CN110283797B

CN110283797B - Tyrosinase, gene, engineering bacterium and preparation method thereof

Info

Publication number: CN110283797B
Application number: CN201910537732.7A
Authority: CN
Inventors: 刘逸寒; 王洪彬; 路福平; 徐泽华; 李玉
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2019-06-20
Filing date: 2019-06-20
Publication date: 2021-08-27
Anticipated expiration: 2039-06-20
Also published as: CN110283797A

Abstract

The invention belongs to the technical field of enzyme genetic engineering, and relates to novel tyrosinase derived from Bacillus asythus, a gene, an engineering bacterium and a preparation method thereof. Meanwhile, the novel bacterial tyrosinase has better effects in the industries of protein crosslinking, phenolic compound detection and the like.

Description

Tyrosinase, gene, engineering bacterium and preparation method thereof

The technical field is as follows:

the invention relates to a novel tyrosinase derived from Bacillus asbodoides, a gene, an engineering bacterium and a preparation method thereof, in particular to a recombinant expression strain for expressing the novel tyrosinase obtained by a genetic engineering technology and a molecular biological means, and application of the tyrosinase protein of the bacterium in the aspects of food, medicine, environment and the like, belonging to the technical field of genetic engineering of enzyme.

Background art:

tyrosinase (EC 1.14.18.1), also called polyphenol oxidase, catechol oxidase, etc., is a copper-containing metalloenzyme containing subunits with a complex structure, has two functions of monooxygenase and oxidase, and is widely present in microorganisms, animals, plants and human bodies. Tyrosinase is generally called polyphenol oxidase in plants, phenol oxidase in insects, and tyrosinase in microorganisms and humans. Tyrosinase catalyzes tyrosine to be oxidized into dopa, dopa is oxidized into dopaquinone to react, and the activity of melanocytes is controlled, so that the tyrosinase is a key enzyme for melanin synthesis. Claus et al further found that the copper ion binding sites of many eukaryotic and prokaryotic tyrosinases were highly conserved by comparison of the amino acid composition of tyrosinase. The tyrosinase catalyzed reaction has activities of monophenolase and bisphenolase, can catalyze and oxidize monophenol and bisphenol into benzoquinone, and both reactions need oxygen molecules to participate. Tyrosinase is a copper-containing metalloenzyme, the active center of which contains two copper ion binding sites, and during the catalysis process, because the number of oxygen atoms bound by copper ions is different, tyrosinase can be divided into three forms: oxidation state (E)_oxy) Reduced state (E)_met) And a deoxy state (E)_deoxy). The existence and interconversion of these three enzyme morphologies is the basis for the unique dual catalysis of tyrosinase. In the monophenolase cycle, E_oxyReacting with monophenol to give benzoquinone and E_deoxyThe latter with O₂Combining and finally regenerating E_oxy. In the bisphenolase cycle, E_oxyWith bisphenols to form benzoquinones and E_metThe latter converts another bisphenol to benzoquinone, which itself is converted to E_deoxyForm (b) bisphenol E_deoxyEssential factors for formation. Tyrosinase monophenolase activity exhibits a specific time lag until E_oxySufficient bisphenol is provided. The time lag is affected by the enzyme source, the monophenol enzyme concentration and the like, the concentration is increased, the time lag is shortened but can not be completely eliminated, and the time lag can be completely eliminated by the bisphenol.

To date, the organisms from which tyrosinase has been successfully isolated are mainly fungi (including molds, agarics, yeasts, etc.), bacteria, gymnosperms, angiosperms, insects, chordons, mammals, etc. Although tyrosinase has similar physiological functions in different organisms, its physicochemical properties are different to different degrees. The tyrosinase from different sources has different molecular characteristics, the protein molecular weight and the isoelectric point of the tyrosinase from different sources are widely changed, and the isoelectric point of the tyrosinase from different sources is distributed in the range of pH3.3 to pH9.35. In fungi, tyrosinase functions mainly in relation to sporulation, tissue regeneration, pathogenicity and increased adaptability in extreme environments. Tyrosinase of fungal origin has no signal peptide. Tyrosinase of mushroom origin is the only tyrosinase found so far containing two different subunits, H-type and L-type. Selinheimo et al investigated the efficient cross-linking of tyrosinase from Trichoderma with R-casein, but the efficiency of cross-linking was not high.

Unlike tyrosinase derived from eukaryotes, bacterial tyrosinase has not only a wide range of isoelectric points, but also low homology in primary structure. The synthesis of melanin by the Raper-Mason pathway is a process catalyzed by tyrosinase, but the difference of the bacterial tyrosinase structure determines that the action mechanism is different from that of fungal tyrosinase. By aligning the NCBI database, it was found that the conserved regions of tyrosinase of bacterial origin are few and that the composition and number of amino acids vary widely. In particular, during growth, bacillus produces a series of beneficial metabolites that stimulate and promote the growth of the host. In 2006, the Matoba research group obtained the crystal structure of tyrosinase for the first time from Streptomyces antibioticus. In 2011, Sendovski and other isolates identified the three-dimensional structure of tyrosinase derived from Bacillus megaterium. In the same year, a Matoba research group analyzes the three-dimensional structure of tyrosinase in streptomyces and has guiding significance for researching tyrosinase derived from bacteria. Compared with eukaryotes, the tyrosinase derived from bacteria has richer diversity, so the research on the tyrosinase derived from bacteria has very important significance for the expansion of the application field of the tyrosinase.

The catalytic oxidation reaction of tyrosinase can be widely used for protein crosslinking. Da YouXu adopts a practical and economic crosslinking method, also called a carrier-free immobilization method, to obtain a crosslinking tyrosinase aggregate as a catalyst, so as to effectively treat phenolic compounds in sewage. At present, tyrosinase has been applied to biological inhibitors, organic synthesis, binding immobilization, and the like, and in addition, tyrosinase has its related applications in the aspects of biosensors, biological detection, and the like.

Bacillus subtilis belongs to gram-positive bacteria. The bacillus subtilis expression system has the following advantages: 1. can efficiently secrete various proteins; 2. many Bacillus subtilis have a long history of use in the fermentation industry, are nonpathogenic, and do not produce any endotoxin; 3. the research on the microbial genetics background of the bacillus genus is very clear, the bacillus genus grows rapidly, and no special requirements on nutrient substances exist; 4. codon preference is not obvious; 5. the fermentation process is simple, the bacillus subtilis belongs to aerobic bacteria, anaerobic fermentation equipment is not needed, and after the fermentation is finished, fermentation liquor and bacterial thalli are simply separated, so that the separation, purification and recovery stages of target protein can be carried out; 6. has stress resistance, and can be used for producing various thermostable enzyme preparations. The bacillus subtilis expression system becomes the most important tool and model for modern molecular biology research, and is an ideal tool for expressing exogenous genes.

Bacillus licheniformis is a gram-positive, putrescent microorganism. The bacillus licheniformis expression system has the following advantages: 1. the enzyme system is rich, various proteins can be efficiently secreted, and the enzyme yield is higher; 2. the bacillus licheniformis has a unique biological oxygen-deprivation action mechanism and can inhibit the growth and the propagation of pathogenic bacteria; 3. it may exist in the form of spores, thus resisting the harsh environment; under a good environment, the growth state can exist; 4. the bacillus licheniformis has better heat resistance; 5. the bacillus licheniformis has a perfect protein secretion system, and the protein synthesis and secretion capacity can reach 20-25 mg/ml; 6. the live bacteria component of the bacillus licheniformis is a spore dormant body and has the characteristics of acid resistance, high temperature resistance, drying resistance and the like; 7. the genetic background research is clear, and the high-level expression of the target protein can be realized through a gene expression regulation mechanism.

Bacillus amyloliquefaciens is a gram-positive bacterium. The bacillus amyloliquefaciens expression system has the following advantages: 1. the secondary metabolite is rich, and can generate various antibacterial substances such as antibacterial protein, lipopeptide, polyketide and the like; 2. the protein produced by the bacillus amyloliquefaciens has good hydrophilicity, stability and high activity; 3. the bacillus amyloliquefaciens can produce various physiologically active substances and amino acid substances; 4. in the bacillus amyloliquefaciens, the number of genes related to the synthesis of proteins and enzyme antibacterial substances is small, and the gene recombination and expression are facilitated; 5. the bacillus amyloliquefaciens has a wide antibacterial spectrum, has the advantages of no pollution, no drug resistance, contribution to human body safety and the like, and has a good development prospect.

The novel tyrosinase coding gene is derived from Bacillus asborkii, belongs to bacteria, clones the novel tyrosinase coding gene in the Bacillus asborkii genome, expresses the novel tyrosinase gene in a Bacillus subtilis expression system, a Bacillus amyloliquefaciens expression system and a Bacillus licheniformis expression system to respectively obtain high-stability tyrosinase free expression recombinant strains of the Bacillus subtilis, the Bacillus licheniformis and the Bacillus amyloliquefaciens, and can obtain the high-stability tyrosinase through corresponding treatment after the recombinant strains are fermented.

The invention content is as follows:

the invention aims to overcome and avoid the defects of the prior industrial production of tyrosinase, and provides novel bacterial tyrosinase derived from Bacillus asborkii and an engineering strain for expressing the novel bacterial tyrosinase gene.

The technical route for realizing the purpose of the invention is as follows: the genome of the Bacillus aryabhattai is used as a template, and the conserved sequence of the tyrosinase mature peptide gene of the Bacillus aryabhattai is analyzed according to the reported tyrosinase mature peptide gene of the Bacillus aryabhattai, so that amplification primers P1 and P2 of the tyrosinase mature peptide gene are designed, wherein an upstream primer P1 and a downstream primer P2 are used for amplifying a target gene expressed in the Bacillus subtilis, the Bacillus licheniformis and the Bacillus amyloliquefaciens, and restriction enzyme cleavage sites EcoR I and Not I are respectively introduced into the upstream primer and the downstream primer. The tyrosinase gene Tyr of the Bacillus asborensis is obtained by PCR cloning, and after the tyrosinase gene Tyr is connected with a pBSA43 vector, a recombinant plasmid pBSA43-Tyr is constructed; escherichia coli JM109 was transformed to obtain a recombinant strain JM109/pBSA 43-Tyr. And successfully expressing the correctly verified recombinant plasmid pBSA43-Tyr in bacillus subtilis, bacillus licheniformis and bacillus amyloliquefaciens respectively to obtain a recombinant strain for producing the high-stability novel tyrosinase, and further optimizing by a fermentation process to obtain the high-yield high-stability novel tyrosinase.

In order to achieve the above purpose, one of the technical solutions provided by the present invention is: a novel bacterial tyrosinase, said tyrosinase is derived from a Bacillus asjohnsonii that has been screened by the inventor, its amino acid sequence is shown in SEQ ID No.2 in the sequence table;

when the tyrosinase is used for measuring the enzymatic properties of the novel tyrosinase by taking L-tyrosine as a substrate, the optimal action temperature is 60 ℃, and the optimal action pH is 5.0;

meanwhile, the pH stability and the thermal stability of the novel tyrosinase are measured by taking L-tyrosine as a substrate, and the result shows that: the residual enzyme activity is more than 60 percent after heat preservation is carried out for 168 hours at the temperature of 4 ℃ within the range of 3-10; keeping the temperature below 35 ℃ for 2h under the condition that the pH value is 7, and keeping the residual enzyme activity to be more than 60%;

the encoding gene of the tyrosinase is Tyr, and the base sequence is shown as SEQ ID No.1 in the sequence table.

In order to achieve the above purpose, the second technical solution provided by the present invention is: reconstructing a recombinant vector from the gene, efficiently expressing the recombinant vector in bacillus subtilis, bacillus licheniformis and bacillus amyloliquefaciens to obtain a recombinant strain for producing the novel tyrosinase with high stability, and further optimizing through a fermentation process to obtain the novel tyrosinase with high yield and high stability;

the host cells for expressing the novel bacterial tyrosinase are respectively bacillus subtilis, bacillus licheniformis and bacillus amyloliquefaciens, and the expression vector is pBSA 43.

The experimental procedure of the present invention is summarized as follows:

1. a novel tyrosinase gene from Bacillus aryabhattai constructs a recombinant strain (Bacillus subtilis WB600/pBSA43-Tyr, Bacillus licheniformis TCCC11965/pBSA43-Tyr and Bacillus amyloliquefaciens CGMCC11218/pBSA 43-Tyr) for expressing the novel tyrosinase, and the preparation process of the novel bacterial tyrosinase comprises the following steps:

(1) obtaining a strain capable of producing tyrosinase, namely bacillus asjohnsonii, by high-throughput strain screening;

(2) taking the genome of the Bacillus aryabhattai as a template, analyzing the conserved sequence of the gene according to the reported tyrosinase mature peptide gene of the Bacillus aryabhattai, designing amplification primers P1 and P2 of the tyrosinase mature peptide gene, obtaining the tyrosinase gene Tyr of the Bacillus aryabhattai through PCR cloning, connecting the tyrosinase gene Tyr with an escherichia coli-bacillus shuttle plasmid pBSA43, constructing a recombinant plasmid pBSA43-Tyr, transforming escherichia coli JM109, and obtaining a recombinant strain JM109/pBSA 43-Tyr;

(3) transforming the recombinant plasmid pBSA43-Tyr into bacillus subtilis WB600, bacillus licheniformis TCCC11965 and bacillus amyloliquefaciens CGMCC No.11218 to construct recombinant strains WB600/pBSA43-Tyr, TCCC11965/pBSA43-Tyr and CGMCC11218/pBSA 43-Tyr;

(4) fermenting the recombinant strain to prepare novel high-stability bacterial tyrosinase;

(5) preparing novel tyrosinase with high stability.

Has the advantages that:

1. the invention obtains a bacterial strain capable of producing tyrosinase, namely Bacillus asborkii, by screening specific high-throughput strains capable of producing tyrosinase, obtains a tyrosinase gene of the bacterial strain by PCR amplification, and sequences the tyrosinase gene into a new base sequence.

2. The novel recombinant tyrosinase prepared by fermenting the novel tyrosinase recombinant strain expressed by the bacillus subtilis and the novel tyrosinase recombinant strain expressed by the bacillus licheniformis and the bacillus amyloliquefaciens in a free mode has the following advantages of enzymological properties: when L-tyrosine is used as a substrate to determine the enzymatic properties of the novel tyrosinase, the optimal action temperature is 60 ℃, and the optimal action pH is 5.0; meanwhile, the novel bacterial tyrosinase has stable activity at the temperature below 35 ℃ and within the pH range of 3-10.

3. The novel bacterial recombinant tyrosinase has a good effect on protein crosslinking. Therefore, the recombinant tyrosinase has great application potential in practical application.

Description of the drawings:

FIG. 1 is a PCR amplification electrophoresis chart of the novel tyrosinase mature peptide gene of the present invention;

wherein: m is DNA Marker, 1 and 2 are tyrosinase mature peptide gene Tyr respectively;

FIG. 2 is a double restriction enzyme digestion verification diagram of recombinant plasmid pBSA43-Tyr of the present invention;

wherein: m is DNA Marker, 1 is recombinant plasmid pBSA43-Tyr through EcoR I and Not I double enzyme cutting picture;

FIG. 3 is an electrophoretogram of the genome of Bacillus aryabhattai of the present invention;

wherein: m is DNA Marker, 1 is Bacillus aryabhattai genome electrophoretogram;

FIG. 4 optimal action temperature curves;

FIG. 5 optimal pH curves.

The specific implementation mode is as follows:

the technical content of the present invention will be further described with reference to examples, but the present invention is not limited to these examples, and the scope of the present invention is not limited by the following examples.

The bacillus licheniformis used in the invention is TCCC11965, which is disclosed in the following parts: development and application of a CRISPR/Cas9system for Bacillus licheniformis microorganisms [ J ]. International Journal of Biological Macromolecules,2019,122:329-337, currently maintained at the institute of microbial culture Collection, university of Tianjin, from which the public can obtain the species.

Example 1: acquisition of novel tyrosinase mature peptide gene of Bacillus aryabhattai

1. The novel tyrosinase mature peptide gene is derived from Bacillus aryabhattai screened in the laboratory, and the genome DNA of the Bacillus aryabhattai is extracted, wherein the extraction steps of the Bacillus aryabhattai genome DNA are as follows:

(1) inoculating and streaking the strain in an LB solid plate from a glycerol tube, and standing and culturing for 12h at 37 ℃;

(2) selecting a single colony from a plate for culturing the thalli, inoculating the single colony in a liquid LB culture medium containing 5mL, and culturing for 12h at the temperature of 37 ℃ at 220 r/min;

(3) subpackaging the bacterial liquid into a sterilized 1.5mL microcentrifuge tube, centrifuging at 12000r/min for 1min, collecting thalli, and discarding supernatant;

(4) resuspending the precipitate in 200 μ L of precooled solution I, repeatedly blowing and stirring with a gun head, mixing well, adding 50 μ L of 50mg/mL lysozyme, and carrying out water bath at 37 ℃ for 1 h;

(5) adding 20 μ L of 10% SDS and 10 μ L of proteinase K, and water-bathing at 65 deg.C for 2-3 h;

(6) adding 250 mu L of newly-prepared solution II, tightly covering the pipe orifice, and gently turning over a 1.5mL EP pipe up and down for 6-8 times to fully crack the thalli in the EP pipe;

(7) adding 350 mu L of precooled solution III, immediately and gently turning over a 1.5mL EP tube from top to bottom for 6-8 times, wherein white flocculent precipitates appear in the EP tube;

(8) centrifuging at 12000r/min for 10min, transferring the supernatant to another EP tube, adding equal volume of Tris saturated phenol/chloroform (1: 1) mixed solution, mixing well, centrifuging at 12000r/min for 10min, and transferring the supernatant to another EP tube;

(9) repeatedly extracting for 2 times, and then extracting for 1 time by using chloroform with the same volume to remove trace phenol;

(10) adding 2 times volume of anhydrous ethanol, mixing, and standing at-20 deg.C for 30 min. Centrifuging at 12000r/min for 10min, and collecting precipitate;

(11) washing the precipitate with 70% ethanol for 2-3 times, and discarding the residual liquid;

(12) air drying for 20-30min, sterilizing with 30 μ L ddH₂Dissolving and precipitating O;

2. through NCBI gene bank search, according to the reported bacillus asjohnsonii tyrosinase mature peptide gene, analyzing its conservative sequence, designing amplification primer of tyrosinase mature peptide coding gene of the invention as follows:

upstream primer P1(SEQ ID NO. 3):

5’—CCGGAATTCGATGAGTAACAAGTACAAAGTTAGAAAAAACG—3’

downstream primer P2(SEQ ID NO. 4):

5’—AAGGAAAAAAGCGGCCGCTGAGGACGTTTTGATTTTCTTAAT—3’

wherein, the upstream primer P1 and the downstream primer P2 are used for amplifying target genes expressed in bacillus subtilis, bacillus licheniformis and bacillus amyloliquefaciens, and the upstream primer and the downstream primer are respectively introduced with restriction enzyme cutting sites EcoR I and Not I.

The amplification template is Bacillus aryabhattai genome DNA, and the amplification reaction conditions are as follows:

10×Pyrobest BufferⅡ	5μL
		dNTP Mixture(2.5mM each)	5μL
upstream primer P1	2μL
		Downstream primer P2	2μL
DNA template	2μL
		Pyrobest DNA Polymerase(5U/μL)	0.5μL
ddH₂O	33.5μL
		Total volume	50μL

The amplification conditions were: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 45s, and extension at 72 ℃ for 1min for 30 cycles; extension at 72 ℃ for 10 min. The PCR amplification product is subjected to 0.8% agarose gel electrophoresis to obtain a band about 900bp (figure 1), a small amount of DNA gel recovery kit is used for recovering the PCR product, and double digestion and purification recovery are carried out to obtain the novel tyrosinase mature peptide coding gene Tyr of the bacillus asbodoides, which is shown in SEQ ID NO. 1. Can also be obtained by a whole-gene synthesis mode according to the sequence shown in SEQ ID NO. 1.

Example 2: construction of novel tyrosinase recombinant bacteria with high stability of bacillus subtilis, bacillus licheniformis and bacillus amyloliquefaciens

1. Construction of expression vector pBSA43

pBSA43 is obtained by using an escherichia coli-bacillus shuttle cloning vector pBE2 as a framework, cloning a strong bacillus constitutive promoter P43 and directly secreting recombinant protein into a levansucrase signal sequence sacB in a culture medium. It carries Amp^rGenes that can utilize ampicillin resistance as a selection marker in E.coli; also has Km^rThe gene can be used as a screening marker in bacillus subtilis, bacillus licheniformis and bacillus amyloliquefaciens by utilizing kanamycin resistance.

2. Construction of novel tyrosinase expression vector pBSA43-Tyr

The novel tyrosinase gene (Tyr) which is amplified by PCR and recovered by EcoR I and Not I double enzyme digestion is connected with a Bacillus subtilis expression vector pBSA43 which is subjected to the same double enzyme digestion by ligase, the connection product is transformed into escherichia coli JM109 competent cells, positive transformants are selected by Amp resistance screening, transformant plasmids are extracted, single and double enzyme digestion verification (figure 2) and sequencing are carried out, and the correct recombinant strain JM109/pBSA43-Tyr is determined to be constructed.

3. The recombinant expression vector pBSA43-Tyr is respectively transformed into bacillus subtilis, bacillus licheniformis and bacillus amyloliquefaciens

Adding 1 μ L (50ng/μ L) of pBSA43-Tyr recombinant plasmid into 50 μ L of Bacillus subtilis WB600, Bacillus licheniformis TCCC11965 and Bacillus amyloliquefaciens CGMCC NO.11218 competent cells respectively, mixing uniformly, transferring into a precooled electric rotating cup (1mm), and performing electric shock once (25 μ F, 200 Ω, 4.5-5.0ms) after ice bath for 1-1.5 min. After the shock was completed, 1mL of recovery medium (LB +0.5mol/L sorbitol +0.38mol/L mannitol) was added immediately. And after shaking culture for 3h at 37 ℃ in a shaking table, coating the resuscitate on an LB plate containing kanamycin, culturing for 12-24h at 37 ℃, selecting positive transformants, and performing single-enzyme and double-enzyme digestion verification to determine to obtain the bacillus subtilis recombinant strain WB600/pBSA43-Tyr, bacillus licheniformis TCCC11965/pBSA43-Tyr and bacillus amyloliquefaciens CGMCC11218/pBSA 43-Tyr.

Example 3: determination of tyrosinase Activity

Monophenol oxidation activity of tyrosinase was measured by adding 0.75mM L-tyrosine and 0.2. mu.M copper chloride as substrates to 50mM Tris-HCl buffer. Adding 200 mu l of substrate into a 96-well plate, keeping the temperature for 1min, then adding 15 mu l of tyrosinase, detecting the initial OD value of the reaction and the OD value of the reaction for 5min under 475nm to obtain the delta OD value of the reaction, wherein the reaction system is 215 mu l.

The temperature optimum of tyrosinase was measured at pH 7 for its activity between 0-90 ℃.

The optimum pH of tyrosinase is measured under the condition of optimum temperature, and the enzyme activity of tyrosinase is measured at the pH value of 3.0-10.0.

The thermal stability of tyrosinase was measured at the optimum pH for the residual enzyme activity after incubation for 0-2h at 20-70 deg.C, once every 20 min.

The pH stability of tyrosinase was measured at the optimum temperature for the residual enzyme activity after 0-7 days of incubation at pH 3.0-10.0, once every 12 h. The determination of the enzyme activity is three parallel experiments, and the results are averaged.

Definition of enzyme activity: at 475nm, the amount of enzyme required per 1. mu. mol of dopachrome produced is one tyrosinase activity unit (U).

The enzymatic properties of the novel tyrosinase were determined by the above method and were as follows:

when tyrosine is used as a substrate to determine the enzymatic properties of the novel tyrosinase, the optimal action temperature is 60 ℃ (figure 4), and the optimal action pH is 5.0 (figure 5);

the thermal stability of the novel tyrosinase was determined using tyrosine as a substrate, and the results showed that: the novel bacterial tyrosinase has a residual enzyme activity of more than 60% after heat preservation at a temperature of below 35 ℃ for 2h under a pH value of 7.

The pH stability of the novel tyrosinase was determined using tyrosine as a substrate, and the results showed that: the novel bacterial tyrosinase has a residual enzyme activity of more than 60% in a pH range of 3-10 and after heat preservation at 4 ℃ for 168 hours.

Example 4: expression and preparation of novel tyrosinase in bacillus subtilis, bacillus licheniformis and bacillus amyloliquefaciens recombinant strains

Inoculating a bacillus subtilis recombinant strain, a bacillus licheniformis recombinant strain and a bacillus amyloliquefaciens recombinant strain WB600/pBSA43-Tyr, TCCC11965/pBSA43-Tyr and CGMCC11218/pBSA43-Tyr into 5mL of LB liquid culture medium (containing kanamycin and 50 mug/mL), culturing at 37 ℃ and 220r/min overnight, transferring into 50mL of fresh LB culture medium according to the inoculation amount of 2%, continuously culturing at 37 ℃ and 220r/min for 48h, centrifuging at 8000r/min to collect the strain to obtain a fermentation supernatant, thus obtaining a novel tyrosinase crude enzyme liquid with high stability, determining the activity of the novel tyrosinase crude enzyme liquid by taking L-tyrosine as a substrate (under the conditions of pH5 and 60 ℃), allowing the bacillus subtilis to express the novel tyrosinase recombinant strain after fermentation to reach 226U/mL, and allowing the bacillus licheniformis to express the novel tyrosinase recombinant strain after fermentation to reach 313U mL, the tyrosinase activity can reach 438U/mL after the bacillus amyloliquefaciens expresses the novel tyrosinase recombinant strain and is fermented, then the novel tyrosinase is precipitated by adopting a fractional salting-out method, protein precipitate is collected, dialysis is carried out to remove salt, and the novel tyrosinase pure enzyme powder is prepared by ion exchange chromatography, gel chromatography and freeze drying.

Example 5: novel tyrosinase activity enhancement

The recombinant tyrosinase amino acid sequence in the invention is subjected to BLAST homology comparison on NCBI, the similarity between the tyrosinase sequence from Ejapol and the tyrosinase sequence (WP _045290758.1) from Ejapol source on NCBI is found to be 98%, the tyrosinase sequence and the tyrosinase sequence are expressed in a Bacillus subtilis recombinant strain WB600 by the same methods of examples 2, 3 and 4, fermentation is carried out, the enzyme activity of fermentation liquor is determined, and the result shows that the novel tyrosinase enzyme activity is about 2.7 times of WP _ 045290758.1.

Sequence listing

<110> Tianjin science and technology university

<120> tyrosinase, gene, engineering bacteria and preparation method thereof

<130> 1

<141> 2019-06-20

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 912

<212> DNA

<213> Bacillus aryabhattai ()

<400> 1

atgagtaaca agtacaaagt tagaaaaaac gtattgtctc ttacagacgc ggaaaaaaga 60

gattttattc gtgccgtgct aatactaaag aaaaaaggaa tatatgaccg ctatatagcc 120

tggcatggtg cagcaggtaa atttcatact cctccgagca gcgatcgaaa tgcagcacat 180

atgagttctg cttttttgcc gtggcatcgt gaataccttt tgcgattcga acgtgacctt 240

cagtccatcg attcagaagt aacccttcct tattgggaat gggaaacgga tgcacagctg 300

caggatccat cacaatcaca aatttggagc gcagatttta tgggaggaaa cggaaaccca 360

aaaaaagatt ttatcgtcga taccggcccc tttgtagctg ggcgctggac gacgatcgat 420

gaacaaggaa atccttccgg tgggctaaaa cgtaattttg gagcaacgaa agaggcacct 480

acactcccta ctcgagatga tgttctcaat gctttaaaaa taactaagta tgatacgccg 540

ccttgggata tgaccagcca aaacagcttt cgtaatcagc ttgaaggatt tattaacggc 600

ccgcagcttc acaatcgcgt acaccgttgg gttgggggac agatgggcgt tgtccctact 660

gctccgaatg atcctgtctt ctttttacac cacgcaaatg tagatcgtat ttgggctgta 720

tggcaaatgg ttcatcgcaa tcaaaactat cagccgatga aaaacgggcc atttggtcaa 780

aactttagag atccgatgta cccttggaat acaacccctg aagacgttat gaaccatcga 840

aagcttgggt acgtatacga tatagaatta agaaaatcaa aacgttcctc acaccaccac 900

caccaccact ga 912

<210> 2

<211> 303

<212> PRT

<213> Bacillus aryabhattai ()

<400> 2

Met Ser Asn Lys Tyr Lys Val Arg Lys Asn Val Leu Ser Leu Thr Asp

1 5 10 15

Ala Glu Lys Arg Asp Phe Ile Arg Ala Val Leu Ile Leu Lys Lys Lys

20 25 30

Gly Ile Tyr Asp Arg Tyr Ile Ala Trp His Gly Ala Ala Gly Lys Phe

35 40 45

His Thr Pro Pro Ser Ser Asp Arg Asn Ala Ala His Met Ser Ser Ala

50 55 60

Phe Leu Pro Trp His Arg Glu Tyr Leu Leu Arg Phe Glu Arg Asp Leu

65 70 75 80

Gln Ser Ile Asp Ser Glu Val Thr Leu Pro Tyr Trp Glu Trp Glu Thr

85 90 95

Asp Ala Gln Leu Gln Asp Pro Ser Gln Ser Gln Ile Trp Ser Ala Asp

100 105 110

Phe Met Gly Gly Asn Gly Asn Pro Lys Lys Asp Phe Ile Val Asp Thr

115 120 125

Gly Pro Phe Val Ala Gly Arg Trp Thr Thr Ile Asp Glu Gln Gly Asn

130 135 140

Pro Ser Gly Gly Leu Lys Arg Asn Phe Gly Ala Thr Lys Glu Ala Pro

145 150 155 160

Thr Leu Pro Thr Arg Asp Asp Val Leu Asn Ala Leu Lys Ile Thr Lys

165 170 175

Tyr Asp Thr Pro Pro Trp Asp Met Thr Ser Gln Asn Ser Phe Arg Asn

180 185 190

Gln Leu Glu Gly Phe Ile Asn Gly Pro Gln Leu His Asn Arg Val His

195 200 205

Arg Trp Val Gly Gly Gln Met Gly Val Val Pro Thr Ala Pro Asn Asp

210 215 220

Pro Val Phe Phe Leu His His Ala Asn Val Asp Arg Ile Trp Ala Val

225 230 235 240

Trp Gln Met Val His Arg Asn Gln Asn Tyr Gln Pro Met Lys Asn Gly

245 250 255

Pro Phe Gly Gln Asn Phe Arg Asp Pro Met Tyr Pro Trp Asn Thr Thr

260 265 270

Pro Glu Asp Val Met Asn His Arg Lys Leu Gly Tyr Val Tyr Asp Ile

275 280 285

Glu Leu Arg Lys Ser Lys Arg Ser Ser His His His His His His

290 295 300

<210> 3

<211> 41

<212> DNA

<213> Artificial sequence ()

<400> 3

ccggaattcg atgagtaaca agtacaaagt tagaaaaaac g 41

<210> 4

<211> 42

<212> DNA

<213> Artificial sequence ()

<400> 4

aaggaaaaaa gcggccgctg aggacgtttt gattttctta at 42

Claims

1. The tyrosinase is characterized in that the amino acid sequence of the tyrosinase is shown as SEQ ID No.2 in a sequence table.

2. The tyrosinase coding gene according to claim 1, wherein the base sequence of the tyrosinase coding gene is shown in a sequence table SEQ ID No. 1.

3. The method of preparing tyrosinase according to claim 1, comprising the steps of:

(1) carrying out enzyme digestion on the gene of claim 2, and connecting the gene with an expression vector to obtain a new recombinant vector;

(2) transforming the recombinant vector into a host cell to obtain a recombinant strain, and fermenting the recombinant strain to obtain the high-stability bacterial tyrosinase.

4. A recombinant vector or a recombinant strain comprising the tyrosinase-encoding gene of claim 2.

5. The recombinant vector containing tyrosinase-encoding gene as claimed in claim 4, wherein the expression vector is pBSA43 vector.

6. The recombinant strain containing tyrosinase coding gene as claimed in claim 4, wherein the host cell is Bacillus subtilis WB600 or Bacillus amyloliquefaciens CGMCC NO. 11218.

7. The use of tyrosinase as claimed in claim 1 for protein cross-linking and detection of phenolic compounds.