.

Strains and plasmids TOP10, TransT1, GS115, X33, SMD1168, KM71, puc57, pGAPZ α A, pPIC9K-lac0

Enzymes and kits: KOD-PLUS-NEO, EasyTaq, restriction enzymes (EcoRI, NotI, BglII, KpnI, DpnI), T4DNA ligase, plasmid miniprep kit, PCR product purification kit, agarose gel recovery kit, yeast plasmid extraction kit

The components of the culture medium:

LB culture medium: 1% peptone, 0.5% yeast extract, 1% NaCl, ph 7.0;

LLB medium: 1% peptone, 0.5% yeast extract, 0.5% NaCl, ph 7.0;

YPD medium: 2% peptone, 1% yeast extract, 2% glucose;

SOC culture medium: 2% peptone, 0.5% yeast extract, 0.05% NaCl, 0.4% glucose, 0.0186% KCl, 0.12% MgSO₄，pH7.0；

Solution for conversion:

TB:10mM Pipes or 10mM Hepes，15mM CaCl₂，250mM KCl，55mM MnCl₂

1M sorbitol: 18.2g sorbitol, dissolved in a proper amount of water, and then the volume is adjusted to 100mL

Buffer A: 10mL YPD, 2mL 1M HEPES (adjusted to pH8.0 with solid NaOH), 125. mu.L 1M DTT

EXAMPLE 1 construction of autonomously replicating episomal plasmid parsGAPz α A

The panARS gene was synthesized, cloned into the puc57 vector, the ligation product was transformed into the top10 competent plasmid, pUc57-ARS-top10 was inoculated into ampicillin-containing Amp 100ug/mL medium for expansion culture, while pGAPZ α A was transformed into DH5 α, pGAPZ α A-DH5 α was inoculated into 50mL LLB (containing zeocin, 25ug/mL) medium for expansion culture, for plasmid extraction, according to the method steps of the OMEGA plasmid extraction kit, plasmids 57-ARS and pGAPZ α A were extracted, restriction endonuclease plasmids puc57-ARS and pGAPZ α A were used, the products were electrophoreserved, T4DNA ligase panARS and pGAPZ α A ligase was ligated into the top10 transformed into the competent state, plated on zeocin selection plates, the primers were inoculated into SetoARS-8. the PCR primer set-strain containing SetoR-S-PCR-clone-5848-PCR was performed at RT-PCR-for verifying that the plasmid was transformed into the plasmid clone 10, the plasmid was preserved, the plasmid was inoculated into the plasmid, and plasmid deposited on the plasmid containing SetoARS-strain-S-pGAPZ-strain-S-SEto-strain-S-strain-SEto-SEyS-SE:

numbering	Name (R)	Sequence (5 '-3')
			SEQ ID NO：4	Seq_Ori_F	TCTGCGCTCTGCTGAAGCCAGTTACCT
SEQ ID NO：5	Seq_ARS_R	GGTAGGAGTGTCGGTCCTTGAAATATATG
			SEQ ID NO：6	Seq_ARS_F	CAGAATGAGAAAGAACAGATACGCAGTAC

EXAMPLE 2 construction of β -galactosidase recombinant expression vector

Synthesizing an acid lactase integrated gene (namely Lac0 gene), cloning the gene to a PMD-18T vector, inoculating a PMD-18T-Lac0 single colony to a 50ml LB culture medium for culture, extracting plasmids, inoculating a pPIC9K-DH5 α single colony to an LB culture medium for culture, extracting plasmids according to the method steps of a plasmid extraction kit, extracting plasmids PMD-18T-Lac0 and pPIC9K, using restriction endonuclease to cut plasmids PMD-18T-Lac0 and pPICK 9gel, recovering a Lac fragment and a pPIC9K vector, using T4DNA ligase to connect the Lac0 and pPIC9K, transforming a top10 transformation competent state by using a connecting product, coating the connecting product on an LB Amp antibiotic screening plate, culturing at 37 ℃ overnight, selecting a single clone, carrying out PCR verification, inoculating LB by a colony, extracting the plasmids, sending the plasmids to a sequencing company, carrying out verification, storing glycerol strain pPIC 9K-0 ℃ for verification.

Firstly extracting plasmids parsGAPz α A and pPIC9K-lac0, carrying out double digestion by restriction endonuclease, cutting gel to recover lac0 fragment and parsGAPz α A vector, using T4DNA ligase to connect target gene (lac0 gene) and parsGAPz α A vector, transforming the connection product into top10 transformation competence, coating the transformation product on LLB zeocin antibiotic screening plate, culturing overnight at 37 ℃, picking several clones the next day, carrying out colony PCR verification by using specific primers APpGF and 3AOX1R, inoculating LLB (containing zeocin) into positive clone, extracting plasmid, sending to a sequencing company for sequencing verification, storing glycerol parsGAPz α A-lac0-top10 at-70 ℃ after verification, wherein the sequences of the specific primers pGX 1R are as follows:

numbering	Name (R)	Sequence (5 '-3')
			SEQ ID NO：7	pGAPF	GTCCCTATTTCAATCAATTGAAC
SEQ ID NO：8	3AOX1R	GCAAATGGCATTCTGACATCC

EXAMPLE 3 correction of β -galactosidase recombinant expression vector downstream cloning site

Designing site-directed mutagenesis primers Kpn _ pCF and Kpn _ pCR, the specific sequences are as follows

Correcting the restriction enzyme site of lac gene to KpnI, the protoenzyme cleavage site of lac0 gene to NotI, using parsGAPz α A-lac0 plasmid as template, using high fidelity KOD-plus-neo DNA polymerase to amplify whole plasmid according to the PCR system and program of KOD enzyme, using PCR product purification kit to purify and recover, DpnI enzyme to digest plasmid template, after treatment, transforming 10ul of purified product into top10 transformation competence, at the same time transforming a negative control without DNA, on the next day, picking up single clone, inoculating into LLB tube, culturing to OD to about 1, collecting bacteria and extracting plasmid, and sequencing to determine whether the KpnI site has been changed.

The KOD enzyme PCR system and procedure were as follows according to the instructions for the KOD enzyme:

and (3) PCR system:

PCR procedure:

the PCR program was carried out for 30 cycles of 98 ℃/15s, 60 ℃/45s, 68 ℃/2min30 s.

Example 4 creation of random mutation library

Error-prone PCR was first performed using the template parsGAPZ α A-lac0(KpnI) and three primer pairs to amplify the upstream, midstream and downstream of the lac0 gene, respectively, the three primer pairs GAP _ EpF and seqLa _ R1, seqLa _ F2 and seqLa _ R2, seqLa _ F3 and GAP _ EpR, respectively, the three primer pairs had the following sequences:

sequence numbering	Sequence name	Sequence (5 '-3')
			SEQ ID NO：9	SeqLa_R1	CCAGTTAGTACCACCGAAAGTCATGTAC
SEQ ID NO：10	SeqLa_F2	GCATTTGGAACAATCTCCATCTACTCCTT
			SEQ ID NO：11	SeqLa_R2	GGCAAATCAGCAGAAACCCAAGCAGAAT
SEQ ID NO：12	SeqLa_F3	CTCCAATCGAAGTTATTGGTGCTCCTAC
			SEQ ID NO：15	GAP_EpF	TTGCTGCTAAAGAAGAAGGGGTATCTCTCG
SEQ ID NO：16	GAP_EpR	CGACGGCGCTATTCAGATCCTCTTCTG

The error-prone PCR system and procedure were as follows:

error-prone PCR system according to the instructions

Error prone PCR procedure

Wherein the PCR program is carried out for 30 cycles of 94 ℃/30s, 60 ℃/45s and 72 ℃/1min20 s.

Three error-prone PCR products (upstream, midstream and downstream sequences of lac0 gene) were recovered according to the OMEGA gel recovery kit instructions, and then, large-primer PCR was performed using the plasmid parsGAPZ α A-lac0 as a template and three error-prone PCR products as large primers, respectively.

PCR system according to KOD enzyme instructions:

PCR procedure:

wherein in the PCR program, 30 cycles of 98 ℃/15s, 60 ℃/45s and 68 ℃/2min40s are performed.

Taking the PCR product for electrophoresis detection, and transforming the large primer PCR product into a TransT1 competent cell. 100ul of the culture broth was spread on LLB medium and cultured overnight at 37 ℃. The next day, several single colonies were picked, inoculated into LLB tubes containing zeocin, shake-cultured, sent to sequencing company for sequencing, the number of mutant bases was guaranteed to be 1-3, thus ensuring the activity of the finally obtained protein. And extracting error-prone plasmids to obtain an error-prone plasmid library. Finally, the error-prone plasmid is precipitated and concentrated by alcohol, and transferred to GS115, X33, SMD1168 and KM71 competent cells. The preparation method of GS115 isoelectric competence is described in the specification of Pichia invitrogen plasmid.

Example 5 high-throughput screening of recombinant bacteria having β -galactosidase Activity

After the error-prone plasmid and the positive control plasmid (original parsGAPZ α A-lac0 obtained in example 3) were electroporated into Pichia pastoris, 1M sorbitol was immediately added, the mixture was placed in an incubator at 28-30 ℃ for standing and recovery for 1-2h, centrifuged to harvest the strain, spread in the incubator at 28-30 ℃ and cultured for 3 days, the ratio of blue and white spots on the plate and the difference in the color development depth of blue colonies were observed, as shown in FIGS. 3a and 3b, in which the circled colonies were blue colonies.

Selecting blue colonies and colonies on a positive control plate, inoculating the blue colonies and the colonies on the positive control plate into a 96-deep-hole plate, placing the blue colonies and the colonies on the positive control plate into a high-speed shaking table, culturing the blue colonies and the colonies in the high-speed shaking table at 28-30 ℃ for about 24 hours, sampling and measuring the concentration of the bacteria, centrifuging to collect bacteria until the concentration of the bacteria grows to about 1 OD, removing a supernatant culture medium, adding a fresh YPD culture medium to express β -galactosidase, taking fermentation liquid of 48 hours, 60 hours, 72 hours and 84 hours respectively, and measuring β -galactosidase activity (the enzyme activity measuring method refers to a method of lactase in FCCVII (American food chemistry code). The result is shown in figure 2, wherein E6, D4, H8, D11 and H12 represent several mutants which are screened at high in high flux, H12 is control lac0, namely lacH 12 represents lac 45 gene of free plasmid without mutation, as can be known in figure 2, E06, E48H, 60H, 8H, 7H, 6H, 7H, 6H, 7H, H.

Materials, reagents and experimental equipment related to the embodiment of the invention are all commercial products conforming to the field of bioengineering unless otherwise specified.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, modifications and decorations can be made without departing from the core technology of the present invention, and these modifications and decorations shall also fall within the protection scope of the present invention. Any changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope.

Sequence listing

<110> Ningbo Hinoya Marine Biotechnology Ltd

<120> high activity β -galactosidase, plasmid for high throughput screening of the enzyme and preparation method thereof

<160>15

<170>SIPOSequenceListing 1.0

<210>2

<211>986

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Ser Ile Lys His Arg Leu Asn Gly Phe Thr Ile Leu Glu His Pro Xaa

1 5 10 15

Pro Ala Lys Arg Asp Leu Leu Gln Asp Ile Val Thr Trp Asp Asp Lys

20 25 30

Ser Leu Phe Ile Asn Gly Glu Arg Ile Met Leu Phe Ser Gly Glu Val

35 40 45

His Pro Phe Arg Leu Pro Val Pro Ser Leu Trp Leu Asp Ile Phe His

50 55 60

Lys Ile Arg Ala Leu Gly Phe Asn Cys Val Ser Phe Tyr Ile Asp Trp

65 70 75 80

Ala Leu Leu Glu Gly Lys Pro Gly Asp Tyr Arg Ala Glu Gly Ile Phe

85 90 95

Ala Leu Glu Pro Phe Phe Asp Ala Ala Lys Glu Ala Gly Ile Tyr Leu

100 105 110

Ile Ala Arg Pro Gly Ser Tyr Ile Asn Ala Glu Val Ser Gly Gly Gly

115 120 125

Phe Pro Gly Trp Leu Gln Arg Val Asn Gly Thr Leu Arg Ser Ser Asp

130 135 140

Glu Pro Phe Leu Lys Ala Thr Asp Asn Tyr Ile Ala Asn Ala Ala Ala

145 150 155 160

Ala Val Ala Lys Ala Gln Ile Thr Asn Gly Gly Pro Val Ile Leu Tyr

165 170 175

Gln Pro Glu Asn Glu Tyr Ser Gly Gly Cys Cys Gly Val Lys Tyr Pro

180 185 190

Asp Ala Asp Tyr Met Gln Tyr Val Met Asp Gln Ala Arg Lys Ala Asp

195 200 205

Ile Val Val Pro Phe Ile Ser Asn Asp Ala Ser Pro Ser Gly His Asn

210 215 220

Ala Pro Gly Ser Gly Thr Gly Ala Val Asp Ile Tyr Gly His Asp Ser

225 230 235 240

Tyr Pro Leu Gly Phe Asp Cys Ala Asn Pro Ser Val Trp Pro Glu Gly

245 250 255

Xaa Leu Pro Asp Asn Phe Arg Thr Leu His Leu Glu Gln Ser Pro Ser

260 265 270

Thr Pro Tyr Ser Leu Leu Glu Phe Gln Ala Gly Ala Phe Asp Pro Trp

275 280 285

Gly Gly Pro Gly Phe Glu Lys Cys Tyr Ala Leu Val Asn His Glu Phe

290 295 300

Ser Arg Val Phe Tyr Arg Asn Asp Leu Ser Phe Gly Val Ser Thr Phe

305 310 315 320

Asn Leu Tyr Met Thr Phe Gly Gly Thr Asn Trp Gly Asn Leu Gly His

325 330 335

Pro Xaa Gly Tyr Thr Ser Tyr Asp Tyr Gly Ser Pro Ile Thr Glu Thr

340 345 350

Arg Asn Val Thr Arg Glu Lys Tyr Ser Asp Ile Lys Leu Leu Ala Asn

355 360 365

Phe Val Lys Ala Ser Pro Ser Tyr Leu Thr Ala Thr Pro Arg Asn Leu

370 375 380

Thr Thr Gly Val Tyr Thr Asp Thr Ser Asp Leu Ala Val Thr Pro Leu

385 390 395 400

Met Gly Asp Ser Pro Gly Ser Phe Phe Val Val Arg His Thr Asp Tyr

405 410 415

Ser Ser Gln Glu Ser Thr Ser Tyr Lys Leu Lys Leu Pro Thr Ser Ala

420 425 430

Gly Asn Leu Thr Ile Pro Gln Leu Glu Gly Thr Leu Ser Leu Asn Gly

435 440 445

Arg Asp Ser Lys Ile His Val Val Asp Tyr Asn Val Ser Gly Thr Asn

450 455 460

Ile Ile Tyr Ser Thr Ala Glu Val Phe Thr Trp Lys Lys Phe Asp Gly

465 470 475 480

Asn Lys Val Leu Val Leu Tyr Gly Gly Pro Lys Glu His His Glu Leu

485 490 495

Ala Ile Ala Ser Lys Ser Asn Val Thr Ile Xaa Glu Gly Ser Asp Ser

500 505 510

Gly Ile Val Ser Thr Arg Lys Gly Ser Ser Val Ile Ile Gly Trp Asp

515 520 525

Val Ser Ser Thr Arg Arg Ile Val Gln Val Gly Asp Leu Arg Val Phe

530 535 540

Leu Leu Asp Arg Asn Ser Ala Tyr Asn Tyr Xaa Val Pro Glu Leu Pro

545 550 555 560

Thr Glu Gly Thr Ser Pro Gly Phe Xaa Thr Ser Lys Thr Thr Ala Ser

565 570 575

Ser Ile Ile Val Lys Ala Gly Tyr Leu Leu Arg Gly Ala His Leu Asp

580 585 590

Gly Ala Asp Leu His Leu Thr Ala Asp Phe Asn Ala Thr Thr Pro Ile

595 600 605

Glu Val Ile Gly Ala Pro Thr Gly Ala Lys Asn Leu Phe Val Asn Gly

610 615 620

Glu Lys Ala Ser His Thr Val Asp Lys Asn Gly Ile Trp Xaa Ser Glu

625 630 635 640

Val Lys Tyr Ala Ala Pro Glu Ile Lys Leu Pro Gly Leu Lys Asp Leu

645 650 655

Asp Trp Lys Tyr Leu Asp Thr Leu Pro Glu Ile Lys Ser Ser Tyr Asp

660 665 670

Asp Ser Ala Trp Val Ser Ala Asp Leu Pro Lys Thr Lys Asn Thr His

675 680 685

Arg Pro Leu Asp Thr Pro Thr Ser Leu Tyr Ser Ser Asp Tyr Gly Phe

690 695 700

His Thr Gly Tyr Leu Ile Tyr Arg Gly His Phe Val Ala Asn Gly Lys

705 710 715 720

Glu Ser Glu Phe Phe Ile Arg Thr Gln Gly Gly Ser Ala Phe Gly Ser

725 730 735

Ser Val Trp Leu Asn Glu Thr Tyr Leu Gly Ser Trp Thr Gly Ala Asp

740 745 750

Tyr Ala Met Asp Gly Asn Ser Thr Tyr Lys Leu Ser Gln Leu Glu Ser

755 760 765

Gly Xaa Asn Tyr Val Ile Thr Val Val Ile Asp Asn Leu Gly Leu Asp

770 775 780

Glu Asn Trp Thr Val Gly Glu Glu Thr Met Xaa Asn Pro Arg Gly Ile

785 790 795 800

Leu Ser Tyr Lys Leu Ser Gly Gln Asp Ala Ser Ala Ile Thr Trp Lys

805 810 815

Leu Thr Gly Asn Leu Gly Gly Glu Asp Tyr Gln Asp Lys Val Arg Gly

820 825 830

Pro Leu Asn Glu Gly Gly Leu Tyr Ala Glu Arg Gln Gly Phe His Gln

835 840 845

Pro Gln Pro Pro Ser Glu Ser Trp Glu Ser Gly Ser Pro Leu Glu Gly

850 855 860

Leu Ser Lys Xaa Gly Ile Gly Phe Tyr Thr Ala Gln Phe Asp Leu Asp

865 870 875 880

Leu Pro Lys Gly Trp Asp Val Pro Leu Tyr Phe Asn Phe Gly Asn Asn

885 890 895

Thr Gln Ala Ala Arg Ala Gln Leu Tyr Val Asn Gly Tyr Gln Tyr Gly

900 905 910

Lys Phe Thr Gly Asn Val Gly Pro Gln Thr Ser Phe Pro Val Pro Glu

915 920 925

Gly Ile Leu Asn Tyr Arg Gly Thr Asn Tyr Val Ala Leu Ser Leu Trp

930 935 940

Ala Leu Glu Ser Asp Gly Ala Lys Leu Gly Ser Phe Glu Leu Ser Tyr

945 950 955 960

Thr Thr Pro Val Leu Thr Gly Tyr Gly Asp Val Glu Ser Pro Glu Gln

965 970 975

Pro Lys Tyr Glu Gln Arg Lys Gly Ala Tyr

980 985

<210>2

<211>452

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tcaacatctt tggataatat cagaatgaga aagaacagat acgcagtacg ttttttggtg 60

agctctttgc acttctttag ttctttccat caatatcagt tttttaaact tttaggacta 120

aaagtgatgt ttaacttcaa aatgtttaaa attttgttct tcccgacgtt cattaagaat 180

actaatacac tttaataatt attttaatat tttgttctaa ataatgactt ttaattaaaa 240

aagataaaat ataaaaacat cataataact caccagaggt taagaacaaa aaaacaaatt 300

agatatctgc taatccaata tagttaaatc aatctttcct tggtataatg ggtatattac 360

atatatttca aggaccgaca ctcctaccaa atatctaaaa tttaccatat taacataaca 420

tgtatataaa cgtcaaatca taatcagcac ta 452

<210>3

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tctgcgctct gctgaagcca gttacct 27

<210>4

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ggtaggagtg tcggtccttg aaatatatg 29

<210>5

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

cagaatgaga aagaacagat acgcagtac 29

<210>6

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gtccctattt caatcaattg aac 23

<210>7

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gcaaatggca ttctgacatc c 21

<210>10

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ccagttagta ccaccgaaag tcatgtac 28

<210>11

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gcatttggaa caatctccat ctactcctt 29

<210>12

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ggcaaatcag cagaaaccca agcagaat 28

<210>13

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ctccaatcga agttattggt gctcctac 28

<210>8

<211>57

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ggtgcttatt aaggtaccca gctttctaga acaaaaactc atctcagaag aggatct 57

<210>9

<211>58

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

tctagaaagc tgggtacctt aataagcacc ctttctttgc tcgtatttag gttgctct 58

<210>14

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ttgctgctaa agaagaaggg gtatctctcg 30

<210>15

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

cgacggcgct attcagatcc tcttctg 27

Claims

1. The high-activity β -galactosidase is characterized in that the amino acid sequence is shown as SEQ ID NO. 2, or the sequence shown as SEQ ID NO. 2 is a derivative amino acid sequence which is subjected to elimination, substitution and addition of one or more amino acids and has the same function as the β -galactosidase represented by SEQ ID NO. 2.

2. An episomal plasmid for high-throughput screening of β -galactosidase with high activity, characterized in that it comprises the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 3.

3. A host cell for expressing high-activity β -galactosidase is characterized by comprising a sequence shown as SEQ ID NO. 1 and SEQ ID NO. 3.

4. The preparation method of the episomal plasmid for high-throughput screening of high-activity β -galactosidase is characterized by comprising the following steps:

(1) construction of episomal plasmids containing autonomously replicating sequences

Synthesizing panARS gene sequence, namely the sequence shown in SEQ ID NO. 3, cloning the panARS gene sequence to a puc57 cloning vector, carrying out enzyme digestion on puc57-ARS and pGAPz α A, connecting the vector and the target gene panARS, transforming a connecting product to top10 competence, carrying out screening verification by colony PCR and enzyme digestion, verifying correct clone for sequencing verification, and naming the recombinant vector verified to be correct as parsGAPz α A;

(2) construction of β -galactosidase recombinant expression vector

Carrying out double enzyme digestion on pPIC9K-lac0 of constructed parsGAPz α A and lac0 genes, connecting a vector and the lac0 gene, transforming top10, carrying out screening verification by using a colony PCR and double enzyme digestion verification method, and naming a recombinant vector verified to be correct as parsGAPz α A-lac0, wherein the sequence of the lac0 gene is shown as SEQ ID NO: 1;

(3) construction of random mutation library of β -galactosidase pichia pastoris expression bacteria

Taking pars GAPz α A-lac0 as a template, making three sequences of upstream, midstream and downstream of an error-prone PCR amplification lac0 gene, recovering error-prone PCR products, taking three products of error-prone PCR as large primers, taking pars GAPz α A-lac0 as a template, making MegaWhopPCR amplification full-length plasmid, digesting the original plasmid template by DpnI enzyme to obtain a product, purifying, directly converting escherichia coli, selecting a plurality of clones, carrying out sequencing, detecting the mutation rate, ensuring that the number of base mutations is between 1 and 3, extracting mutant plasmids by using mixed bacteria liquid after all conditions are completely met, and electrically converting pichia pastoris X33, GS115, SMD1168 and KM 71;

5. The method for preparing the episomal plasmid for high-throughput screening of β -galactosidase with high activity according to claim 4, wherein the primers used in the error-prone PCR amplification of the upstream, midstream and downstream three sequences of the lac gene in step (4) correspond to GAP _ EpF and seqLa _ R1, seqLa _ F2 and seqLa _ R2, seqLa _ F3 and GAP _ EpR, respectively, and the sequences thereof are that the GAP _ EpF sequence is shown in SEQ ID NO. 15, the seqLa _ R1 sequence is shown in SEQ ID NO. 9, the seqLa _ F2 sequence is shown in SEQ ID NO. 10, the seqLa _ R2 sequence is shown in SEQ ID NO. 11, the seqLa _ F3 sequence is shown in SEQ ID NO. 12, and the GAP _ EpR sequence is shown in SEQ ID NO. 16.