CN110760465B

CN110760465B - Bacillus amyloliquefaciens capable of efficiently secreting and expressing foreign proteins and application thereof

Info

Publication number: CN110760465B
Application number: CN201911119213.5A
Authority: CN
Inventors: 刘文龙; 王兴吉; 郭庆文; 王克芬; 王金余; 钱娟娟; 佟新伟
Original assignee: Shandong Lonct Enzymes Co ltd
Current assignee: Shandong Lonct Enzymes Co ltd
Priority date: 2019-11-15
Filing date: 2019-11-15
Publication date: 2021-04-09
Anticipated expiration: 2039-11-15
Also published as: CN110760465A

Abstract

The invention belongs to the technical field of biology, and particularly relates to bacillus amyloliquefaciens capable of integrating and efficiently secreting and expressing exogenous proteins and application thereof. The strain is specifically Bacillus amyloliquefaciens ZD-708 (delta GA delta EGL), is obtained by obtaining a ZD-708 strain through ARTP mutagenesis on the basis of a Bacillus amyloliquefaciens LKT-10261 capable of efficiently producing neutral protease, knocking out a glucoamylase gene GA and a cellulase gene EGL on the basis of the ZD-708 strain, and disabling shear modification of a pKS1 plasmid by a restriction modification system. The neutral protease obtained by the strain fermentation culture has the enzyme activity of 20200-21930U/mL, the protein content in the supernatant is 95-100mg/mL, the expressed protease has high activity level, the production cost is greatly reduced, and the application field of the enzyme is widened.

Description

Bacillus amyloliquefaciens capable of efficiently secreting and expressing foreign proteins and application thereof

The technical field is as follows:

the invention belongs to the technical field of biology, and particularly relates to bacillus amyloliquefaciens capable of integrating and efficiently secreting and expressing exogenous proteins and application thereof.

Background art:

with the development of biotechnology, in order to reduce production cost, expand action conditions and scope and meet the requirements of diversified products in the market, a plurality of production strains which are high in enzyme production activity, good in production stability and strong in adaptability and aim at different products need to be developed or optimized. Because the development of a plurality of new strains is long, and often a plurality of varieties of enzyme products are produced by the same strain, the production and development speed can be accelerated by utilizing the strain of the same expression system to produce a plurality of different enzyme products, and the industrial dynamics of the market is followed up to meet various demands of the market to the maximum extent. For example, the expression system of Pichia pastoris, the expression system of Bacillus subtilis, the expression system of Bacillus licheniformis, and the like.

Bacillus amyloliquefaciens is a bacillus and is a safe microorganism recognized by the U.S. food and drug administration. Since the last 60 s, the whole genome sequence of bacillus amyloliquefaciens FZB42 published in 2007 was reported, so that people could know the bacillus amyloliquefaciens more deeply. The strain does not pollute the environment, is widely distributed in the nature, is easy to separate and culture, has quick growth and good stability, and is widely used for producing enzyme preparations at present.

The method for DNA homologous recombination knocks out the target gene, namely, adjacent gene segments on two sides of the target gene are designed and connected together, and the target gene is knocked out by transforming a host cell and performing exchange recombination between the adjacent segments and the same segments on two sides of the target gene in the host. In the knockout process, the selection of vectors, transformation methods and screening markers has an important influence on the establishment of an efficient and stable operation system.

The temperature-sensitive plasmid is a plasmid which can autonomously replicate at a specific temperature and cannot autonomously replicate above the specific temperature. Meanwhile, the temperature-sensitive plasmid carries out two processes of plasmid transformation into a host cell and homologous recombination in the host cell separately, thereby greatly improving the success rate of knockout, in particular to the bacillus amyloliquefaciens which is a type of bacteria difficult to transform. Temperature-sensitive plasmids such as pE194 and pKS1, etc., wherein pE194 is used for the earliest and most extensive time, but the plasmid itself is large, the transformation difficulty is relatively large, and in the using process, in some strains, the situation of being insensitive to temperature can occur, and when the temperature is raised to 40 ℃, the plasmid in a part of cells can still keep a free state. pKS1 replicates autonomously at 30 degrees and stops at 37 degrees, and is more sensitive to temperature changes. In 2010, Zakataeva et al firstly apply pKS1 plasmid to Bacillus amyloliquefaciens and establish a knock-out method for understanding the Bacillus amyloliquefaciens.

The transformation rate of wild bacillus amyloliquefaciens is low, and due to the limitation of modification systems in bacteria, at present, no patent for screening the bacillus amyloliquefaciens and modifying an expression system of the bacillus amyloliquefaciens is reported.

The invention content is as follows:

the invention firstly provides a bacillus amyloliquefaciens capable of efficiently secreting and expressing neutral protease, the strain is specifically bacillus amyloliquefaciens (Bacillus amyloliquefaciens) ZD-708 (delta GA delta EGL), a ZD-708 strain is obtained by ARTP mutagenesis on the basis of bacillus amyloliquefaciens LKT-10261 capable of efficiently producing neutral protease, a glucoamylase gene GA and a cellulase gene EGL are knocked out on the basis of the ZD-708 strain, and the shear modification of a pKS1 plasmid by a restriction modification system is ineffective;

the nucleotide sequence of the glucoamylase gene GA is shown in a sequence table SEQ ID NO. 2;

the nucleotide sequence of the cellulase gene EGL is shown as a sequence table SEQ ID NO. 3;

the ZD-708 strain of Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) has been deposited in the general microbiological center of China Committee for culture Collection of microorganisms in 10 and 9 months in 2019 with the addresses as follows: no.3 of Xilu No.1 of Beijing Kogyo of Chaoyang, China, zip code 100101, with the preservation number of CGMCC NO. 18644.

The invention also provides the application of the strain ZD-708 (delta GA delta EGL) in the production of the neutral protease.

Further, the method for producing neutral protease by fermentation using the strain ZD-708(Δ GA Δ EGL) is as follows:

inoculating the strain into a fermentation culture medium according to the inoculation amount of 5-8%, placing in a shaking table at 200-220 rpm and 35-37 ℃, and culturing for 80-90 h. Taking the fermentation liquor, centrifuging for 5min at 8000rpm, determining the neutral protease activity of the supernatant to be 20200-21930U/mL, and determining the protein content of the supernatant to be 95-100 mg/mL.

The fermentation medium comprises the following components: 32g/L of maltodextrin, 14g/L of corn flour, 12g/L of bean cake powder, 2.3g/L of yeast powder and Na₂HPO₄4.4g/L，KH₂PO₄5.1g/L, calcium carbonate 1%, pH 7.0.

The strain ZD-708 (delta GA delta EGL) can grow under the conditions of 25-65 ℃ and pH4.5-8.5; the optimal growth temperature is 30-48 ℃, and the optimal growth pH5.0-8.0. By applying the wider temperature and pH adaptability of the strain, various enzyme preparations with different characteristics of acidity, alkalinity, high temperature and low temperature can be efficiently expressed, and when the strain is used for expressing pullulanase, the protein expression level can reach 95-118mg/mL, so that the production cost can be greatly reduced, and the application of the expressed enzyme preparations in more industries is promoted.

The invention also provides application of the strain ZD-708 (delta GA delta EGL) in an expression system for efficiently secreting and expressing foreign proteins;

further, the expression of the target product can be achieved by replacing the neutral protease gene APR in the strain ZD-708(Δ GA Δ EGL);

the nucleotide sequence of the neutral protease gene APR is shown in SEQ ID NO. 1.

Has the advantages that:

the shear modification of a pKS1 plasmid by using a restriction modification system of the bacillus amyloliquefaciens ZD-708 (delta GA delta EGL) constructed by the invention after mutation is ineffective, the bacillus amyloliquefaciens ZD-708 (delta GA delta EGL) can efficiently secrete and express neutral protease as a production strain of the neutral protease, the enzyme activity of the neutral protease obtained in fermentation culture is 20200-21930U/mL, the protein content in supernatant is determined to be 95-100mg/mL, the expressed protease activity level is high, the production cost is greatly reduced, the application field of the enzyme is widened, the conversion of new and old kinetic energy of related industries is accelerated, and the economic high-quality development of the related industries is promoted.

Description of the drawings:

FIG. 116 electrophoretic detection of PCR products of SrRNA

Wherein, M is Marker, and 1 is sample;

FIG. 2 is a partial map of plasmid pKS 1;

FIG. 3 electrophoretic detection of glucoamylase Gene knockout

Wherein, M is Marker, and 1 is sample;

FIG. 4 electrophoretic detection of cellulase Gene knockout

Wherein, M is Marker, and 1 is sample;

the specific implementation mode is as follows:

the present invention will be described in detail below with reference to specific embodiments, which are only illustrative and are not intended to limit the scope of the present invention.

EXAMPLE 1 screening and identification of strains producing high amounts of neutral protease

1. Bacterial strain preliminary screening

Collecting a soil sample of a Yishui county food industry park, and grinding the collected soil sample by using a mortar; taking 5g of ground soil sample, and putting the ground soil sample into a large triangular flask filled with 95ml of sterile water for full oscillation to obtain a soil suspension; diluting the soil suspension in a gradient manner to obtain soil suspensions with different concentrations; select concentration of 10^-6、10^-7And 10^-8Adding 100 mu l of the soil suspension into an SX culture medium plate, uniformly coating, and culturing in an incubator at 37 ℃ for 1-3 days; selecting a large single colony with a transparent ring, streaking the single colony on an SX culture medium plate again, carrying out secondary confirmation, separation and purification, culturing for 1-3 days at 37 ℃ to obtain a separated and purified single colony, inoculating the single colony into a test tube filled with 5mLSX liquid culture medium, placing the test tube in a shaking table at 37 ℃ and 200rpm for culturing for 1-2 days, taking 1mL of bacterial suspension and 1mL of sterilized 40% glycerol into a 5mL centrifuge tube, and placing the centrifuge tube in a refrigerator at-20 ℃ for storage and later use.

The composition of the SX medium for plate screening is as follows: 15g/L of tryptone, 5g/L of yeast extract powder, 0.5g/L of sodium chloride, 0.12g/L of potassium chloride, 0.15g/L of calcium chloride, 2.2g/L of magnesium sulfate, 3.6g/L of glucose, 1.7g/L of skimmed milk powder, 1.2g/L of potassium dihydrogen phosphate, 0.96g/L of disodium hydrogen phosphate, 10g/L of agar powder and pH 7.0.

The liquid SX culture medium is the culture medium without agar powder.

2. Rescreening of bacterial strains

Taking a frozen strain, marking on an SX culture medium plate, culturing for 1-3 days at 37 ℃, taking a single colony with a larger transparent ring on the plate by using an inoculating needle, inoculating the single colony into a test tube filled with 10mLSX liquid culture medium, placing the test tube in a shaking table at 37 ℃ and 200rpm, culturing for 1-2 days, inoculating the single colony into a 24-hole deep-hole plate, performing high-flux rescreening, wherein the liquid loading amount is 3mL per hole, the inoculation amount is 10%, and placing the single colony in the shaking table at 37 ℃ and 200rpm, and culturing for 1-2 days.

The culture medium adopted by the deep-hole plate re-screening comprises the following components: maltodextrin 20g/L, peptone 14g/L, yeast powder 3g/L, Na₂HPO₄3g/L，KH₂PO₄4.2g/L，pH7.0。

From 15326 strains, a strain with the highest enzyme activity, namely LKT-10261, is obtained by secondary screening, and the enzyme activity of the produced neutral protease reaches 8000U/mL.

3. Determination of enzyme Activity

The method is characterized in that protease hydrolyzes casein substrates under certain temperature and pH conditions to generate amino acids (such as tyrosine, tryptophan and the like) containing phenolic groups, the Folin reagent (Folin) is reduced under alkaline conditions to generate molybdenum blue and tungsten blue, and a spectrophotometer is used for measuring the absorbance of a solution at the wavelength of 680 nm. The enzyme activity is proportional to the absorbance, and thus the enzyme activity of the product can be calculated.

Definition of enzyme activity: hydrolysis of casein at a temperature (40 ℃. + -. 0.2 ℃) and corresponding pH conditions (acid protease pH3.0, neutral protease pH7.2) within 1min produced an enzyme amount corresponding to 1. mu.g of phenolic amino acids (expressed as tyrosine equivalents), expressed as 1 enzyme activity unit, expressed as U.

4. Identification of strains

And identifying the screened strain LKT-10261 with highest enzyme activity by adopting a conventional physiological and biochemical reaction and a 16SrRNA technology. In the embodiment of the invention, the genome in the strain is extracted by adopting a genome extraction kit produced by Shanghai industrial organisms. FIG. 1 shows an electrophoresis diagram of PCR products when 16SrRNA was PCR-identified for strain LKT-10261. The PCR product was sequenced by Shanghai Biotech, and further by using a French biological Merrier bacteria identifier (refer to "Manual of common bacteria identification"), the physicochemical characteristics are shown in Table 1, and finally, it was determined that the strain LKT-10261 was Bacillus amyloliquefaciens, and the bacterial colony of the strain was white, transparent, oval, regular in edge, and convex spherical in surface.

TABLE 1 Main biological characteristics of LKT-10261

Example 2 mutagenesis of strains and selection of strains that do not produce spores and have an increased level of enzyme Activity

1. Preparation of the bacterial suspension

Taking frozen strain LKT-10261, streaking on an SX culture medium solid plate, culturing for 1-3 days at 37 ℃, taking a single colony with a relatively large transparent ring on the plate by using an inoculating needle, inoculating the single colony in a triangular flask filled with 100mLSX liquid culture medium, placing the triangular flask in a shaking table at 37 ℃ and 200rpm, culturing for 1.5 days, absorbing 40mL of seed solution in a centrifuge tube at 8000rpm, centrifuging for 5min, discarding supernatant, and cleaning thalli by using 30mL of physiological saline. Centrifuging for 2 times under the same conditions, and re-suspending the precipitated thallus with 10mL of sterile water to obtain a bacterial suspension with the concentration of 10⁷About one/mL.

2. Normal temperature and pressure plasma mutagenesis (ARTP mutagenesis)

Sucking 10 μ L bacterial suspension on the slide, placing the slide on a rotating table of an ARTP mutagenesis system operation chamber by using tweezers, slowly adjusting a lifting table knob (referring to a lifting table scale) to adjust the distance between the slide and a generator to about 1.6mm, and selecting mutagenesis irradiation time from 8s, 12s, 15s and 17 s. After completion of mutagenesis, the slide glass was transferred to an EP tube filled with 1mL of physiological saline, shaken with a vortex shaker, and then appropriately diluted. Coating 100 μ L of the suspension on an SX medium plate, and culturing in an incubator at 37 deg.C for 1-3 days; and selecting a single colony with a large transparent circle, and further screening by shaking a flask.

3. Screening mutagenic strain without producing spore and with high enzyme activity level by shaking bottle

A single colony with a relatively large transparent circle on the plate was inoculated by an inoculating needle into a flask containing 100mLSX liquid medium, and cultured in a shaker at 37 ℃ and 200rpm for 1.5 days. Inoculating 5ml of the culture medium into a shake flask screening medium, placing the medium in a shaking table at 37 ℃ and 200rpm, culturing for 3 days, performing image microscopic examination before determining enzyme activity, and determining the enzyme activity level if spores are not produced. The shake flask enzyme activity level of 3 mutant strains which are screened and have obviously improved enzyme production level and do not produce spores is as follows:

mutagenic strains	Triple average enzyme activity level
		ZD-10916	17427
ZD-708	16960
		ZD-6628	13718

The shake flask screening medium consists of: 40g/L of maltodextrin, 15g/L of corn flour, 14g/L of bean cake powder, 2g/L of yeast powder and Na₂HPO₄4g/L，KH₂PO₄5g/L, calcium carbonate 2%, pH7.0.

The screened spore-forming mutagenesis strain is beneficial to the subsequent fermentation process.

Example 33 verification of whether the mutant strains were capable of molecular genetic manipulation

The authors (Connaughton J F, et al, Gene Analysis Techniques,1988,5(6): 116-. On the other hand, plasmid pKS1, which has a BamHI site, is shown in FIG. 2, so that if the strain restriction modification system is not disrupted by mutagenesis, plasmid pKS1, transformed into Bacillus amyloliquefaciens, is degraded by endogenous BamHI restriction enzymes, whereas transformants grow on resistant plates and show kanamycin and erythromycin resistance on the plasmid. Therefore, the 3 mutant strains ZD-10916, ZD-708 and ZD-6628 selected above are taken to be transformed with plasmid pKS1 to verify whether the restriction modification system of the strain has failed to shear modify the plasmid, so as to facilitate the subsequent molecular operation on the basis of the strain.

3.1 preparation of electrotransformation competent cells

Taking the frozen tubes of the 3 mutant strains, respectively streaking on LB plates, placing in a 37 ℃ incubator, culturing for 1-2 days, selecting a single colony, inoculating into 200mLLB culture medium, culturing in a 37 ℃ shaking table at 200rpm to OD₆₀₀The bacterial liquid is placed in an ice-water bath for 15min, 2 50mL centrifuge tubes are used for centrifuging for 15min at 9000rpm under the environment of 4 ℃, the supernatant is removed, after all the centrifugation is finished, the bacterial liquid is repeatedly suspended and precipitated by using an electrotransformation buffer (prepared by 0.7mol/L sorbitol, 0.8mol/L mannitol, 12% glycerol and deionized water) precooled in an ice bath, the supernatant is removed after the centrifugation is carried out for 15min under the environment of 4 ℃ again at 9000rpm, the precipitated bacterial liquid is repeatedly washed for 5 times, finally 4mL of precooled electrotransformation buffer is added, and after the bacterial liquid is repeatedly suspended, 100 mu L of the bacterial liquid is subpackaged by a 100 mu L tube and is rapidly placed in a refrigerator at-70 ℃ for later use.

3.2 verification of the electrotransformation of the plasmid pKS1

And (3) taking the prepared electrotransformation competence of the 3 strains, adding 1.5 mu L of plasmid pKS1 with the concentration of 80 ng/mu L, repeatedly and uniformly mixing, adding into a precooled 2mm electrotransfer cup, immediately adding 1.5ml of SX culture medium containing 0.6mol/L sorbitol and 0.4mol/L mannitol after 1800V electric shock for 5ms, placing in a shaking table with the temperature of 30 ℃ and the rpm of 130 for culture for 3h, taking 50 mu L of bacterial liquid after shaking uniformly, coating on an LB solid plate containing Kan (30 mu g/ml), placing in an incubator with the temperature of 30 ℃ for culture for 2 days, and carrying out the next molecular genetic operation if bacterial colonies grow out on the coated LB plate. The experimental result shows that only ZD-708 in the three mutant strains has a large number of colonies, which indicates that the mutant strain ZD-708 can be subjected to molecular genetic manipulation after mutagenesis.

Example 4 simplified optimization of the expression System of the mutagenized Strain ZD-708

In order to further simplify the expression system of the mutant strain ZD-708, reduce the secretory expression of other hybrid proteins and make more energy flow and substance flow to the target protein so as to facilitate the subsequent extraction of the target protein, some genes of non-essential hybrid proteins need to be identified and deleted.

4.1 identification of the Heteroprotein Gene

Selecting shake flask fermentation liquor of the mutagenic strain ZD-708, centrifuging at 8000rpm for 5min to obtain supernatant, performing non-denaturing polyacrylamide gel electrophoresis detection, and recovering enzyme proteins of 3 main bands.

The main enzyme classes produced by bacillus amyloliquefaciens are: saccharifying enzyme, cellulase, pectinase, protease, phytase and alpha-amylase.

The proteins in the 3 main bands recovered above were verified one by one using the national standard method, wherein the national standard of each enzyme was verified as follows: saccharifying enzyme is referred to international standard GB8276-2006, cellulase is referred to international standard NY/T912-2004, pectinase is referred to international standard NY/T912-2004, protease is referred to international standard GB/T23527-2009, phytase is referred to international standard GB/T18634-2009, and alpha-amylase is referred to international standard GB/T24401-2009.

The enzyme types of the three main bands are respectively verified as follows: neutral protease, cellulase and glucoamylase.

And (3) extracting the genome of the strain ZD-708 by using a bacterial genome DNA rapid extraction kit of Shanghai worker, and sending the genome to the Shanghai worker to perform whole genome sequencing. The sequences of the cellulase and the glucoamylase genes in the genome sequence of the mutant strain ZD-708 are found by comparing with the conserved sequences of the cellulase and the glucoamylase in the genome sequence of other known bacillus amyloliquefaciens.

4.2 traceless deletion of Heteroprotein Gene

4.2.1 design of homology arm primers

Designing and amplifying upstream and downstream homologous arm primers of the two genes according to the upstream and downstream 700bp-100bp sequences of the cellulase and glucoamylase gene sequences in the genome sequence of the mutagenic strain ZD-708. Adding Kpn I and Not I enzyme cutting sites and protective basic groups on the primers, and designing the primers as follows:

two pairs of primers GA-S1/GA-X1 and GA-S2/GA-X2 for amplifying upstream and downstream homologous arm fragments of a saccharifying enzyme gene (GA gene); the names of the upstream and downstream homologous arm segments amplified by the pair of primers are GA-S (upstream homologous arm) and GA-X (downstream homologous arm) respectively; the primers for fusing the two homologous arm fragments are GA-S1 and GA-X2, and the name of the fused fragment is GA-S-X; the primers YZ-1 and YZ-2 are used for verifying whether the GA gene is knocked out, if the GA gene fragment can be amplified, the GA gene fragment is not knocked out, and if the GA gene fragment cannot be amplified, the GA gene fragment is knocked out successfully.

Two pairs of primers EGL-S1/EGL-X1 and EGL-S2/EGL-X2 for amplifying homologous arm fragments at the upper and lower reaches of the cellulase gene (EGL gene); the names of the upstream and downstream homologous arm segments amplified by the pair of primers are respectively EGL-S (upstream homologous arm) and EGL-X (downstream homologous arm); the primers for fusing the two homologous arm fragments are EGL-S1 and EGL-X2, and the name of the fused fragment is EGL-S-X; the primers YZ-3 and YZ-4 are primers for verifying whether the EGL gene is knocked out, if the EGL gene fragment can be amplified, the EGL gene fragment is not knocked out, and if the EGL gene fragment cannot be amplified, the EGL gene fragment is knocked out successfully.

Specific primer sequences are shown in the following table:

4.2.2 amplification of homology arms

And respectively using the 4 pairs of primers and the mutant strain ZD-708 genome extracted by the kit as a template to amplify different homologous arms. The specific reaction system is as follows:

the PCR reaction system used was 50. mu.L, as shown below.

Composition (I)	Volume of
		ddH2O	32.0μL
10×PCR Buffer	5.0μL
		dNTP(2.5mmol/L)	5.0μL
Upstream primer (10mmol/L)	2.0μL
		Downstream primer (10mmol/L)	2.0μL
Strain ZD-708 genome	2.0μL
		Taq DNA polymerase (5U/. mu.L)	2.0μL

The annealing temperature adopted is 55-65 ℃. Taking 56 ℃ as an example, the reaction procedure is as follows.

After the amplified homologous arm fragments are verified by nucleic acid electrophoresis, 4 homologous arm fragments are recovered by a gel cutting recovery kit (purchased from Shanghai bio-organisms) and are respectively GA-S/GA-X/EGL-S/EGL-X. And performing fusion PCR by using GA-S and GA-X as templates and GA-S1 and GA-X2 as primers, wherein the specific reaction system is as follows: the annealing temperature was 67 ℃.

Composition (I)	Volume of
		ddH2O	32.0μL
10×PCR Buffer	5.0μL
		dNTP(2.5mmol/L)	5.0μL
GA-S1(10mmol/L)	2.0μL
		GA-X2(10mmol/L)	2.0μL
GA-S homology arm fragment	1.0μL
		GA-X homology arm fragment	1.0μL
Taq DNA polymerase (5U/. mu.L)	2.0μL

Similarly, EGL-S and EGL-X are used as templates, and GA-S1 and GA-X2 are used as primers to perform fusion PCR.

4.2.3 ligation of fusion fragments to T vectors

And (2) performing nucleic acid electrophoresis on the obtained PCR product, obtaining 2 homologous arm fusion fragments by using a gel cutting recovery kit (purchased from Shanghai biological organisms), adding the purified and recovered 2 homologous arm fusion fragments, pMD19-T simple vector (purchased from Shanghai biological organisms) and Solution I (purchased from Shanghai biological organisms) into a connection system according to the volume ratio of 4.5:0.5:5, and reacting for 1-6 h at 16 ℃. Coli Top10 competent cells (purchased from Shanghai life) were transformed, screened with blue and white spots, and further subjected to sequencing verification to obtain cloned plasmids containing two gene homology arm fusion fragments, which were named as T-GA-S-X and T-EGL-S-X, respectively.

4.2.4 construction of knockout plasmids

4.2.4.1 ligation of fusion homology arm GA-S-X to pKS1 plasmid

The cloned plasmid T-GA-S-X and the temperature sensitive plasmid pKS1 (purchased from Shanghai) obtained above were double digested with Kpn I and Not I, respectively, using the following double digestion reaction systems:

composition (I)	Volume of
		Cloning plasmids or temperature-sensitive plasmids	5.0μL
KpnⅠ	1.0μL
		NotⅠ	1.0μL
10*FastDigest	2.0μL
		ddH₂O	11.0μL
Total	20.0μL

And (3) performing nucleic acid electrophoresis on the obtained double-enzyme digestion product, and obtaining a linear fragment of the fusion homology arm fragment GA-S-X and the temperature-sensitive plasmid pKS1 both with the cohesive ends of Kpn I and Not I enzyme digestion sites by a gel cutting recovery kit (purchased from Shanghai organisms). Then the two are connected together, and the reaction system is as follows:

composition (I)	Volume of
		Linear plasmid pKS1	3.0μL
Fusion homology arm fragment GA-S-X	1.0μL
		SolutionⅠ	5.0μL
ddH₂O	1.0μL
		Total	10.0μL

The obtained ligation product was transformed into E.coli Top10 competent cells (purchased from Shanghai Probiotics), spread on LB plates containing erythromycin (100. mu.g/mL) resistance, and cultured in an incubator at 30 ℃ for 15 hours. Single colonies on the resistant plates were randomly picked, inoculated into 50mL LB liquid medium containing erythromycin (100. mu.g/mL), placed in a shaker at 30 ℃ and cultured at 200rpm for 12 hours. Then, a recombinant plasmid was extracted using a plasmid extraction kit (purchased from Shanghai, Ltd.), and the recombinant plasmid was named pKS1-GA, and was further verified by sequencing.

4.2.4.2 ligation of fusion homology arms EGL-S-X with pKS1 plasmid

The cloned plasmid T-EGL-S-X and the temperature-sensitive plasmid pKS1 (deposited by the company) obtained above were digested with Kpn I and Not I in a double digestion reaction system as follows:

And (3) performing nucleic acid electrophoresis on the obtained double-enzyme digestion product, and obtaining a linear fragment of the fusion homologous arm fragment EGL-S-X and the temperature-sensitive plasmid pKS1 both with the cohesive ends of Kpn I and Not I enzyme digestion sites by a gel cutting recovery kit (purchased from Shanghai biologies). Then the two are connected together, and the reaction system is as follows:

the obtained ligation product was transformed into E.coli Top10 competent cells (purchased from Shanghai Probiotics), spread on LB plates containing erythromycin (100. mu.g/mL) resistance, and cultured in an incubator at 30 ℃ for 15 hours. Single colonies on the resistant plates were randomly picked, inoculated into 50mL LB liquid medium containing erythromycin (100. mu.g/mL), placed in a shaker at 30 ℃ and cultured at 200rpm for 12 hours. The recombinant plasmid was then extracted using a plasmid extraction kit (purchased from Shanghai, Ltd.), designated pKS1-EGL, and further verified by sequencing.

4.2.5 deletion of the saccharifying enzyme Gene GA

4.2.5.1 preparation of mutant ZD-708 electrotransformation competence

The same procedure was followed for the preparation of the receptor form in example 3.1.

4.2.5.2 electrotransformation of recombinant plasmid pKS1-GA

100 mu L of mutagenic strain ZD-708 is taken for electrotransformation competence, 1.5 mu L of recombinant plasmid pKS1-GA with the concentration of 80 ng/mu L is added, after repeated and uniform mixing, the mixture is added into a precooled 2mm electrotransfer cup, after 1800V electric shock for 5ms, 1.5mL of SX liquid culture medium containing 0.6mol/L sorbitol and 0.4mol/L mannitol is immediately added, the mixture is placed in a shaker at 30 ℃ and cultured for 6h at 200rpm, then 100 mu L of the mixture is taken and coated on an erythromycin (100 mu g/mL) resistant LB plate, and the mixture is placed in an incubator at 30 ℃ and cultured for 15 h. And (3) selecting a single colony growing on the resistant plate, inoculating the single colony into 50mL of non-resistant LB liquid medium, culturing for 15h in a shaker at 37 ℃ and 200rpm, taking 100 mu L of the single colony, coating the single colony on an erythromycin (100 mu g/mL) resistant LB plate, placing the single colony in a 37 ℃ incubator, and culturing for 15h, wherein the growing single colony is a transformant which generates homologous recombination and single exchange. Then transferring the single-exchanged transformant to a nonresistant LB culture medium, culturing for 38h in a shaking table at 30 ℃ and 200rpm, taking 100 mu L of the single-exchanged transformant, coating the 100 mu L of the single-exchanged transformant on a nonresistant LB plate, placing the single-exchanged transformant in an incubator at 37 ℃ for culturing for 15h, randomly selecting about 100 single colonies, transferring the single colonies to an erythromycin (100 mu g/mL) resistant LB plate, selecting the single colonies which are not long on the resistant plate for colony PCR identification, performing PCR amplification by using a primer YZ-1 and a primer YZ-2, wherein the length of a PCR product is 3563bp if GA gene is not successfully knocked out, and the length of the PCR product is 530bp if GA gene is successfully knocked out. The strain in which the GA gene of the saccharifying enzyme is successfully knocked out is named as ZD-708 (delta GA), and the result of electrophoresis detection on whether the saccharifying enzyme is knocked out is shown in figure 3.

4.2.6 knock-out of cellulase EGL

The thus-obtained strain ZD-708 (. DELTA.GA) was prepared into electroporation competent cells in the same manner as in 3.1.

Taking 100 mu LZD-708 (delta GA) electrotransformation competence, adding 1.5 mu L of recombinant plasmid pKS1-EGL with the concentration of 80 ng/mu L, knocking out the glucoamylase GA gene in the subsequent operation process, finally verifying that the primers of colony PCR are YZ-3 and YZ-4 respectively, after PCR amplification is carried out by using the primers YZ-3 and the primer YZ-4, if the EGL gene is not successfully knocked out, the length of the PCR product is 2726bp, and if the EGL gene is successfully knocked out, the length of the PCR product is 451 bp. The strain which successfully knocks out the EGL gene is named as ZD-708 (delta GA delta EGL), and the result of electrophoresis detection on whether cellulase is knocked out is shown in figure 4.

The strain ZD-708 (delta GA delta EGL) can grow under the conditions of 25-65 ℃ and pH4.5-8.5; the optimal growth temperature is 30-48 ℃, and the optimal growth pH5.0-8.0. By using the wider temperature and pH adaptability of the strain, various enzyme preparations with different characteristics of acidity, alkalinity, high temperature and low temperature can be efficiently expressed, the production cost can be greatly reduced, and the application of the expressed enzyme preparations in more industries is promoted.

Example 5 method for producing neutral protease by fermentation of reduced genome Strain ZD-708 (. DELTA.GA. DELTA.EGL)

(1) Plate culture: culturing for 28h in an incubator at 37 ℃;

the plate culture medium consists of: 8g/L of peptone, 3g/L of yeast powder, 2g/L of sodium chloride, 3g/L of casein, 1g/L of magnesium sulfate, 10g/L of glucose and 13g/L of agar;

(2) seed culture: placing in a shaking table at 37 ℃ and 220rpm, and culturing for 13 h;

the seed culture medium comprises the following components: 4g/L of peptone, 5g/L of yeast powder, 4g/L of sodium chloride, 2g/L of magnesium sulfate and 18g/L of glucose;

(3) and (3) shake flask fermentation culture: the inoculation amount is 8 percent, and the inoculated strain is placed in a shaking table at 37 ℃ and 220rpm for 90 hours;

the shake flask fermentation medium consists of: 32g/L of maltodextrin, 14g/L of corn flour, 12g/L of bean cake powder and fermented rice2.3g/L of mother powder and Na₂HPO₄4.4g/L，KH₂PO₄5.1g/L, 1% of calcium carbonate, and pH7.0;

taking fermentation liquor after shaking flask fermentation is finished, centrifuging for 5min at 8000rpm, measuring the enzyme activity of neutral protease in supernatant to be 21930U/mL, and measuring the protein content in supernatant to be 95 mg/mL;

protein content was performed according to literature methods (bradford. anal Chem, 1976).

Example 6 method for producing neutral protease by fermentation of reduced genome Strain ZD-708 (. DELTA.GA. DELTA.EGL)

(1) Plate culture: culturing for 28h in an incubator at 37 ℃;

(3) and (3) shake flask fermentation culture: inoculating 5% of the strain, placing in a shaking table at 200rpm and 35 ℃, and culturing for 80 h;

the shake flask fermentation medium consists of: 32g/L of maltodextrin, 14g/L of corn flour, 12g/L of bean cake powder, 2.3g/L of yeast powder and Na₂HPO₄4.4g/L，KH₂PO₄5.1g/L, 1% of calcium carbonate, and pH7.0;

after the shake flask fermentation is finished, taking the fermentation liquor, centrifuging for 5min at 8000rpm, and measuring the enzyme activity of the neutral protease in the supernatant to 20200/ml.

Sequence listing

<110> Shandonglongket enzyme preparations Co., Ltd

<120> bacillus amyloliquefaciens capable of efficiently secreting and expressing foreign proteins and application thereof

<130> 1

<141> 2019-11-15

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1517

<212> DNA

<213> Strain ZD-708(Δ GA Δ EGL)

<400> 1

gtgggtttaggtaagaaattgtcagtctgccgggtgttcaggcctctagtgctgtagccg 60

cttcctttatgagtttaaccagctggtgcaagaatcctcagcttaaagaaaacctgacga 120

attttgtaccgaagcagtgggtccgctgtagcggcgaattgccttctgtcagtgacaaag 180

ctatcaatgacgatacttgaaacaaaacaccaaggcaaagtccttaaaggcaatccttct 240

gaaagtgcct attgaagctg ataccgatga tctcggctac aagcacttcc gttatgtgcc 300

tgtcgtaaac ggtattaacg gtgaattaaa caacgatgtt tccgccaaaa cggcaaacag 360

caaaagtctt ctaacggaac cgttgcaaac aaaaacaaag ccgagctgaa agcagcagcc 420

acaaaaatta tgcgcaaatc aggcgctgga tcatgcttat aaagcgatcg gcaaatcacc 480

tgaagcagac ggcaaatacc gcctcgccta tgatgtaacc atccgctaca tcgaaccgga 540

acccgttatc tgggtgaaag actctcaagt cattattcac gtcgataaat ccaacaactg 600

caaactggga agtaaccgtt gatgcggaaa caggaaaaat ccttgaaaaa gcaaaacaac 660

attaaatatt tcttctgaaa gcggcaaata tgtgctgcgc gatctttcta aacctaccga 720

gtgggcatgc cgccacaacc ggaacaggta cgactcttaa aggaaaaacg gtctgctcgt 780

atccagcacc acaaaccagt ttacaacttc ttctcagcgc gctgcacacc gttgataaca 840

caaaataata cgtacgatct gcaaaaccgc gagtggagct ataacctgcc ctccgtgggg 900

cgcataacaa cctcggcaaa gtgtatgaat atttctatca gaagtataat cgcaacagct 960

acgacaataa aggcgtacaa taacgcagcc aagatcgtat ctcaatacgg cagcagatcg 1020

gcgaccaaat gatttacggt gacggcgacg gttgaattcc atgaagattc ttctcaccta 1080

tgacacatgc tttccggttc aatggacgta accgctcgtt acacaggtct gatgaaacag 1140

ccaacctgaa ctacgaaaat cgggcgcttt aagcttacgc aacattctat tcgggtactt 1200

caacgatact gaggactggg atatcggtga agatagtcag ggacagccag ccggctctcc 1260

gcagcttatc caatccggcg tatgacaggg catacaaaca ttacaaaaat cgcggaatcc 1320

cgaacaaagc cgcttacaat atcaacgagg cgtgaacaaa gcggagcaga tttactatcg 1380

tgctctgacg gtatacctct gtcactccgt cacttcggga ccttttaaag atgcaaaagc 1440

cgctttgatt cacaactcac gtcgacgcga ccgggctctc aagatgctag aagctgcctg 1500

gaatggtcgg attgtaa 1517

<210> 2

<211> 1222

<212> DNA

<213> Bacillus amyloliquefaciens (Bacillus amyloliquefaciens ZD-708)

<400> 2

atgatccttc ttttgaagac ttatataaag ttgacagaac tgacttggaa accttcttgg 60

acaaacaaaa gaaattcaaa cgatgtatct ttatactatc ttttacaaaa cattgcttat 120

ccaggccaat ttaacacaga tggttctgca tacaccggag cttgggggag aaccagccta 180

atttaatgac ggtgttcccg gtactgttat tgcttctcca tcattttcga acagttcttt 240

ctgaactaga agataataac ttcaatacca ctttggctaa acctcaatcc ggactactat 300

taccaatgga ccagagattc cgcaattaca taaggcagtt gagtactaca ttaataccag 360

ttacaacctt caaagaacac ctaaccacaa gtggcagctt tgatgatgaa aatcataaag 420

gcttgggagg cagacacttt tttacaagct tggttcaaca gaaagccctt gcttaaaatg 480

ctgctgcttc taccctcgaa agttatttga gtggcagtga tggtgacaaa actcctagac 540

aaggtctaga ttcagccact tatattggcc cacttttgga tttgttaata ctgatgttaa 600

ccacattgtt gaaaacccag atttgcttgt taacagtgct tattctgctg gtgcagctat 660

tggcagatac ccagaagaca gtatgttttg caatcatatt acttgttatt ggaggataat 720

aaagacagat actgacgcaa aatgatggtc ctgctttgag agcttatgca tcaaaccaga 780

cttcaaggaa tatgttatag ggtactggga ttctactggg tttgatcttt gggaggaacc 840

caaactcatg atattggcga aagcagctca actccatttg atgttgacaa tgtaatgaca 900

ttaccattaa caagattaac tacgattttt ttaacaagta tatggctcat tgtgtttaca 960

atggtgatgg ttcatctgaa ggcaatccat ggtttttagc taccctatgc tgcccaagtt 1020

ccatacaaac ttgtttatga tgcaaagtct gcctcatgat gattcttttt gcaagtcatt 1080

ttggatcata ttaatgatgc gaatgaacaa cttaacagaa ataccggtta ttccaccagt 1140

gcctactctt ttatgacaac tggagcagtg gtgctcttct tgaagctatt agacttagaa 1200

ataaggtcaa ggctttggct aa 1222

<210> 3

<211> 1203

<212> DNA

<213> Bacillus amyloliquefaciens (Bacillus amyloliquefaciens ZD-708)

<400> 3

atgaaacggt caatccttgc tactattttt attacgtgtt tattgattgc ggtattgaca 60

atgggcggca agatgccttc gccggcatca gcagcaggga caaaaacgcc agtagcaaag 120

cggatacaac tgaaagggat cagttcacat ggattgcaat ggtatggcga atgggtcagc 180

ttagcataaa aggtacacaa cttgtaaacc aagacggcat ttcgtcaata aagacagctt 240

aaaatggctg agagacgatt ggggcatcac cgttttccgc gcggcaactg tatacggcag 300

acggcggtta tattgacaac ctcatttatg aaattgcaaa tgaaccaaac ggtgacgtga 360

actggaagcg tgatattaca accgtatgcg gaagaagtga tttccgttat ccgcaaaaat 420

gaccccgaca atcccatcat tgtcggaacc ggtacatgga gccaggatgt gaatgatgct 480

gccgatgacc agctaaaaga tgcaaacgtc atgtacgcgc ttcattttta tgccggcaca 540

cacggccaat ctttacggga taaagcaaac tatgcactca gtaacaggag cgcctatttt 600

cgtgacggaa tggggaacaa gcgggtgaac tggaatcttt ctgataagca ggaatcatcc 660

tcagcgttaa agcctggagc atctagaaaa cattcgcagc aacaaagatt caacgaagga 720

cgcccctgaa acgccaaaac aggcggctgg ccgctgtcag atttaactgc ttcaggaacc 780

ttcgtaagag cacaagataa tcccacacag gaaaaaggcg tttctgtaca atacaaatgc 840

aggggatggg agtgtgaaca gcaaccaaat ccgcccgcag cttcacataa gatacctatc 900

tggaactggg gtttaaaaaa ggaacactgt caccgggagc aagcaaaaat aacgggaata 960

cgacggttga tttaaaagaa tgtcactgcc cgttactggt ataacgcgaa aaacaaaggc 1020

caaaactttg actgtgacta cgcgccacag ggaatattca gcttcgtctt cacaacgatg 1080

actggagcaa ttatgcacat taaaacaacg aaaaagcggc gattattcca ttttgggttt 1140

tccaatcaaa tacgtaaaat cacattatat catcaaggaa aactgagaac agaacccaat 1200

taa 1203

Claims

1. A bacillus amyloliquefaciens for secreting and expressing neutral protease is characterized in that the strain is bacillus amyloliquefaciens (Bacillus amyloliquefaciens)Bacillus amyloliquefaciens) The GA and EGL of ZD-708 are obtained by knocking out the glucoamylase gene GA and the cellulase gene EGL on the basis of the ZD-708 strain;

the preservation number of the ZD-708 strain is CGMCC NO. 18644;

the nucleotide sequence of the cellulase gene EGL is shown in a sequence table SEQ ID NO. 3.

2. The bacillus amyloliquefaciens for secreting and expressing neutral protease as claimed in claim 1, wherein the nucleotide sequence of the glucoamylase gene GA is shown in sequence table SEQ ID No. 2.

3. The strain of claim 1, bacillus amyloliquefaciens (bacillus amyloliquefaciens)Bacillus amyloliquefaciens) The application of ZD-708 Δ EGL in producing neutral protease.

4. Use according to claim 3, wherein the neutral protease is produced by fermentation by: inoculating the strain into a fermentation culture medium according to the inoculation amount of 5-8%, and culturing at 35-37 ℃ for 80-90h at 200-220 rpm; the enzyme activity of the neutral protease of the supernatant of the fermentation liquor reaches 20200-21930U/ml.

5. The use according to claim 4, wherein the fermentation medium consists of: 32g/L of maltodextrin, 14g/L of corn flour, 12g/L of bean cake powder, 2.3g/L of yeast powder and Na₂HPO₄4.4g/L，KH₂PO₄5.1g/L, calcium carbonate 1%, pH 7.0.