CN111172143B

CN111172143B - D-xylonic acid dehydratase and application thereof

Info

Publication number: CN111172143B
Application number: CN202010026812.9A
Authority: CN
Inventors: 陈可泉; 麦丹丹; 王昕�
Original assignee: Nanjing Tech University
Current assignee: Nanjing Tech University
Priority date: 2020-01-10
Filing date: 2020-01-10
Publication date: 2021-09-24
Anticipated expiration: 2040-01-10
Also published as: CN111172143A

Abstract

The invention discloses D-xylonic acid dehydratase, wherein the amino acid sequence of the D-xylonic acid dehydratase is shown as SEQ ID No.: 1-4, directionally evolving D-xylonic acid dehydratase YjhG from escherichia coli through error-prone PCR to obtain four D-xylonic acid dehydratase YjhG gene sequences, converting the D-xylonic acid dehydratase YjhG gene sequences into escherichia coli to obtain a plurality of groups of mutant strains 91, 96, 62 and 286 with high activity, wherein xylonic acid consumed by the strains in 12 hours is 4.2g/L, 4.8g/L, 6.22g/L and 5.43g/L respectively, and xylonic acid consumed by an initial strain (parent strain A) under the same condition is 2.15g/L and is increased by 2.1 times, 2.4 times, 2.89 times and 2.5 times respectively.

Description

D-xylonic acid dehydratase and application thereof

Technical Field

The invention belongs to the field of microbial genetic engineering, and particularly relates to D-xylonic acid dehydratase and application thereof.

Background

D-xylonic acid dehydratase is named as D-hydrogen xylose-lyase and can catalyze xylonic acid dehydration reaction. Currently, xylonate dehydratase has different bacterial sources, such as halophilic archaea, lactobacillus crescentus and pseudomonas. D-xylonic acid dehydratases from different sources may utilize different substrates, such as D-gluconic acid, D-xylonic acid, and D-xylose. Although the xylose dehydratase YjhG derived from escherichia coli is known to have enzymatic activity for catalyzing dehydration of D-xylonic acid, there are few studies on its properties.

At present, it has been determined that D-xylonic acid dehydratase is an important enzyme in many metabolic pathways. In some biosynthetic pathways of high value-added chemicals such as ethylene glycol, triols and tetraols, the xylonic acid dehydratase YjhG derived from Escherichia coli is used to catalyze the D-xylonic acid dehydration reaction. For example, in the biological pathway for the production of D-1,2, 4-butanetriol using D-xylose, the synthetic pathway comprises: (1) converting D-xylose into D-xylonic acid under the catalysis of D-xylose dehydrogenase; (2) d-xylonic acid is catalyzed by D-xylonic acid dehydratase to generate D-3-deoxyglycerol pentofuranose acid; (3) d-3-deoxyglycerol pentofuranonate is catalyzed by 2-keto acid decarboxylase to generate D-3, 4-dihydroxy butyraldehyde; (4) d-3, 4-dihydroxy butyraldehyde is catalyzed by dehydrogenase to generate D-1,2, 4-butanetriol. The xylanase has important influence on the yield and quality of the production of the glycol, the triol and the tetraol by microbial fermentation, but the reaction rate of the xylonic acid dehydratase is slow, so that the catalytic reaction time is long. Therefore, the screening of the xylonate dehydratase with high catalytic efficiency is continued to improve the reaction rate of the xylonate dehydratase.

Disclosure of Invention

The technical problem to be solved by the invention is to provide the xylonic acid dehydratase YjhG with high catalytic efficiency by a technical means of directed evolution.

The invention also aims to solve the technical problem of providing the application of the xylonic acid dehydratase YjhG in preparing the polyalcohol.

In order to solve the technical problems, the invention adopts the following technical scheme:

a D-xylonate dehydratase having an amino acid sequence as set forth in SEQ ID No.: 1 to 4.

The gene sequence for coding the D-xylonic acid dehydratase is within the protection scope of the invention, and SEQ ID No.: 1-4 into a gene sequence to obtain the gene sequence of the D-xylonate dehydratase.

A recombinant plasmid comprising the gene sequence encoding D-xylonate dehydratase.

A recombinant cell comprising the gene sequence encoding D-xylonate dehydratase.

The application of the D-xylonic acid dehydratase in preparing the polyalcohol is within the protection scope of the invention.

Preferably, the polyol is 1,2, 4-butanetriol.

A gene engineering bacterium for producing 1,2, 4-butanetriol, which is introduced into Escherichia coli with the gene sequence coding D-xylonic acid dehydratase of the present invention.

The genetic engineering bacteria for producing 1,2, 4-butanetriol, the Escherichia coli is introduced with D-xylonic acid dehydratase gene, D-xylose dehydrogenase gene, benzoyl formate decarboxylase gene and alcohol dehydrogenase gene, the nucleotide sequence of the D-xylose dehydrogenase gene is shown as SEQ ID No.: 5, and the nucleotide sequence of the benzoyl formate decarboxylase gene is shown as SEQ ID No.: 6, and the nucleotide sequence of the alcohol dehydrogenase gene is shown as SEQ ID No.: shown at 7.

The construction method of the genetic engineering bacteria for producing 1,2, 4-butanetriol comprises the following steps:

(1) respectively cloning a D-xylonic acid dehydratase gene, a D-xylose dehydrogenase gene, a benzoyl formate decarboxylase gene and an alcohol dehydrogenase gene into expression plasmids, wherein the expression plasmids comprise BT-62 and BT-286 to obtain recombinant plasmids,

(2) and transforming the recombinant vector into a host bacterium which is Trans 1T1 to obtain the genetically engineered bacterium for producing the 1,2, 4-butanetriol.

The application of the genetic engineering bacteria for producing 1,2, 4-butanetriol in the preparation of 1,2, 4-butanetriol is within the protection scope of the invention.

The invention carries out error-prone PCR on the gene sequence of D-xylonate dehydratase YjhG from escherichia coli through error-prone PCR, changes the codon of xylonate dehydratase (YjhG) gene through random mutation, changes the position of the codon base of YjhG gene through error-prone PCR random mutation, and finally obtains

mutant strains

91, 96, 62 and 286 with high xylonate dehydratase activity through screening. Respectively extracting plasmids, and sending the plasmids to Shanghai biological engineering technical service company Limited for sequencing to determine the mutated YjhG gene sequence.

No. 91 (amino acid sequence is shown as SEQ ID NO. 1) of the mutant strain, wherein the 143 th base is mutated from T to C, the corresponding amino acid is mutated from histidine to threonine, the 236 th base is mutated from A to G, and the corresponding amino acid is mutated from lysine to arginine; the 520 th base is mutated from G to A, and the corresponding amino acid is mutated from alanine to threonine; the base 938 is mutated from T to C and the corresponding amino acid from glutamine to proline.

The 967 th base of the mutant strain No. 96 (amino acid sequence is shown in SEQ ID NO. 2) is mutated from G to A, and the corresponding amino acid is mutated from alanine to threonine.

No. 62 (amino acid sequence is shown in SEQ ID NO. 3) 967 base is mutated from G to A, the corresponding amino acid is mutated from alanine to threonine, 1855 base is mutated from G to A, the corresponding amino acid is mutated from aspartic acid to asparagine, 1898 base is mutated from C to T, and the corresponding amino acid is mutated from threonine to isoleucine.

In the mutant 286 (the amino acid sequence is shown in SEQ ID NO. 4), the 163 st base is mutated from T to C, the corresponding amino acid is mutated from serine to proline, the 203 nd amino acid is mutated from G to A, the corresponding amino acid is mutated from serine to asparagine, the 967 th base is mutated from G to A, and the corresponding amino acid is mutated from alanine to threonine.

Has the advantages that: compared with the prior art, the invention has the following advantages:

the YjhG gene is subjected to random mutation transformation by using an error-prone PCR technology to obtain a plurality of groups of mutant strains No. 91, No. 96, No. 62 and No. 286 with higher activity, the xylonic acid consumed by the strains within 12h is respectively 4.2g/L, 4.8g/L, 6.22g/L and 5.43g/L, and the xylonic acid consumed by the starting strain (parent strain A) under the same condition is 2.15g/L, which is respectively improved by 2.1 times, 2.4 times, 2.89 times and 2.5 times. Random mutation transformation is carried out on YjhG gene by using error-prone PCR technology, so that mutant strains with obviously improved conversion efficiency when xylonic acid is used as a substrate are obtained, the breeding target is clear, and the efficiency is high.

Drawings

FIG. 1 comparison of enzyme activities of mutant and recombinant strains after first round error-prone PCR rescreening

FIG. 2 is a comparison of the enzyme activities of the mutant strain and the recombinant strain after the second round of error-prone PCR preliminary screening.

FIG. 3 is a comparison of the enzyme activities of the mutant strain and the recombinant strain after the second round of error-prone PCR rescreening.

FIG. 4 comparison of butanetriol production by mutant strains after the second round of error-prone PCR rescreening.

FIG. 5 comparison of butanetriol production by mutant strains after the first round of error-prone PCR rescreening.

Detailed Description

The invention will be better understood from the following examples. However, those skilled in the art will readily appreciate that the description of the embodiments is only for illustrating the present invention and should not be taken as limiting the invention as detailed in the claims.

D-xylonate dehydratase used in the examples was a gene derived from Escherichia coli, which was ligated to a pCWJ expression vector and transformed into competent cells of Escherichia coli Trans 1T1, and the resulting positive clones were cultured to OD 600 of 0.6 to 1.0, followed by addition of IPTG to a final concentration of 0.5 mmol. multidot.L^-1Culturing at 33 ℃ for 12-18 h.

Example 1: construction of YjhG Gene-containing Strain

(1) Introducing enzyme cutting sites (NcoI and Hind III) by using primers at the 5 'end and the 3' end of the YjhG gene, carrying out double enzyme cutting on the YjhG gene and the pCWJ plasmid, and then connecting the YjhG gene to a pCWJ vector;

(2) the above-mentioned ligation solution was transferred into competent cells of Escherichia coli Trans 1T1 (all-grass Biotechnology Co., Ltd.), spread on LB plate with 50mg/L resistance to Chloromyces, and cultured overnight at 37 ℃.

(3) And (3) selecting a single colony growing on the plate, transferring the single colony to an LB culture medium containing 50mg/L chloramphenicol resistance, extracting a plasmid, and performing enzyme digestion verification by using restriction enzymes Spe I and Kpn I to finally obtain the recombinant plasmid pCWJ-YjhG.

Example 2: construction of YjhG Gene mutant library

(1) Inoculating the Escherichia coli Trans 1T1/pCWJ-YjhG obtained in example 1 into LB liquid medium, culturing in a shaker at 37 ℃, centrifuging for 5min at 6000g after 10h, collecting somatic cells, and extracting the plasmid pCWJ-YjhG by using a plasmid miniextraction kit (purchased from Shanghai Biotechnology engineering service Co., Ltd.); the LB liquid medium consists of: 10g/L of peptone, 5g/L of yeast powder, 5g/L of sodium chloride and 50mg/L of chloramphenicol.

(2) Establishing error-prone PCR reaction:

(1a) design ofForward primer containing restriction site (YjhG-NcoI-F, CATG)CCATGGAAATGTCTGTTCGCAATATTTTTGCTGAC, underlined NcoI cleavage site) and a reverse primer (YjhG-HindIII-R, CCCAAGCT TTCAGTTTTTATTCATAAAATCGCGCAAAGC, underlined Hind III cleavage site);

(1b) preparing 50uL of error-prone PCR reaction mixed solution:

the error-prone PCR reaction system is as follows: 10 XTaq buffer 5uL, Mn²⁺(50mmol/L)1uL、Mg²⁺(50mmol/L)7uL, DNA template 10uL, 10 XdNTP 5uL, upstream primer YjhG-NcoI-F2 uL, downstream primer YjhG-Hind III-R2 uL, Taq enzyme 0.5uL, ddH₂O 18uL；

(1c) Placing the error-prone PCR reaction mixed solution on a PCR instrument to perform error-prone PCR amplification on YjhG gene, wherein the amplification procedure is as follows:

denaturation at 94 ℃ for 3min, and 20 cycles, wherein each cycle comprises denaturation at 94 ℃ for 60s, annealing at 57 ℃ for 60s, and extension at 72 ℃ for 60s, after the cycle is finished, extension is not needed at 72 ℃, and then the PCR product is stored at 4 ℃, and after the amplification is finished, the size of the PCR product is confirmed by agarose gel electrophoresis with the concentration of 1.5%.

(3) Construction of YjhG Gene mutant library:

(2a) recovering PCR amplification products by using an agarose recovery kit (Tiangen Biochemical technology Co., Ltd.);

(2b) preparing 50uL of enzyme digestion reaction mixed solution, and performing double enzyme digestion on the PCR product and the pCWJ vector after the glue recovery in the step (2b) by using restriction enzymes NcoI and Hind III respectively, wherein the double enzyme digestion system is as follows: fragment DNA template: 42uL, endonuclease NcoI: 1.5uL, endonuclease Hind III: 1.5uL, 10 XQcut Buffer: 5uL, pCWJ vector system: pCWJ vector: 42uL, endonuclease NcoI: 1.5uL, endonuclease Hind III: 1.5uL, 10 XQcut Buffer: 5 uL. Respectively performing enzyme digestion in a water bath at 37 deg.C for 45 min;

(2c) the restriction enzyme products are electrophoresed on agarose gel with the concentration of 1.5% to confirm the size so as to verify the restriction enzyme effect, the target fragments are recovered by a purification kit, the pCWJ vector is cut into gel, and the gel is recovered by a DNA gel recovery kit (Tiangen Biochemical technology Co., Ltd.).

(2d) Preparing 10uL of ligation reaction mixed solution, wherein the system is as follows: t4 Ligation Buffer:1uL, the double digested pCWJ vector obtained in step (2 c): 2.5uL, double digested DNA fragment obtained in step (c): 3.5uL, T4 DNA Ligase: 0.5uL, and placing in a water bath kettle at 25 ℃ for reaction for 30 min. The ligation products were transformed into 25uL E.coli Trans 1T1 competent according to molecular cloning protocols.

(2f) Finally, the extract is spread on an LB solid medium plate (peptone 10g/L, yeast powder 5g/L, sodium chloride 5g/L, chloramphenicol 50mg/mL), placed in the forward direction at 37 ℃ to absorb excessive liquid, and then cultured in an inverted manner overnight;

(2g) all single colonies of transformants grown on the transformation plates were streaked on LB solid medium plate containing 50mg/L chloramphenicol, and cultured in an inverted state in a 37 ℃ incubator overnight. All transformants grown were subjected to colony PCR using primers.

Example 3: obtaining of genetic engineering bacteria with high YjhG yield

Respectively inoculating the transformant and pCWJ-YjhG strain in the mutant library constructed in the embodiment 2 into 1mL LB liquid culture medium (10 g/L of peptone, 5g/L of yeast powder, 5g/L of sodium chloride and 50mg/mL of chloramphenicol) in a 96-well plate, adding 0.5mmol of IPTG, carrying out shake cultivation at the rotating speed of 33 ℃ and 200rpm for 12h, centrifuging at 8000r/min and 4 ℃ for 10min after the cultivation is finished, collecting cells, adding 500uL of xylose solution to ensure that the final concentration is 100g/L and 500uL of water, uniformly mixing, carrying out shake conversion at 33 ℃ and 200rpm for 12h, adding 30mM periodate reagent, reacting with xylonic acid to generate formaldehyde, carrying out primary screening by measuring the absorbance value at 410nm by an enzyme labeling instrument, carrying out secondary screening by using high performance liquid detection, screening out secondary screening to obtain a mutant strain 91, the enzyme activity of YjhG is obviously improved compared with that of the parent strain A, No. 96, as shown in FIG. 1, in which the mutant No. 91 consumed 2.3g/L of xylonic acid within 12 hours, the mutant No. 96 consumed 2.5g/L of xylonic acid within 12 hours, and the unmutated strain YjhG consumed 0.93g/L of xylonic acid within 12 hours.

The gene engineering bacteria No. 91 and No. 96 are cultured respectively as follows:

(1) single colonies of the recombinant strain pCWJ-YjhG were picked from the plate, inoculated into a shake tube containing 5mL of LB resistant to 50mg/L chloramphenicol, and cultured at 37 ℃ to 6 ℃After 8h, the cells were transferred to 100mL LB medium containing 50mg/L chloramphenicol resistance and cultured to OD₆₀₀0.6-0.9 mmol of IPTG is added, and centrifugal strain collection is induced for 12h to obtain recombinant strain pCWJ-YjhG cells

(2) Fermentation culture: the formula of the culture medium is as follows: peptone: 10g/L, yeast powder: 5g/L, sodium chloride: 5g/L, using water as solvent, and carrying out fermentation culture on the cells obtained in the step (a), wherein the culture temperature is as follows: 33 ℃, incubation time: and (4) 12 h.

Adding pre-cultured gene engineering bacteria No. 91 and No. 96 into aqueous solution of xylonic acid respectively, controlling the concentration of the xylonic acid solution in an initial reaction system to be 20g/L and controlling the OD of the strain₆₀₀60 ℃, reacting at 37 ℃ for 12h, and detecting how much xylonic acid is consumed by high performance liquid chromatography. As shown in FIG. 2, the mutant strains No. 91 and No. 96 consumed about 4.2g/L and 4.8g/L of xylonic acid within 12h, respectively, which are improved by 2.1 and 2.4 times compared with the parent strain A under the same conditions.

The xylonic acid dehydratase genes (YjhG) of No. 91 and No. 96 mutant strains are cut off by utilizing the enzyme cutting sites in the embodiment 1 to cut off the mutant YjhG fragments, the mutant YjhG genes, the D-xylose dehydrogenase genes, the benzoyl formate decarboxylase genes and the alcohol dehydrogenase genes are respectively introduced into plasmids to obtain recombinant plasmids BT-91 and BT-96, and then the recombinant plasmids are respectively transformed into host bacteria Trans 1T1 to obtain recombinant bacteria BT-T1-91 and BT-T1-96. The reaction system was controlled to 20mL, substrate 20g/L, OD 60, pH 7.0. As shown in FIG. 5, xylonic acid consumed by the mutant strains BT-T1-91 and BT-T1-96 in 48h was 11.13g/L and 13.3g/L, respectively, which were improved by about 2-fold and 2.4-fold compared to the non-mutant strain (PGP), wherein the yields of 1,2, 4-butanetriol of the mutant strains No. 91 and No. 96 reached 10.45g/L and 12.55g/L, respectively, while the yield of 1,2, 4-butanetriol of the non-mutant strain was 5.75g/L, and thus was improved by about 1.86-fold and 2.1-fold compared to the mutant strain.

Example 4: error-prone PCR was performed on 96 # high-producing strain

A mutant library was constructed for mutant strain No. 96 according to the construction of the mutant library of YjhG in example 1, and constructed on pCWJ vector, and a mutant strain having higher enzyme activity was selected according to the method in example 3.

Example 5: analysis of high-yield mutant strain YjhG gene sequence

The mutant strain No. 62 obtained by re-screening in the embodiment 4 and the plasmid contained in the mutant strain No. 286 are obtained according to the method described in the embodiment 1, and sent to Shanghai biological engineering technology service company Limited to determine the mutated YjhG gene sequence by sequencing, and the DNAman software is used for sequence comparison; the amino acid sequence of the mutant strain No. 62 gene is shown in SEQ ID NO. 3; the amino acid sequence of the mutant strain 286 is shown in SEQ ID NO. 4.

Analysis of mutant YjhG mutation sites: the 967 th base is mutated from G to A, the corresponding amino acid is mutated from alanine to threonine, the 1855 th base is mutated from G to A, the corresponding amino acid is mutated from aspartic acid to asparagine, the 1898 th base is mutated from C to T, and the corresponding amino acid is mutated from threonine to isoleucine.

The 163 st base of the mutant 286 is mutated from T to C, the corresponding amino acid is mutated from serine to proline, the 203 nd base is mutated from G to A, the corresponding amino acid is mutated from serine to asparagine, the 967 th base is mutated from G to A, and the corresponding amino acid is mutated from alanine to threonine.

Example 5:

the genetic engineering bacteria No. 62 and No. 286 are cultured respectively as follows:

(1) selecting single colonies of the recombinant strain pCWJ-YjhG from the plate, respectively, inoculating the single colonies into a shaking tube containing 5mL of LB with 50mg/L chloramphenicol resistance, culturing at 37 ℃ for 6-8 h, transferring the single colonies into 100mL of LB culture medium with 50mg/L chloramphenicol resistance, and culturing until OD is reached₆₀₀0.6-0.9 mmol of IPTG is added, and centrifugal strain collection is induced for 12h to obtain recombinant strain pCWJ-YjhG cells

Adding pre-cultured gene engineering bacteria No. 62 and No. 238 into aqueous solution of xylonic acid respectively, controlling the concentration of the xylonic acid solution in the initial reaction system to be 20g/L and controlling the OD of the strain₆₀₀60 ℃, reacting at 37 ℃ for 12h, and detecting how much xylonic acid is consumed by high performance liquid chromatography. As shown in FIG. 2, the mutant strains No. 91 and No. 96 consumed about 4.2g/L and 4.8g/L of xylonic acid within 12h, respectively, which are improved by 2.1 and 2.4 times compared with the parent strain A under the same conditions.

Example 6:

the xylonic acid dehydratase genes (YjhG) of No. 62 and No. 286 mutant strains cut off the mutant YjhG fragments by utilizing the enzyme cutting sites in the embodiment 1, the mutant YjhG genes, the D-xylose dehydrogenase genes, the benzoyl formate decarboxylase genes and the alcohol dehydrogenase genes are respectively introduced into plasmids to obtain recombinant plasmids BT-91 and BT-96, and then the recombinant plasmids are respectively transformed into host bacteria Trans 1T1 to obtain recombinant bacteria BT-T1-62 and BT-T1-238. The reaction system was controlled to 20mL, substrate 20g/L, OD 60, pH 7.0. As shown in FIG. 3, the yields of 1,2, 4-butanetriol were 18.2g/L and 15.69g/L, respectively, for the mutant strains BT-T1-62 and BT-T1-286, while the yield of 1,2, 4-butanetriol was 5.43g/L for the non-mutant strain, and thus, was increased by about 2.89-fold and 2.5-fold as compared with the mutant strain.

Sequence listing

<110> Nanjing university of industry

<120> D-xylonic acid dehydratase and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 655

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ser Val Arg Asn Ile Phe Ala Asp Glu Ser His Asp Ile Tyr Thr

1 5 10 15

Val Arg Thr His Ala Asp Gly Pro Asp Gly Glu Leu Pro Leu Thr Ala

20 25 30

Glu Met Leu Ile Asn Arg Pro Ser Gly Asp Leu Phe Gly Met Thr Thr

35 40 45

Asn Ala Gly Met Gly Trp Ser Pro Asp Glu Leu Asp Arg Asp Gly Ile

50 55 60

Leu Leu Leu Ser Thr Leu Gly Gly Leu Arg Gly Ala Asp Gly Arg Pro

65 70 75 80

Val Ala Leu Ala Leu His Gln Gly His Tyr Glu Leu Asp Ile Gln Met

85 90 95

Lys Ala Ala Ala Glu Val Ile Lys Ala Asn His Ala Leu Pro Tyr Ala

100 105 110

Val Tyr Val Ser Asp Pro Cys Asp Gly Arg Thr Gln Gly Thr Thr Gly

115 120 125

Met Phe Asp Ser Leu Pro Tyr Arg Asn Asp Ala Ser Met Val Met Arg

130 135 140

Arg Leu Ile Arg Ser Leu Pro Asp Ala Lys Ala Val Ile Gly Val Ala

145 150 155 160

Ser Cys Asp Lys Gly Leu Pro Ala Thr Met Met Ala Leu Thr Ala Gln

165 170 175

His Asn Ile Ala Thr Val Leu Val Pro Gly Gly Ala Thr Leu Pro Ala

180 185 190

Lys Asp Gly Glu Asp Asn Gly Lys Val Gln Thr Ile Gly Ala Arg Phe

195 200 205

Ala Asn Gly Glu Leu Ser Leu Gln Asp Ala Arg Arg Ala Gly Cys Lys

210 215 220

Ala Cys Ala Ser Ser Gly Gly Gly Cys Gln Phe Leu Gly Thr Ala Gly

225 230 235 240

Thr Ser Gln Val Val Ala Glu Gly Leu Gly Leu Ala Ile Pro His Ser

245 250 255

Ala Leu Ala Pro Ser Gly Glu Pro Val Trp Arg Glu Ile Ala Arg Ala

260 265 270

Ser Ala Arg Ala Ala Leu Asn Leu Ser Gln Lys Gly Ile Thr Thr Arg

275 280 285

Glu Ile Leu Thr Asp Lys Ala Ile Glu Asn Ala Met Thr Val His Ala

290 295 300

Ala Phe Gly Gly Ser Thr Asn Leu Pro Leu His Ile Pro Ala Ile Ala

305 310 315 320

His Gln Ala Gly Cys His Ile Pro Thr Val Asp Asp Trp Ile Arg Ile

325 330 335

Asn Lys Arg Val Pro Arg Leu Val Ser Val Leu Pro Asn Gly Pro Val

340 345 350

Tyr His Pro Thr Val Asn Ala Phe Met Ala Gly Gly Val Pro Glu Val

355 360 365

Met Leu His Leu Arg Ser Leu Gly Leu Leu His Glu Asp Val Met Thr

370 375 380

Val Thr Gly Ser Thr Leu Lys Glu Asn Leu Asp Trp Trp Glu His Ser

385 390 395 400

Glu Arg Arg Gln Arg Phe Lys Gln Leu Leu Leu Asp Gln Glu Gln Ile

405 410 415

Asn Ala Asp Glu Val Ile Met Ser Pro Gln Gln Ala Lys Ala Arg Gly

420 425 430

Leu Thr Ser Thr Ile Thr Phe Pro Val Gly Asn Ile Ala Pro Glu Gly

435 440 445

Ser Val Ile Lys Ser Thr Ala Ile Asp Pro Ser Met Ile Asp Glu Gln

450 455 460

Gly Ile Tyr Tyr His Lys Gly Val Ala Lys Val Tyr Leu Ser Glu Lys

465 470 475 480

Ser Ala Ile Tyr Asp Ile Lys His Asp Lys Ile Lys Ala Gly Asp Ile

485 490 495

Leu Val Ile Ile Gly Val Gly Pro Ser Gly Thr Gly Met Glu Glu Thr

500 505 510

Tyr Gln Val Thr Ser Ala Leu Lys His Leu Ser Tyr Gly Lys His Val

515 520 525

Ser Leu Ile Thr Asp Ala Arg Phe Ser Gly Val Ser Thr Gly Ala Cys

530 535 540

Ile Gly His Val Gly Pro Glu Ala Leu Ala Gly Gly Pro Ile Gly Lys

545 550 555 560

Leu Arg Thr Gly Asp Leu Ile Glu Ile Lys Ile Asp Cys Arg Glu Leu

565 570 575

His Gly Glu Val Asn Phe Leu Gly Thr Arg Ser Asp Glu Gln Leu Pro

580 585 590

Ser Gln Glu Glu Ala Thr Ala Ile Leu Asn Ala Arg Pro Ser His Gln

595 600 605

Asp Leu Leu Pro Asp Pro Glu Leu Pro Asp Asp Thr Arg Leu Trp Ala

610 615 620

Met Leu Gln Ala Val Ser Gly Gly Thr Trp Thr Gly Cys Ile Tyr Asp

625 630 635 640

Val Asn Lys Ile Gly Ala Ala Leu Arg Asp Phe Met Asn Lys Asn

645 650 655

<210> 2

<211> 655

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ser Val Arg Asn Ile Phe Ala Asp Glu Ser His Asp Ile Tyr Thr

1 5 10 15

Val Arg Thr His Ala Asp Gly Pro Asp Gly Glu Leu Pro Leu Thr Ala

20 25 30

Glu Met Leu Ile Asn Arg Pro Ser Gly Asp Leu Phe Gly Met Thr Met

35 40 45

Asn Ala Gly Met Gly Trp Ser Pro Asp Glu Leu Asp Arg Asp Gly Ile

50 55 60

Leu Leu Leu Ser Thr Leu Gly Gly Leu Arg Gly Ala Asp Gly Lys Pro

65 70 75 80

Val Ala Leu Ala Leu His Gln Gly His Tyr Glu Leu Asp Ile Gln Met

85 90 95

Lys Ala Ala Ala Glu Val Ile Lys Ala Asn His Ala Leu Pro Tyr Ala

100 105 110

Val Tyr Val Ser Asp Pro Cys Asp Gly Arg Thr Gln Gly Thr Thr Gly

115 120 125

Met Phe Asp Ser Leu Pro Tyr Arg Asn Asp Ala Ser Met Val Met Arg

130 135 140

Arg Leu Ile Arg Ser Leu Pro Asp Ala Lys Ala Val Ile Gly Val Ala

145 150 155 160

Ser Cys Asp Lys Gly Leu Pro Ala Thr Met Met Ala Leu Ala Ala Gln

165 170 175

His Asn Ile Ala Thr Val Leu Val Pro Gly Gly Ala Thr Leu Pro Ala

180 185 190

Lys Asp Gly Glu Asp Asn Gly Lys Val Gln Thr Ile Gly Ala Arg Phe

195 200 205

Ala Asn Gly Glu Leu Ser Leu Gln Asp Ala Arg Arg Ala Gly Cys Lys

210 215 220

Ala Cys Ala Ser Ser Gly Gly Gly Cys Gln Phe Leu Gly Thr Ala Gly

225 230 235 240

Thr Ser Gln Val Val Ala Glu Gly Leu Gly Leu Ala Ile Pro His Ser

245 250 255

Ala Leu Ala Pro Ser Gly Glu Pro Val Trp Arg Glu Ile Ala Arg Ala

260 265 270

Ser Ala Arg Ala Ala Leu Asn Leu Ser Gln Lys Gly Ile Thr Thr Arg

275 280 285

Glu Ile Leu Thr Asp Lys Ala Ile Glu Asn Ala Met Thr Val His Ala

290 295 300

Ala Phe Gly Gly Ser Thr Asn Leu Leu Leu His Ile Pro Ala Ile Ala

305 310 315 320

His Gln Thr Gly Cys His Ile Pro Thr Val Asp Asp Trp Ile Arg Ile

325 330 335

Asn Lys Arg Val Pro Arg Leu Val Ser Val Leu Pro Asn Gly Pro Val

340 345 350

Tyr His Pro Thr Val Asn Ala Phe Met Ala Gly Gly Val Pro Glu Val

355 360 365

Met Leu His Leu Arg Ser Leu Gly Leu Leu His Glu Asp Val Met Thr

370 375 380

Val Thr Gly Ser Thr Leu Lys Glu Asn Leu Asp Trp Trp Glu His Ser

385 390 395 400

Glu Arg Arg Gln Arg Phe Lys Gln Leu Leu Leu Asp Gln Glu Gln Ile

405 410 415

Asn Ala Asp Glu Val Ile Met Ser Pro Gln Gln Ala Lys Ala Arg Gly

420 425 430

Leu Thr Ser Thr Ile Thr Phe Pro Val Gly Asn Ile Ala Pro Glu Gly

435 440 445

Ser Val Ile Lys Ser Thr Ala Ile Asp Pro Ser Met Ile Asp Glu Gln

450 455 460

Gly Ile Tyr Tyr His Lys Gly Val Ala Lys Val Tyr Leu Ser Glu Lys

465 470 475 480

Ser Ala Ile Tyr Asp Ile Lys His Asp Lys Ile Lys Ala Gly Asp Ile

485 490 495

Leu Val Ile Ile Gly Val Gly Pro Ser Gly Thr Gly Met Glu Glu Thr

500 505 510

Tyr Gln Val Thr Ser Ala Leu Lys His Leu Ser Tyr Gly Lys His Val

515 520 525

Ser Leu Ile Thr Asp Ala Arg Phe Ser Gly Val Ser Thr Gly Ala Cys

530 535 540

Ile Gly His Val Gly Pro Glu Ala Leu Ala Gly Gly Pro Ile Gly Lys

545 550 555 560

Leu Arg Thr Gly Asp Leu Ile Glu Ile Lys Ile Asp Cys Arg Glu Leu

565 570 575

His Gly Glu Val Asn Phe Leu Gly Thr Arg Ser Asp Glu Gln Leu Pro

580 585 590

Ser Gln Glu Glu Ala Thr Ala Ile Leu Asn Ala Arg Pro Ser His Gln

595 600 605

Asp Leu Leu Pro Asp Pro Glu Leu Pro Asp Asp Thr Arg Leu Trp Ala

610 615 620

Met Leu Gln Ala Val Ser Gly Gly Thr Trp Thr Gly Cys Ile Tyr Asp

625 630 635 640

Val Asn Lys Ile Gly Ala Ala Leu Arg Asp Phe Met Asn Lys Asn

645 650 655

<210> 3

<211> 655

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Ser Val Arg Asn Ile Phe Ala Asp Glu Ser His Asp Ile Tyr Thr

1 5 10 15

Val Arg Thr His Ala Asp Gly Pro Asp Gly Glu Leu Pro Leu Thr Ala

20 25 30

Glu Met Leu Ile Asn Arg Pro Ser Gly Asp Leu Phe Gly Met Thr Met

35 40 45

Asn Ala Gly Met Gly Trp Ser Pro Asp Glu Leu Asp Arg Asp Gly Ile

50 55 60

Leu Leu Leu Ser Thr Leu Gly Gly Leu Arg Gly Ala Asp Gly Lys Pro

65 70 75 80

Val Ala Leu Ala Leu His Gln Gly His Tyr Glu Leu Asp Ile Gln Met

85 90 95

Lys Ala Ala Ala Glu Val Ile Lys Ala Asn His Ala Leu Pro Tyr Ala

100 105 110

Val Tyr Val Ser Asp Pro Cys Asp Gly Arg Thr Gln Gly Thr Thr Gly

115 120 125

Met Phe Asp Ser Leu Pro Tyr Arg Asn Asp Ala Ser Met Val Met Arg

130 135 140

Arg Leu Ile Arg Ser Leu Pro Asp Ala Lys Ala Val Ile Gly Val Ala

145 150 155 160

Ser Cys Asp Lys Gly Leu Pro Ala Thr Met Met Ala Leu Ala Ala Gln

165 170 175

His Asn Ile Ala Thr Val Leu Val Pro Gly Gly Ala Thr Leu Pro Ala

180 185 190

Lys Asp Gly Glu Asp Asn Gly Lys Val Gln Thr Ile Gly Ala Arg Phe

195 200 205

Ala Asn Gly Glu Leu Ser Leu Gln Asp Ala Arg Arg Ala Gly Cys Lys

210 215 220

Ala Cys Ala Ser Ser Gly Gly Gly Cys Gln Phe Leu Gly Thr Ala Gly

225 230 235 240

Thr Ser Gln Val Val Ala Glu Gly Leu Gly Leu Ala Ile Pro His Ser

245 250 255

Ala Leu Ala Pro Ser Gly Glu Pro Val Trp Arg Glu Ile Ala Arg Ala

260 265 270

Ser Ala Arg Ala Ala Leu Asn Leu Ser Gln Lys Gly Ile Thr Thr Arg

275 280 285

Glu Ile Leu Thr Asp Lys Ala Ile Glu Asn Ala Met Thr Val His Ala

290 295 300

Ala Phe Gly Gly Ser Thr Asn Leu Leu Leu His Ile Pro Ala Ile Ala

305 310 315 320

His Gln Thr Gly Cys His Ile Pro Thr Val Asp Asp Trp Ile Arg Ile

325 330 335

Asn Lys Arg Val Pro Arg Leu Val Ser Val Leu Pro Asn Gly Pro Val

340 345 350

Tyr His Pro Thr Val Asn Ala Phe Met Ala Gly Gly Val Pro Glu Val

355 360 365

Met Leu His Leu Arg Ser Leu Gly Leu Leu His Glu Asp Val Met Thr

370 375 380

Val Thr Gly Ser Thr Leu Lys Glu Asn Leu Asp Trp Trp Glu His Ser

385 390 395 400

Glu Arg Arg Gln Arg Phe Lys Gln Leu Leu Leu Asp Gln Glu Gln Ile

405 410 415

Asn Ala Asp Glu Val Ile Met Ser Pro Gln Gln Ala Lys Ala Arg Gly

420 425 430

Leu Thr Ser Thr Ile Thr Phe Pro Val Gly Asn Ile Ala Pro Glu Gly

435 440 445

Ser Val Ile Lys Ser Thr Ala Ile Asp Pro Ser Met Ile Asp Glu Gln

450 455 460

Gly Ile Tyr Tyr His Lys Gly Val Ala Lys Val Tyr Leu Ser Glu Lys

465 470 475 480

Ser Ala Ile Tyr Asp Ile Lys His Asp Lys Ile Lys Ala Gly Asp Ile

485 490 495

Leu Val Ile Ile Gly Val Gly Pro Ser Gly Thr Gly Met Glu Glu Thr

500 505 510

Tyr Gln Val Thr Ser Ala Leu Lys His Leu Ser Tyr Gly Lys His Val

515 520 525

Ser Leu Ile Thr Asp Ala Arg Phe Ser Gly Val Ser Thr Gly Ala Cys

530 535 540

Ile Gly His Val Gly Pro Glu Ala Leu Ala Gly Gly Pro Ile Gly Lys

545 550 555 560

Leu Arg Thr Gly Asp Leu Ile Glu Ile Lys Ile Asp Cys Arg Glu Leu

565 570 575

His Gly Glu Val Asn Phe Leu Gly Thr Arg Ser Asp Glu Gln Leu Pro

580 585 590

Ser Gln Glu Glu Ala Thr Ala Ile Leu Asn Ala Arg Pro Ser His Gln

595 600 605

Asp Leu Leu Pro Asp Pro Glu Leu Pro Asp Asp Thr Arg Leu Trp Ala

610 615 620

Met Leu Gln Ala Val Ser Gly Gly Thr Trp Thr Gly Cys Ile Tyr Asp

625 630 635 640

Val Asn Lys Ile Gly Ala Ala Leu Arg Asp Phe Met Asn Lys Asn

645 650 655

<210> 4

<211> 655

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Ser Val Arg Asn Ile Phe Ala Asp Glu Ser His Asp Ile Tyr Thr

1 5 10 15

Val Arg Thr His Ala Asp Gly Pro Asp Gly Glu Leu Pro Leu Thr Ala

20 25 30

Glu Met Leu Ile Asn Arg Pro Ser Gly Asp Leu Phe Gly Met Thr Met

35 40 45

Asn Ala Gly Met Gly Trp Pro Pro Asp Glu Leu Asp Arg Asp Gly Ile

50 55 60

Leu Leu Leu Asn Thr Leu Gly Gly Leu Arg Gly Ala Asp Gly Lys Pro

65 70 75 80

Val Ala Leu Ala Leu His Gln Gly His Tyr Glu Leu Asp Ile Gln Met

85 90 95

Lys Ala Ala Ala Glu Val Ile Lys Ala Asn His Ala Leu Pro Tyr Ala

100 105 110

Val Tyr Val Ser Asp Pro Cys Asp Gly Arg Thr Gln Gly Thr Thr Gly

115 120 125

Met Phe Asp Ser Leu Pro Tyr Arg Asn Asp Ala Ser Met Val Met Arg

130 135 140

Arg Leu Ile Arg Ser Leu Pro Asp Ala Lys Ala Val Ile Gly Val Ala

145 150 155 160

Ser Cys Asp Lys Gly Leu Pro Ala Thr Met Met Ala Leu Ala Ala Gln

165 170 175

His Asn Ile Ala Thr Val Leu Val Pro Gly Gly Ala Thr Leu Pro Ala

180 185 190

Lys Asp Gly Glu Asp Asn Gly Lys Val Gln Thr Ile Gly Ala Arg Phe

195 200 205

Ala Asn Gly Glu Leu Ser Leu Gln Asp Ala Arg Arg Ala Gly Cys Lys

210 215 220

Ala Cys Ala Ser Ser Gly Gly Gly Cys Gln Phe Leu Gly Thr Ala Gly

225 230 235 240

Thr Ser Gln Val Val Ala Glu Gly Leu Gly Leu Ala Ile Pro His Ser

245 250 255

Ala Leu Ala Pro Ser Gly Glu Pro Val Trp Arg Glu Ile Ala Arg Ala

260 265 270

Ser Ala Arg Ala Ala Leu Asn Leu Ser Gln Lys Gly Ile Thr Thr Arg

275 280 285

Glu Ile Leu Thr Asp Lys Ala Ile Glu Asn Ala Met Thr Val His Ala

290 295 300

Ala Phe Gly Gly Ser Thr Asn Leu Leu Leu His Ile Pro Ala Ile Ala

305 310 315 320

His Gln Thr Gly Cys His Ile Pro Thr Val Asp Asp Trp Ile Arg Ile

325 330 335

Asn Lys Arg Val Pro Arg Leu Val Ser Val Leu Pro Asn Gly Pro Val

340 345 350

Tyr His Pro Thr Val Asn Ala Phe Met Ala Gly Gly Val Pro Glu Val

355 360 365

Met Leu His Leu Arg Ser Leu Gly Leu Leu His Glu Asp Val Met Thr

370 375 380

Val Thr Gly Ser Thr Leu Lys Glu Asn Leu Asp Trp Trp Glu His Ser

385 390 395 400

Glu Arg Arg Gln Arg Phe Lys Gln Leu Leu Leu Asp Gln Glu Gln Ile

405 410 415

Asn Ala Asp Glu Val Ile Met Ser Pro Gln Gln Ala Lys Ala Arg Gly

420 425 430

Leu Thr Ser Thr Ile Thr Phe Pro Val Gly Asn Ile Ala Pro Glu Gly

435 440 445

Ser Val Ile Lys Ser Thr Ala Ile Asp Pro Ser Met Ile Asp Glu Gln

450 455 460

Gly Ile Tyr Tyr His Lys Gly Val Ala Lys Val Tyr Leu Ser Glu Lys

465 470 475 480

Ser Ala Ile Tyr Asp Ile Lys His Asp Lys Ile Lys Ala Gly Asp Ile

485 490 495

Leu Val Ile Ile Gly Val Gly Pro Ser Gly Thr Gly Met Glu Glu Thr

500 505 510

Tyr Gln Val Thr Ser Ala Leu Lys His Leu Ser Tyr Gly Lys His Val

515 520 525

Ser Leu Ile Thr Asp Ala Arg Phe Ser Gly Val Ser Thr Gly Ala Cys

530 535 540

Ile Gly His Val Gly Pro Glu Ala Leu Ala Gly Gly Pro Ile Gly Lys

545 550 555 560

Leu Arg Thr Gly Asp Leu Ile Glu Ile Lys Ile Asp Cys Arg Glu Leu

565 570 575

His Gly Glu Val Asn Phe Leu Gly Thr Arg Ser Asp Glu Gln Leu Pro

580 585 590

Ser Gln Glu Glu Ala Thr Ala Ile Leu Asn Ala Arg Pro Ser His Gln

595 600 605

Asp Leu Leu Pro Asp Pro Glu Leu Pro Asp Asp Thr Arg Leu Trp Ala

610 615 620

Met Leu Gln Ala Val Ser Gly Gly Thr Trp Thr Gly Cys Ile Tyr Asp

625 630 635 640

Val Asn Lys Ile Gly Ala Ala Leu Arg Asp Phe Met Asn Lys Asn

645 650 655

<210> 5

<211> 744

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgtcttctg ctatctaccc gtctctgaaa ggtaaacgtg ttgttatcac cggtggtggt 60

tctggtatcg gtgctggtct gaccgctggt ttcgctcgtc agggtgctga agttatcttc 120

ctggacatcg ctgacgaaga ctctcgtgct ctggaagctg aactggctgg ttctccgatc 180

ccgccggttt acaaacgttg cgacctgatg aacctggaag ctatcaaagc tgttttcgct 240

gaaatcggtg acgttgacgt tctggttaac aacgctggta acgacgaccg tcacaaactg 300

gctgacgtta ccggtgctta ctgggacgaa cgtatcaacg ttaacctgcg tcacatgctg 360

ttctgcaccc aggctgttgc tccgggtatg aaaaaacgtg gtggtggtgc tgttatcaac 420

ttcggttcta tctcttggca cctgggtctg gaagacctgg ttctgtacga aaccgctaaa 480

gctggtatcg aaggtatgac ccgtgctctg gctcgtgaac tgggtccgga cgacatccgt 540

gttacctgcg ttgttccggg taacgttaaa accaaacgtc aggaaaaatg gtacaccccg 600

gaaggtgaag ctcagatcgt tgctgctcag tgcctgaaag gtcgtatcgt tccggaaaac 660

gttgctgctc tggttctgtt cctggcttct gacgacgctt ctctgtgcac cggtcacgaa 720

tactggatcg acgctggttg gcgt 744

<210> 6

<211> 1644

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgtatacag taggagatta cctgttagac cgattacacg agttgggaat tgaagaaatt 60

tttggagttc ctggtgacta taacttacaa tttttagatc aaattatttc acgcgaagat 120

atgaaatgga ttggaaatgc taatgaatta aatgcttctt atatggctga tggttatgct 180

cgtactaaaa aagctgccgc atttctcacc acatttggag tcggcgaatt gagtgcgatc 240

aatggactgg caggaagtta tgccgaaaat ttaccagtag tagaaattgt tggttcacca 300

acttcaaaag tacaaaatga cggaaaattt gtccatcata cactagcaga tggtgatttt 360

aaacacttta tgaagatgca tgaacctgtt acagcagcgc ggactttact gacagcagaa 420

aatgccacat atgaaattga ccgagtactt tctcaattac taaaagaaag aaaaccagtc 480

tatattaact taccagtcga tgttgctgca gcaaaagcag agaagcctgc attatcttta 540

gaaaaagaaa gctctacaac aaatacaact gaacaagtga ttttgagtaa gattgaagaa 600

agtttgaaaa atgcccaaaa accagtagtg attgcaggac acgaagtaat tagttttggt 660

ttagaaaaaa cggtaactca gtttgtttca gaaacaaaac taccgattac gacactaaat 720

tttggtaaaa gtgctgttga tgaatctttg ccctcatttt taggaatata taacgggaaa 780

ctttcagaaa tcagtcttaa aaattttgtg gagtccgcag actttatcct aatgcttgga 840

gtgaagctta cggaccgctc aacaggtgca ttcacacatc atttagatga aaataaaatg 900

atttcactaa acatagatga aggaataatt ttcaataaag tggtagaaga ttttgatttt 960

agagcagtgg tttcttcttt atcagaatta aaaggaatag aatatgaagg acaatatatt 1020

gataagcaat atgaagaatt tattccatca agtgctccct tatcacaaga ccgtctatgg 1080

caggcagttg aaagtttgac tcaaagcaat gaaacaatcg ttgctgaaca aggaacctca 1140

ttttttggag cttcaacaat tttcttaaaa tcaaatagtc gttttattgg acaaccttta 1200

tggggttcta ttggatatac ttttccagcg gctttaggaa gccaaattgc ggataaagag 1260

agcagacacc ttttatttat tggtgatggt tcacttcaac ttaccgtaca agaattagga 1320

ctatcaatca gagaaaaact caatccaatt tgttttatca taaataatga tggttataca 1380

gttgaaagag aaatccacgg acctactcaa agttataacg acattccaat gtggaattac 1440

tcgaaattac cagaaacatt tggagcaaca gaagatcgtg tagtatcaaa aattgttaga 1500

acagagaatg aatttgtgtc tgtcatgaaa gaagcccaag cagatgtcaa tagaatgtat 1560

tggatagaac tagttttgga aaaagaagat gcgccaaaat tactgaaaaa aatgggtaaa 1620

ttatttgctg agcaaaataa ataa 1644

<210> 7

<211> 1011

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgaaggctg cagttgttac gaaggatcat catgttgacg ttacgtataa aacactgcgc 60

tcactgaaac atggcgaagc cctgctgaaa atggagtgtt gtggtgtatg tcataccgat 120

cttcatgtta agaatggcga ttttggtgac aaaaccggcg taattctggg ccatgaaggc 180

atcggtgtgg tggcagaagt gggtccaggt gtcacctcat taaaaccagg cgatcgtgcc 240

agcgtggcgt ggttctacga aggatgcggt cattgcgaat actgtaacag tggtaacgaa 300

acgctctgcc gttcagttaa aaatgccgga tacagcgttg atggcgggat ggcggaagag 360

tgcatcgtgg tcgccgatta cgcggtaaaa gtgccagatg gtctggactc ggcggcggcc 420

agcagcatta cctgtgcggg agtcaccacc tacaaagccg ttaagctgtc aaaaattcgt 480

ccagggcagt ggattgctat ctacggtctt ggcggtctgg gtaacctcgc cctgcaatac 540

gcgaagaatg tctttaacgc caaagtgatc gccattgatg tcaatgatga gcagttaaaa 600

ctggcaaccg aaatgggcgc agatttagcg attaactcac acaccgaaga cgccgccaaa 660

attgtgcagg agaaaactgg tggcgctcac gctgcggtgg taacagcggt agctaaagct 720

gcgtttaact cggcagttga tgctgtccgt gcaggcggtc gtgttgtggc tgtcggtcta 780

ccgccggagt ctatgagcct ggatatccca cgtcttgtgc tggatggtat tgaagtggtc 840

ggttcgctgg tcggcacgcg ccaggattta actgaagcct tccagtttgc cgccgaaggt 900

aaagtggtgc cgaaagtcgc cctgcgtccg ttagcggaca tcaacaccat ctttactgag 960

atggaagaag gcaaaatccg tggccgcatg gtgattgatt tccgtcacta a 1011

Claims

A D-xylonate dehydratase having the amino acid sequence set forth in SEQ ID No.: 1 to 4.
2. A gene encoding D-xylonic acid dehydratase according to claim 1.
3. A recombinant plasmid comprising the gene of claim 2.
4. A recombinant cell comprising the gene of claim 2.
5. Use of a D-xylonic acid dehydratase according to claim 1 for the preparation of a polyol.
6. Use according to claim 5, wherein the polyol is 1,2, 4-butanetriol.
7. A genetically engineered bacterium producing 1,2, 4-butanetriol, wherein the gene encoding D-xylonate dehydratase of claim 2 is introduced into Escherichia coli.
8. The genetically engineered bacterium of claim 7, wherein D-xylose dehydrogenase gene, benzoylformate decarboxylase gene, and alcohol dehydrogenase gene are introduced into E.coli.
9. The method for constructing a genetically engineered bacterium that produces 1,2, 4-butanetriol according to claim 7,

(1) respectively cloning a D-xylonic acid dehydratase gene, a D-xylose dehydrogenase gene, a benzoyl formate decarboxylase gene and an alcohol dehydrogenase gene into expression plasmids, wherein the expression plasmids comprise pCWJ to obtain recombinant plasmids,

(2) and transforming the recombinant vector into a host bacterium, wherein the host bacterium is large intestine Trans 1T1 to obtain the genetic engineering bacterium for producing the 1,2, 4-butanetriol.
10. Use of the genetically engineered bacterium of any one of claims 7 and 8 producing 1,2, 4-butanetriol in the preparation of 1,2, 4-butanetriol.