CN108949784B - Application of sporulation-related gene sigmaF in enzyme production - Google Patents

Abstract

The invention relates to application of a sporulation-related gene sigmaF in enzyme production. The invention discloses the effect of a sporulation related gene sigmaF on enzyme production for the first time, and partial gene fragments of the sigmaF and Cm are subjected to insertion inactivation^rGene fusion, fusion gene sigmaF-Cm^rThe sigmaF gene is inserted into a sequence of the sigmaF gene of the bacillus clausii, so that the sigmaF gene cannot be normally expressed and inactivated, the sporulation rate of the sigmaF gene inactivated strain is reduced to 0.6 percent of that of the original strain, and the fermentation activity of the batch fermentation cellulase is improved by about 2.5 times compared with that of the original strain. The engineering strain constructed by the invention improves the fermentation enzyme activity of the cellulase, and is beneficial to genetic breeding and industrial production of bacillus enzyme preparation production strains.

Description

Application of sporulation-related gene sigmaF in enzyme production

Technical Field

The invention relates to an application of a sporulation related gene sigmaF in enzyme production, belonging to the technical field of molecular biology and the field of enzyme engineering.

Background

Bacillus clausii (Bacillus clausii) is a common industrial production strain, and can produce protease, amylase, pectinase, lipase, cellulase and other enzymes in the fermentation production process. Among them, cellulase (β -1, 4-glucan-4-glucan hydrolase) is a generic term for a series of enzymes capable of degrading cellulose to produce cellobiose and glucose, and hydrolyzing a cellulose substance to glucose. Cellulase has wide application in the industries of food, feed, textile, paper making and the like, and in recent years, the cellulase has more attention in the aspects of comprehensive utilization of biomass, clean production of biological energy and the like. In order to obtain high enzyme activity, different molecular biology means are applied to the construction of genetic engineering bacteria so as to further improve the enzyme activity by means of diversity breeding and reduce the scale production cost and the use cost of the enzyme.

Chinese patent document CN106191013A (application No. 201610853941.9) discloses a method for controlling expression of cellulase in bacillus megaterium by temperature and acidity, wherein homologous recombination plasmids are constructed, bacillus megaterium ATCC14581 is transformed to obtain bacillus megaterium engineering bacteria for expressing the cellulase, and the expression of exonuclease or endonuclease of the bacillus megaterium cellulase can be directionally controlled by adjusting the external temperature or acidity. Chinese patent document CN102766615A (application No. 201210256710.1) discloses a method for preparing cellulase using bacillus, which comprises the steps of: the bacillus is taken as a production strain, and the bacillus is obtained by slant culture, shaking culture and fermentation culture, wherein a culture medium for fermentation culture comprises 0.5-2% of starch, 1-5% of bean cake powder, 8-12% of bean cake powder hydrolysate, 0.3-0.8% of bran, 1-2% of inorganic salt and 0-0.3% of defoaming agent by mass, and the cellulase obtained by the method has high activity under neutral and alkaline conditions of pH and is obviously superior to acid cellulase in the aspect of water washing enzyme application. However, the relationship between the sporulation-related gene and the cellulase production has not been reported clearly, and researches show that the sporulation-related gene not only affects the sporulation, but also has a regulating effect on the structure, growth, metabolite production and the like of a strain.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides the application of the sporulation related gene sigmaF in enzyme production, selectively knocks out the sporulation related gene sigmaF, constructs a spore-deficient bacterium, and can effectively improve the enzyme activity of the strain cellulase.

Summary of the invention:

the invention selectively knocks out sporulation related genes sigmaF and uses the sporulation related genes sigmaF and Cm of the Bacillus clausii^rThe fragments are overlapped and connected, and are subjected to enzyme digestion and concentration to transform the bacillus clausii, so that spores form a related gene sigmaF to be inactivated, bacillus clausii spore deletion bacteria is constructed, the cell metabolism is changed, the enzyme activity of the cellulase of the strain is obviously improved, and the enzyme activity of the cellulase is about 3.5 times of that of the original strain.

Detailed description of the invention:

the technical scheme of the invention is as follows:

application of a sporulation related gene sigmaF in enzyme production, wherein the nucleotide sequence of the gene sigmaF is shown as SEQID NO. 1.

According to the invention, the enzyme is preferably produced cellulase, and the enzyme activity of the cellulase is 3-4 times of that of the original strain.

According to a preferred embodiment of the invention, the sporulation-associated gene sigmaF is used for enzyme production, and the steps are as follows:

(1) extracting genome DNA of the Bacillus clausii, and carrying out PCR amplification by taking the genome DNA as a template to obtain a Bacillus clausii spore formation related gene sigmaF, wherein the nucleotide sequence of the gene sigmaF is shown as SEQ ID NO. 1;

(2) using pHT01 plasmid as template, obtaining Cm by PCR amplification^rFragment of Cm^rThe nucleotide sequence of the fragment is shown as SEQID NO. 2;

(3) adopting an overlapping PCR technology to combine the gene sigmaF obtained in the step (1) with the Cm obtained in the step (2)^rFusing the fragments to obtain a fused gene sigmaF-Cm^rThe fusion gene sigmaF-Cm^rThe nucleotide sequence of (A) is shown as SEQ ID NO. 3;

(4) the fusion gene sigmaF-Cm prepared in the step (3) is used for^rAfter enzyme digestion, concentration, transformation of the competent cells of the Bacillus clausii, and screening to obtain positive recombinant bacteria which can be applied to enzyme production.

Preferably, in step (1), the nucleotide sequence of the primer amplified by PCR is as follows, and the underlined BamH I cleavage site:

sigmaF-F：CGCGGATCCATGAGTGCAGAGGTGAAAAACAGCGG，

sigmaF-R：GTGAGCAAAAGGCCAGCAAAATGAGTGGTCGGCAAT；

the PCR amplification system was as follows, with a total volume of 50. mu.L:

2 XHiFi-PCR Master 25. mu.L, upstream primer sigmaF-F2.5. mu.L, downstream primer sigmaF-R2.5. mu.L, Bacillus clausii genomic DNA 2.5. mu.L, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 1min for 15s for 30 cycles; extension was continued for 10min at 72 ℃.

Preferably, in step (2), the nucleotide sequence of the primer amplified by PCR is as follows, and the underlined BamH I cleavage site:

Cm^r-F：CTTGTAGGAACGCTTTTTGCTGGCCTTTTGCTC，

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTGTCGGAATGG；

the PCR amplification system was as follows, with a total volume of 50. mu.L:

2 × HiFi-PCR Master 25 μ L, upstream primer Cm^r2.5. mu.L of-F, the downstream primer Cm^r2.5. mu.L of R, 2.5. mu.L of pHT01 plasmid, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 2min for 45s for 30 cycles; extension was continued for 10min at 72 ℃.

Preferably, in step (3), the nucleotide sequence of the amplification primer for the overlapping PCR is as follows, and the underlined BamHI cleavage site:

sigmaF-F：CGCGGATCCATGAGTGCAGAGGTGAAAAACAGCGG，

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTGTCGGAATGG；

the first round of overlap PCR amplification system was as follows, with a total volume of 25. mu.L:

2 × HiFi-PCR Master 12.5 μ L, Gene sigmaF 2 μ L, Cm^rFragment 2. mu.L, ddH₂O 8.5μL；

The first round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 2min for 40s, 5 cycles; extension was continued for 10min at 72 ℃.

The second round of overlapping PCR amplification system is that the following reagents are added on the basis of the first round of PCR amplification system:

2 XHiFi-PCR Master 12.5. mu.L, upstream primer sigmaF-F1. mu.L, downstream primer Cm^r-R 1μL，ddH₂O10.5μL；

The second round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 4min for 30 cycles; extension was continued for 10min at 72 ℃.

Preferably, in step (4), the reaction system for enzyme digestion is as follows, and the total volume is 40 μ L:

overlapping PCR products 20. mu.L, 10 XKBuffer 4. mu.L, BamHI endonuclease 2. mu.L, ddH₂O 14μL；

The enzyme digestion conditions are as follows: 37 ℃ for 1.5 h.

Preferably, in the step (4), the fused gene sigmaF-Cm is concentrated^rThe concentration of (b) is 300-500 ng/. mu.L.

Preferably, in step (4), the bacillus clausii competent cell is prepared by the following method:

selecting fresh Bacillus clausii single colony, culturing at 37 deg.C and 220r/min to thallus concentration OD₆₀₀And (3) putting the bacillus clausii strain.

Further preferably, the components of the electrotransfer buffer are as follows:

sorbitol with the mass percent of 9.1 percent, mannitol with the mass percent of 9.1 percent, glycerol with the volume percent of 10 percent and the balance of water.

Preferably, in the step (4), the bacillus clausii competent cell is transformed by the following steps:

the fused gene sigmaF-Cm after enzyme digestion and concentration is used^rElectrically transforming the bacillus clausii competent cells, wherein the voltage of the electric transformation is 1500-1800V, the electric shock time is 4-5 ms, and then culturing in a liquid recovery culture medium at 37 ℃ for 3-4 h to obtain the bacillus clausii competent cells.

Further preferably, the components of the liquid recovery culture medium are as follows, and the components are all in percentage by weight:

peptone 1%, yeast extract powder 0.5%, sodium chloride 1%, sorbitol 9%, mannitol 7%, and pH 7.0-7.4.

Preferably, in the step (4), the screening step is as follows:

and (3) coating the transformed bacillus clausii competent cells on an LB (Luo-Beauveria-biosciences) plate containing chloramphenicol, culturing at 37 ℃ for 12-24 h, then carrying out transformant identification through colony PCR (polymerase chain reaction), and screening to obtain positive recombinant bacteria.

Further preferably, the LB plate containing chloramphenicol is LB solid medium with chloramphenicol concentration of 25. mu. mol/mL.

Has the advantages that:

1. the invention discloses the effect of a sporulation related gene sigmaF on enzyme production for the first time, and partial gene fragments of the sigmaF and Cm are subjected to insertion inactivation^rGene fusion, fusion gene sigmaF-Cm^rThe sigmaF gene is inserted into a sequence of the sigmaF gene of the bacillus clausii, so that the sigmaF gene cannot be normally expressed and inactivated, the sporulation rate of the sigmaF gene inactivated strain is reduced to 0.6 percent of that of the original strain, and the fermentation activity of the batch fermentation cellulase is improved by about 2.5 times compared with that of the original strain.

2. The engineering strain constructed by the invention improves the fermentation enzyme activity of the cellulase, and is beneficial to genetic breeding and industrial production of bacillus enzyme preparation production strains.

Drawings

FIG. 1 is an agarose gel electrophoresis image of a Bacillus clausii sigmaF gene fragment of the present invention;

in the figure, lane M is a DNA molecular weight marker (DNAmarker), and lanes 1-2 are sigmaF gene fragment bands with the size of 579 bp.

FIG. 2 shows Cm of the present invention^rAgarose gel electrophoresis of the gene fragment;

in the figure, lane M is the DNA molecular weight marker (DNAmarker), and lanes 1-2 are Cm^rThe size of the gene fragment band is 1260 bp.

FIG. 3 is an agarose gel electrophoresis image of the transformant for the inactivation of the sigmaF gene of Bacillus clausii of the present invention;

in the figure, lane M is a DNA molecular weight marker (DNAmarker), lanes 1-2 are transformant bands, and the size is 1803 bp.

Detailed Description

The technical solution of the present invention is further described with reference to the following examples, but the scope of the present invention is not limited thereto.

The terms used in the present methods, unless otherwise specified, generally have the meanings that are commonly understood by those of ordinary skill in the art.

In the following examples, various procedures and methods not described in detail and well known in the art are conventional methods. The source of the reagents used, the name of the product, and the components necessary to list them, are indicated at the time of their first appearance, and the same reagents used thereafter, unless otherwise specified, are the same as indicated for the first time.

The source of the biological material is as follows:

the Bacillus clausii (Bacillus clausii) in the examples was purchased from the institute of biotechnology, north beijing, and the strain numbers: BNCC160124, a common commercially available strain;

plasmid pHT01 was purchased from Hangzhou Bao Sai Bio Inc.

The LB solid medium comprises the following components in percentage by mass:

peptone 1%, yeast extract 0.5%, sodium chloride 1%, agar 2%, pH 7.0-7.4

The LB culture medium comprises the following components in percentage by mass:

peptone 1%, yeast extract 0.5%, sodium chloride 1%, pH 7.0-7.4

Example 1: construction of the fragment of interest

Extracting the genome DNA of the Bacillus clausii (according to the specification of an Ezup column type bacterial genome DNA extraction kit).

Designing a primer according to the nucleotide sequence of the sigmaF gene, introducing a BamHI enzyme cutting site into an upstream primer, and adding Cm into a downstream primer^rThe 5' -end of the fragment has 21 bases, and the primers are synthesized by Biotechnology engineering (Shanghai) Ltd. 2 XHiFi-PCR Master polymerase of Bao bioengineering GmbH is adopted, and the extracted Bacillus clausii genome DNA is used as a template to amplify the sigmaF gene.

The nucleotide sequence of the primers is shown below, wherein the underlined is the BamHI cleavage site.

sigmaF-F：CGCGGATCCATGAGTGCAGAGGTGAAAAACAGCGG

sigmaF-R：GTGAGCAAAAGGCCAGCAAAATGAGTGGTCGGCAAT；

The PCR amplification system was as follows, with a total volume of 50. mu.L:

2 XHiFi-PCR Master 25. mu.L, upstream primer sigmaF-F2.5. mu.L, downstream primer sigmaF-R2.5. mu.L, Bacillus clausii genomic DNA 2.5. mu.L, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 1min for 15s for 30 cycles; extension was continued for 10min at 72 ℃.

And (3) inspecting the PCR product by agarose gel electrophoresis, wherein the result is shown in figure 1, the length of the target gene sigmaF is 579bp (SEQ ID NO.1), the PCR product sigmaF obtained by amplification is subjected to gel recovery by using a SanPrep column type DNA gel recovery kit, and the obtained DNA solution is stored at-20 ℃ for later use.

(ⅱ)Cm^rObtaining fragments

Using pHT01 plasmid as template, obtaining Cm by PCR amplification^rAnd (3) fragment.

The nucleotide sequence of the PCR amplification primer is as follows, a BamHI enzyme cutting site is introduced into a downstream primer, 15 bases are added into an upstream primer and the 3' end of a gene sigmaF, wherein the underlined is the BamHI enzyme cutting site:

Cm^r-F：ATTGCCGACCACTCATTTTGCTGGCCTTTTGCTCAC

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTGTCGGAATGG；

the PCR amplification system was as follows, with a total volume of 50. mu.L:

2 × HiFi-PCR Master 25 μ L, upstream primer Cm^r2.5. mu.L of-F, the downstream primer Cm^r2.5. mu.L of R, 2.5. mu.L of pHT01 plasmid, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 2min for 45s for 30 cycles; extension was continued for 10min at 72 ℃.

The PCR products were checked by agarose gel electrophoresis, and the results are shown in FIG. 2, Cm^rThe length of the fragment is 1260bp (SEQ ID NO.2), and the PCR product Cm obtained by amplification is^rUse ofThe SanPrep column type DNA gel recovery kit is used for gel recovery, and the obtained DNA solution is stored at the temperature of-20 ℃ for later use.

(iii) comparing the gene sigmaF obtained in step (i) with the Cm obtained in step (ii)^rThe fragments are fused by adopting overlapping PCR to obtain a fusion gene sigmaF-Cm^r。

Wherein, the primer nucleotide sequence of the overlap PCR is as follows, and the underlined BamH I restriction enzyme site:

sigmaF-F：CGCGGATCCATGAGTGCAGAGGTGAAAAACAGCGG

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTGTCGGAATGG

the first round of overlap PCR amplification system was as follows, with a total volume of 25. mu.L:

2 × HiFi-PCR Master 12.5 μ L, Gene sigmaF 2 μ L, Cm^rFragment 2. mu.L, ddH₂O 8.5μL；

The first round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 2min for 40s, 5 cycles; extension was continued for 10min at 72 ℃.

The second round of overlapping PCR amplification system is that the following reagents are added on the basis of the first round of PCR amplification system:

2 XHiFi-PCR Master 12.5. mu.L, upstream primer sigmaF-F1. mu.L, downstream primer Cm^r-R 1μL，ddH₂O10.5μL；

The second round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 4min for 30 cycles; extension was continued for 10min at 72 ℃.

Similarly, agarose gel electrophoresis was performed to examine the PCR product, and the desired gene sigmaF-Cm was detected^rHas a length of 1803bp (SEQ ID NO.3), and a PCR product sigmaF-Cm obtained by amplification^rThe gel was recovered using a SanPrep column DNA gel recovery kit, and the resulting DNA solution was stored at-20 ℃ for further use.

Example 2: preparation of Bacillus Clausilii competent cell

Selecting a single colony of the Bacillus clausii on the surface of a fresh LB solid culture medium, inoculating the single colony of the Bacillus clausii in a 10mLLB culture medium, culturing at 37 ℃ and 220r/min overnight;

(ii) inoculating 2.0mL of the bacterial solution into 50mLGM medium, culturing at 37 deg.C and 220r/min for 4h to OD₆₀₀＝1.0；

(iii) transferring the bacterial liquid to a 50mL centrifuge tube, and carrying out ice bath for 10min to stop the growth of the thalli;

(IV) centrifuging at 4 ℃ for 5min at 5000r/min after ice bath, and collecting thalli;

(V) the centrifuged cells were washed 3 times with a pre-cooled electrotransfer buffer (ETM);

(VI) after the washing, resuspending the cells using 1000. mu.L of an electrotransfer buffer;

(VII) subpackaging the prepared competent cells into 100 mu L/tube, and storing at-80 ℃ for later use.

Wherein, the culture medium GM: LB medium +0.5mol/L sorbitol

Electrotransfer buffer (ETM): sorbitol with the mass percent of 9.1 percent, mannitol with the mass percent of 9.1 percent, glycerol with the volume percent of 10 percent and the balance of water.

Example 3: fusion gene sigmaF-Cm^rElectrotransformation of competent cells of Bacillus clausii

Fusing the gene sigmaF-Cm^rDigesting by using a restriction enzyme BamHI;

the cleavage system (40. mu.L) was as follows:

10 XK Buffer 4. mu.L, BamHI endonuclease 2. mu.L, overlap PCR product 20. mu.L, ddH₂O 14μL；

The enzyme digestion conditions are as follows: 1.5h at 37 ℃;

(ii) concentrating and purifying the digested product

(1) Taking the enzyme digestion product, adding 1/10 volume sodium acetate of 3mol/L and 2.5 volume absolute ethyl alcohol, and placing in a refrigerator at-20 ℃ for 20 min;

(2)12000r/min, centrifuging for 5min to obtain precipitate;

(3) adding 300 mu L of 75 percent (volume percentage) of absolute ethanol solution into the precipitate, and re-suspending the precipitate;

(4)12000r/min, centrifuging for 5min, and air drying at 37 deg.C for 30min to remove ethanol;

(5) add 20. mu.L of ddH₂O resuspend DNA and store at-20 ℃ for use.

(iii) electrotransformation

Firstly, the concentrated fusion gene sigmaF-Cm is measured by a nucleic acid ultramicro spectrophotometer^rAfter the concentration reaches 500 ng/mu L, adding competent cells and a concentrated product into an electric rotating cup, carrying out electric conversion after ice bath for 5min, wherein the electric conversion voltage is 1500V, electric shock is 5ms, recovering and culturing the cells after electric conversion at 37 ℃ for 3-4 h through a liquid recovery culture medium RM, centrifuging for 5min at 4000r/min, suspending and precipitating 100 mu L of supernatant, coating a 25 mu mol/mL chloramphenicol LB plate, culturing at 37 ℃ for 12-24 h, and screening a transformant with chloramphenicol resistance;

the liquid recovery culture medium RM comprises the following components in percentage by weight:

peptone 1%, yeast extract powder 0.5%, sodium chloride 1%, sorbitol 9%, mannitol 7%, and pH 7.0.

Example 4: culture and identification of positive recombinant bacteria

Selecting the transformants with chloramphenicol resistance, inoculating the transformants into a liquid LB culture medium containing chloramphenicol resistance, culturing at 37 ℃ for 12h, repeatedly freezing and thawing the bacterial liquid for 3-4 times, and taking the bacterial liquid as a template, sigmaF-F and Cm^rAnd (4) performing colony PCR amplification by taking the-R as a primer, and verifying an amplification product by using agarose gel electrophoresis.

The PCR primer sequences are as follows, the BamHI restriction sites are underlined:

sigmaF-F：CGCGGATCCCCTTAAAAGCGGAGCCAAAAC

Cmr-R：CGCGGATCCTAGTGACTGGCGATGCTG

the PCR amplification system is 25 mu L:

2 XHiFi-PCR Master 12.5. mu.L, bacterial liquid 2. mu.L, upstream primer sigmaF-F1. mu.L, downstream primer Cm^r-R1μL，ddH₂O 8.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 4min for 25s, 30 cycles; extension was continued for 10min at 72 ℃ and the PCR products were checked by agarose gel electrophoresis, the results of which are shown in FIG. 3.

Example 5: determination of cellulase Activity

(1) Example 4 the strain identified as a positive recombinant bacterium is repeatedly activated for 2 times in LB solid medium containing 25. mu. mol/mL chloramphenicol, and is subjected to static culture at 37 ℃ for 20 h; selecting a single colony in 10mL of liquid LB culture medium, culturing for 12h at 37 ℃ and 200r/min, inoculating the single colony in 100mL of liquid LB culture medium containing 25 mu mol/mL of chloramphenicol in an inoculation amount of 3%, culturing at 37 ℃ and 200r/min, taking fermentation liquor of different culture time, and centrifuging to remove thalli to obtain an enzyme solution to be detected;

(2) the specific method for measuring the enzyme activity of the cellulase comprises the following steps:

drawing a standard curve

Respectively sucking glucose standard use solution, buffer solution and DNS reagent into each standard tube according to the amount specified in the table 1, uniformly mixing 3 parallel samples in each group by using a vortex mixer; putting the standard tubes in a boiling water bath at the same time, reacting for 10min, rapidly cooling to room temperature, metering to 25mL, and mixing; and measuring the absorbance at 540nm and drawing a standard curve.

TABLE 1 glucose Standard Curve

Ii.sample determination

Taking four test tubes, and respectively adding 2mL of CMC-Na (sodium carboxymethylcellulose) solution prepared by buffer solution into the four test tubes; respectively adding 0.5mL of diluted enzyme solution to be detected into three sample tubes, and uniformly mixing by using a vortex mixer; after four test tubes are simultaneously placed at 50 ℃ for incubation for 30min, 3mL of DNS reagent is added into each tube, 0.5mL of diluted enzyme solution to be detected is added into a blank tube, and the tubes are shaken up. Putting the four branch pipes into a boiling water bath at the same time, heating for 10min, rapidly cooling to room temperature, and metering to 25 mL; blank tubes were zeroed for control and absorbance was measured in a 540nm spectrophotometer.

Definition of cellulase activity units: 1mL of liquid enzyme hydrolyzes a sodium carboxymethylcellulose substrate per minute at pH 4.8 and 50 ℃ to generate 1umol of reducing sugar, namely an enzyme activity unit expressed in U/mL.

The enzyme activity unit of the amylase is converted into U/g by measuring the dry weight of the thallus.

Through determination, the sporulation rate of the Bacillus clausii sigmaF deletion strain is 0.6 percent of that of the original strain, and the enzyme activity of the cellulase reaches 23.2 multiplied by 10 after the Bacillus clausii sigmaF deletion strain is fermented for 96 hours³U/g is about 3.5 times of the original strain. The enzyme activity of the bacillus clausii cellulase can be effectively improved by the insertional inactivation of the sporulation related gene sigmaF.

SEQUENCE LISTING

<110> university of Qilu Industrial science

Application of <120> sporulation related gene sigmaF in enzyme production

<160>3

<170>PatentIn version 3.5

<210>1

<211>579

<212>DNA

<213>Bacillus clausii

<400>1

atgagtgcag aggtgaaaaa cagcggcaaa aaaaagccac tatccgataa acaagtgaaa 60

gagcttattg caaaaagcca ggaaggcgac acagaagcac gggattcgat cgtcaaccat 120

aacacacgtc tcgtctggtc agtggttcaa cgttttttga atcgcggtta tgaggcagat 180

gacctttttc aaattggctg cattggttta attaagtctg tcgacaaatt tgacctttcc 240

tacgacgtga aattttccac gtatgctgtg ccgatgatta ttggtgaaat ccaacggttt 300

ctgcgggatg atggcacagt gaaagtaagc cggtccatta aagaattaag caataaaatc 360

cgcaaagcaa aagacgaact gacgaaaacg ctgcgccggg caccgaccat taatgagatc 420

gctgaacatt taggcgtgac gcctgaggaaattgtatttg ctggagatgc caaccggagc 480

ttgtcctcaa tccatgaaac ggtttatgaa aatgacggcg atccgattac acttctagat 540

caaattgccg accactcatt ttgctggcct tttgctcac 579

<210>2

<211>1260

<212>DNA

<213> Artificial sequence

<400>2

attgccgacc actcattttg ctggcctttt gctcacatgt tctttcctgc gttatcccct 60

gattctgtgg ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga 120

acgaccgagc gcagcgagtc agtgagcgag gaagcggaag agcgcccaat acgcatgctt 180

aagttattgg tatgactggt tttaagcgca aaaaaagttg ctttttcgta cctattaatg 240

tatcgtttta gaaaaccgac tgtaaaaagt acagtcggca ttatctcata ttataaaagc 300

cagtcattag gcctatctga caattcctga atagagttca taaacaatcc tgcatgataa 360

ccatcacaaa cagaatgatg tacctgtaaa gatagcggta aatatattga attaccttta 420

ttaatgaatt ttcctgctgt aataatgggt agaaggtaat tactattatt attgatattt 480

aagttaaacc cagtaaatga agtccatgga ataatagaaa gagaaaaagc attttcaggt 540

ataggtgttt tgggaaacaa tttccccgaa ccattatatt tctctacatc agaaaggtat 600

aaatcataaa actctttgaa gtcattcttt acaggagtcc aaataccaga gaatgtttta 660

gatacaccat caaaaattgt ataaagtggc tctaacttat cccaataacc taactctccg 720

tcgctattgt aaccagttct aaaagctgta tttgagttta tcacccttgt cactaagaaa 780

ataaatgcag ggtaaaattt atatccttct tgttttatgt ttcggtataa aacactaata 840

tcaatttctg tggttatact aaaagtcgtt tgttggttca aataatgatt aaatatctct 900

tttctcttcc aattgtctaa atcaatttta ttaaagttca tttgatatgc ctcctaaatt 960

tttatctaaa gtgaatttag gaggcttact tgtctgcttt cttcattaga atcaatcctt 1020

ttttaaaagt caatattact gtaacataaa tatatatttt aaaaatatcc cactttatcc 1080

aattttcgtt tgttgaacta atgggtgctt tagttgaaga ataaaagacc acattaaaaa 1140

atgtggtctt ttgtgttttt ttaaaggatt tgagcgtagc gaaaaatcct tttctttctt 1200

atcttgataa taagggtaac tattgccgat cgtccattcc gacagcatcg ccagtcacta 1260

<210>3

<211>1803

<212>DNA

<213> Artificial sequence

<400>3

atgagtgcag aggtgaaaaa cagcggcaaa aaaaagccac tatccgataa acaagtgaaa 60

gagcttattg caaaaagcca ggaaggcgac acagaagcac gggattcgat cgtcaaccat 120

aacacacgtc tcgtctggtc agtggttcaa cgttttttga atcgcggtta tgaggcagat 180

gacctttttc aaattggctg cattggttta attaagtctg tcgacaaatt tgacctttcc 240

tacgacgtga aattttccac gtatgctgtg ccgatgatta ttggtgaaat ccaacggttt 300

ctgcgggatg atggcacagt gaaagtaagc cggtccatta aagaattaag caataaaatc 360

cgcaaagcaa aagacgaact gacgaaaacg ctgcgccggg caccgaccat taatgagatc 420

gctgaacatt taggcgtgac gcctgaggaa attgtatttg ctggagatgc caaccggagc 480

ttgtcctcaa tccatgaaac ggtttatgaa aatgacggcg atccgattac acttctagat 540

caaattgccg accactcatt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc 600

cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc 660

cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aagagcgccc aatacgcatg 720

cttaagttat tggtatgact ggttttaagc gcaaaaaaag ttgctttttc gtacctatta 780

atgtatcgtt ttagaaaacc gactgtaaaa agtacagtcg gcattatctc atattataaa 840

agccagtcat taggcctatc tgacaattcc tgaatagagt tcataaacaa tcctgcatga 900

taaccatcac aaacagaatg atgtacctgt aaagatagcg gtaaatatat tgaattacct 960

ttattaatga attttcctgc tgtaataatg ggtagaaggt aattactatt attattgata 1020

tttaagttaa acccagtaaa tgaagtccat ggaataatag aaagagaaaa agcattttca 1080

ggtataggtg ttttgggaaa caatttcccc gaaccattat atttctctac atcagaaagg 1140

tataaatcat aaaactcttt gaagtcattc tttacaggag tccaaatacc agagaatgtt 1200

ttagatacac catcaaaaat tgtataaagt ggctctaact tatcccaata acctaactct 1260

ccgtcgctat tgtaaccagt tctaaaagct gtatttgagt ttatcaccct tgtcactaag 1320

aaaataaatg cagggtaaaa tttatatcct tcttgtttta tgtttcggta taaaacacta 1380

atatcaattt ctgtggttat actaaaagtc gtttgttggt tcaaataatg attaaatatc 1440

tcttttctct tccaattgtc taaatcaatt ttattaaagt tcatttgata tgcctcctaa 1500

atttttatct aaagtgaatt taggaggctt acttgtctgc tttcttcatt agaatcaatc 1560

cttttttaaa agtcaatatt actgtaacat aaatatatat tttaaaaata tcccacttta 1620

tccaattttc gtttgttgaa ctaatgggtg ctttagttga agaataaaag accacattaa 1680

aaaatgtggt cttttgtgtt tttttaaagg atttgagcgt agcgaaaaat ccttttcttt 1740

cttatcttga taataagggt aactattgcc gatcgtccat tccgacagca tcgccagtca 1800

cta 1803

Claims (8)

1. The application of the sporulation related gene sigmaF in enzyme production is characterized by comprising the following steps:

(1) extracting genome DNA of the Bacillus clausii, and carrying out PCR amplification by taking the genome DNA as a template to obtain a Bacillus clausii spore formation related gene sigmaF, wherein the nucleotide sequence of the gene sigmaF is shown as SEQ ID NO. 1;

(2) using pHT01 plasmid as template, obtaining Cm by PCR amplification^rFragment of Cm^rThe nucleotide sequence of the fragment is shown as SEQ ID NO. 2;

(3) adopting an overlapping PCR technology to combine the gene sigmaF obtained in the step (1) with the Cm obtained in the step (2)^rFusing the fragments to obtain a fused gene sigmaF-Cm^rThe fusion gene sigmaF-Cm^rThe nucleotide sequence of (A) is shown as SEQ ID NO. 3;

(4) the fusion gene sigmaF-Cm prepared in the step (3) is used for^rAfter enzyme digestion, concentrating, transforming the competent cells of the Bacillus clausii, and screening to obtain positive recombinant bacteria which can be applied to enzyme production; the concentrated fusion gene sigmaF-Cm^rThe concentration of (a) is 300-500 ng/muL;

the enzyme production is cellulase, and the enzyme activity of the cellulase is 3-4 times of that of the original strain.

2. The use according to claim 1, wherein in step (1), the nucleotide sequence of the primers amplified by PCR is as follows, and the BamHI cleavage sites are underlined:

sigmaF-F：CGCGGATCCATGAGTGCAGAGGTGAAAAACAGCGG，

sigmaF-R：GTGAGCAAAAGGCCAGCAAAATGAGTGGTCGGCAAT；

the PCR amplification system was as follows, with a total volume of 50. mu.L:

2 XHiFi-PCR Master 25. mu.L, upstream primer sigmaF-F2.5. mu.L, downstream primer sigmaF-R2.5. mu.L, Bacillus clausii genomic DNA 2.5. mu.L, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 1min for 15s for 30 cycles; extension was continued for 10min at 72 ℃.

3. The use according to claim 1, wherein in step (2), the nucleotide sequence of the primers amplified by PCR is as follows, and the BamHI cleavage sites are underlined:

Cm^r-F：CTTGTAGGAACGCTTTTTGCTGGCCTTTTGCTC，

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTGTCGGAATGG；

the PCR amplification system was as follows, with a total volume of 50. mu.L:

2 × HiFi-PCR Master 25 μ L, upstream primer Cm^r2.5. mu.L of-F, the downstream primer Cm^r2.5. mu.L of R, 2.5. mu.L of pHT01 plasmid, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 2min for 45s for 30 cycles; extension was continued for 10min at 72 ℃.

4. The use according to claim 1, wherein in step (3), the nucleotide sequences of the amplification primers of the overlapping PCR are as follows, with the BamHI cleavage sites underlined:

sigmaF-F：CGCGGATCCATGAGTGCAGAGGTGAAAAACAGCGG，

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTGTCGGAATGG；

the first round of overlap PCR amplification system was as follows, with a total volume of 25. mu.L:

2 × HiFi-PCR Master 12.5 μ L, Gene sigmaF 2 μ L, Cm^rFragment 2. mu.L, ddH₂O 8.5μL；

The first round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 2min for 40s, 5 cycles; continuing to extend for 10min at 72 ℃;

the second round of overlapping PCR amplification system is that the following reagents are added on the basis of the first round of PCR amplification system:

2 XHiFi-PCR Master 12.5. mu.L, upstream primer sigmaF-F1. mu.L, downstream primer Cm^r-R 1μL，ddH₂O10.5μL；

The second round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 4min for 30 cycles; extension was continued for 10min at 72 ℃.

5. The use of claim 1, wherein in step (4), the reaction system of the enzyme digestion is as follows, and the total volume is 40 μ L:

overlapping PCR products 20. mu.L, 10 XK Buffer 4. mu.L, BamHI endonuclease 2. mu.L, ddH₂O 14μL；

The enzyme digestion conditions are as follows: 37 ℃ for 1.5 h.

6. The use of claim 1, wherein in step (4), said bacillus thioninus competent cells are prepared by:

selecting fresh Bacillus clausii single colony, culturing at 37 deg.C and 220r/min to thallus concentration OD₆₀₀Putting the bacillus clausii strain;

wherein the components of the electrotransfer buffer solution are as follows:

sorbitol with the mass percent of 9.1 percent, mannitol with the mass percent of 9.1 percent, glycerol with the volume percent of 10 percent and the balance of water.

7. The use of claim 1, wherein in step (4), said transformed c.

The fused gene sigmaF-Cm after enzyme digestion and concentration is used^rElectrically transforming the bacillus clausii competent cells, wherein the voltage of the electric transformation is 1500-1800V, the electric shock time is 4-5 ms, and then culturing in a liquid recovery culture medium at 37 ℃ for 3-4 h to obtain the bacillus clausii competent cells;

the liquid recovery culture medium comprises the following components in percentage by weight:

peptone 1%, yeast extract powder 0.5%, sodium chloride 1%, sorbitol 9%, mannitol 7%, and pH 7.0-7.4.

8. The use of claim 1, wherein in step (4), the screening step is as follows:

coating the transformed bacillus clausii competent cells on an LB (Luo-Beauveria-biosciences) flat plate containing chloramphenicol, culturing at 37 ℃ for 12-24 h, then carrying out transformant identification through colony PCR (polymerase chain reaction), and screening to obtain positive recombinant bacteria;

wherein the LB plate containing chloramphenicol is LB solid medium with chloramphenicol concentration of 25 mu mol/mL.

Images