CN1190434A

CN1190434A - Production of proteins using bacillus incapable of sporulation

Info

Publication number: CN1190434A
Application number: CN96195350A
Authority: CN
Inventors: F·G·普里斯特; A·B·弗莱明格; M·坦格尼; P·L·约吉恩森; B·迪德里克森
Original assignee: Novo Nordisk AS
Current assignee: Novo Nordisk AS
Priority date: 1995-07-07
Filing date: 1996-07-04
Publication date: 1998-08-12
Also published as: EP0837925A1; AU6353896A; JPH11509096A; WO1997003185A1

Abstract

The invention provides a method of obtaining bacteria of the genus Bacillus other than B. subtilis incapable of sporulation by using information from B. subtilis to mutate a parent strain to be truly asporogenous. Such strains are used for the production of useful metabolites, specifically polypeptides, such as enzymes.

Description

Produce method of protein with the genus bacillus that can not form gemma

Invention field

The present invention relates to a kind of by use the bacterium sported the bacillus that can not form gemma produce multiple product (especially producing the transhipment polypeptide) method, be used for producing the method for above-mentioned bacterium and in the employed DNA construct of aforesaid method.

Background of invention

Be used for many peptide species of medicine and multiple industry and the bacterium that protein is just using bacillus in production.

For instance, Bacillus licheniformis just is widely used in that to produce as the industrial enzymes of amylase and proteolytic enzyme and so on and it be a kind of welcome host at industrial preparation cloned genes product (1,2,3) aspect.The annual extracellular enzyme of from this organism, producing the hundreds of ton, this just causes disposing a lot of tons the surplus organism of usefulness, and these organisms are usually all as compost.

From the angle of environment, when being distributed to these materials in the soil, importantly this material should be dead.This usually can be by realizing with chemical substance, radioactive substance and/or thermal treatment mud.

Although most production bacterial strain is Sp ^-, but in the process of random mutation experiment, generally all introduced the damage that causes this phenotype and the function and the effect of this damage is unknown.Therefore, in the depleted biological substance, exist the sterilising conditions that possibility can be very high and harsher, more expensive by needs and environment more should not be accepted of low-level gemma to guarantee to eradicate the complicacy that gemma has increased sterilization process.

In addition, the manage production foundation of stricter legal system of bacterial strain make to be used a kind of very limited gemma form mutant to meet the requirements very much.Such mutant preferably should be:

(i) aspect the gemma formation be complete defective;

(ii) complete stability and can not revert to the formation gemma, and

(iii) be similar to aspect synthetic and the secretion extracellular enzyme or surpassing parent.

At present, the genetics that gemma forms in the subtilis is in advanced stage (4,5) and from the gemma of the Bacillus licheniformis that clearly characterized form gene (17,6,7), as if if the development pathway difference, the close relative of so this subtilis may follow similar development pathway.

Viewed first morphologic being changed at II synthesized asymmetric barrier film in the stage in the gemma forming process.The littler offspring who is swallowed up by mother cell has produced forespore the most at last.Expression of gene part in mother cell and grown spore can be subjected to the synthetic in order and activated control of a succession of Sigma Factors, wherein Sigma Factors is transcribed gemma formed with instantaneous and stereospecific mode guide RNA polysaccharase and is had specific promotor (4,5).

The product σ of spoIIAC gene ^FAlbumen (8,9) is a kind of be present in the Pre-splitter cell but its activity then is limited to forespore and the Sigma Factors of active just become obvious (14) after separation only.It is vital (10) that this Sigma Factors has specific genetic expression for foundation to compartment, and if do not have this Sigma Factors, will stop a large amount of expression of gene in growing gemma.σ ^FA main function for activating forespore is had specific Sigma Factors σ ^GExpression, σ wherein ^GDetermining expression of gene (11) in growing gemma.In addition, former-σ ^EBe processed into the σ that is determining genetic expression in the mother cell ^EAlso can be subjected to the blocking-up (11) of the nonsense mutation among the spoIIAC.Completely destroy and obstruction that the disappearance of spoIIAC gene may cause growing in the gemma depend on σ ^EThe growth of mother cell.

At these reasons and because former research has shown that the spoIIAC sudden change is very little by (15 to the synthetic influence of extracellular enzyme in subtilis, 16), so the inventor selects the spoIIAC sudden change as the target that lacks in the Bacillus licheniformis.

The invention summary

The invention provides a kind of method that is used to produce the transhipment polypeptide, this method comprises

I) the DNA construct of the polypeptide relevant that help encoding with the production of said metabolite express and the condition of said metabolite production under cultivate because sudden change and can not form the bacterium of the bacillus of gemma, said bacterium comprises said DNA construct, and

Ii) reclaim said metabolite, its prerequisite is that said bacterium does not belong to subtilis.

The present invention also provides host bacteria and a kind of method that is used to produce above-mentioned host that can not form the bacillus of gemma owing to suddenly change.

This method to be so that the information that provides from subtilis to be provided, thereby feasiblely can lack or the more a plurality of gene that relates in the gemma forming process.

Adopt splicing in the external disappearance for preparing the spoIIAC gene by the overlap elongation technology.In a thermally sensitive plasmid, this gene is introduced in the Bacillus licheniformis, and after from karyomit(e), integrating and excising, prepared a kind of chromogene of accurate positioning deficiency.

The bacterium of sudden change do not have spore fully and formed it is characterized in that cell extremely on have spore cell on the two spore loads of asymmetric membranous miscarriage.The above-mentioned bacterium of qualitative dull and stereotyped test shows is synthetic

The DNA enzyme of normal level, polygalacturonic acid lyase, proteolytic enzyme, RNA enzyme and zytase still owing to the activity of beta-1,3-glucanase and carboxymethylcelluloenzyme enzyme, are therefore compared with the parent bacterial strain and reduced hydrolysis area in mutant.

In prolongation is incubated to 72 hours process, be identical the synthetic of batch culture neutral and alkali proteolytic enzyme of mutant and parent, but because the productive rate of mutant alpha-amylase has descended about 30%.

In the middle of this research, we point out to use in Bacillus licheniformis, and reorganization prepares the genetically deficient that is limited in the body, and the disappearance of spoIIAC produced a kind of aspect gemma formation the bacterial strain of complete and stable defective, this bacterial strain is still keeping the normal synthetic of serine protease and is reducing a little to some extent on amylase is synthetic.

The present invention is an example with the Bacillus licheniformis, but it is contemplated that in such as other genus bacillus such as slow genus bacillus, bacillus amyloliquefaciens, bacillus thuringiensis, Alkaliphilic bacillus, goldbeater's skin genus bacillus and also can use the present invention.

Form and brief description of the drawings

Table I represents to carry the excision frequency of the allelic pE194ts of disappearance spoIIAC of Bacillus licheniformis.

Fig. 1 represents the splicing undertaken by the overlap extension of creating disappearance in spoIIA.

A. the details of employed primer (accompanying drawing is represented primer A, B, C, the position of the Nucleotide of the 3-end of D).

B. the sequence of the spoIIAC gene that obtains by sequence that measure to use the PCR product that primer A and D produce from the bacterial strain DN286 spoIIACD3 of disappearance.

Fig. 2 represents to cause integration and the excision reaction that produces disappearance in spoIIAC.

Fig. 3 represents a kind of thin section of the typical cells from spoIIAC deletion mutant culture, and this mutant demonstrates the phenotype (lines=3mm) of the spore on the two spore loads of miscarriage property.

Fig. 4 is illustrated in the growth among Bacillus licheniformis DN286 and the DN286 spoIIACD3, and gemma forms and extracellular enzyme synthetic.

A and B; Respectively in minimum medium and brain heart infusion, the growth (●) of the growth of bacterial strain DN286 (■) and spore () and DN286 spoIIACD3.

C and D, respectively in minimum medium and brain heart infusion, the serine protease that is undertaken by bacterial strain DN286 (■) synthetic and by bacterial strain DN286 spoIIACD3 (●) carry out synthetic.

E, minimum medium (, zero) and brain heart infusion (■, ●) in, that carries out in bacterial strain DN286 () and DN286 spoIIACD3 (zero) is diastatic synthetic.

Detailed Description Of The Invention

As already pointed out, the invention provides a kind of method for the production of the transhipment polypeptide, the method comprises

I) the DNA construct of the polypeptide relevant with said metabolism the production of material that be conducive to encode express and the condition of said production of metabolites under, cultivate the bacterium that can not form the bacillus of gemma owing to suddenly change, said bacterium comprises said DNA construct, and

Ii) reclaim said metabolin, its prerequisite is that said bacterium does not belong to bacillus subtilis.

According to the present invention, above-mentioned bacterium preferably belongs to the group that comprises that Bacillus licheniformis, slow bacillus, bacillus amyloliquefaciens, bacillus thuringiensis etc. are planted.

Method of the present invention is illustrational by its bacillus that can not form gemma is come, but is also included within the middle of the present invention such as so any other the sudden change that effectively destroys the sporulation process in irreversible mode of Spo-2 sudden change and Spo-3 sudden change.

As mentioned above, method of the present invention should preferably be used the wherein said bacterium that sports irreversible sudden change.

Estimate that method of the present invention is mainly for the production of any polypeptide, wherein especially transport polypeptide.

For above-mentioned bacterium, said polypeptide can be endogenous or ectogenic, this means that aforementioned polypeptides is respectively that other organism produces by himself or by some at first.

But it is contemplated that also sporulation deficient strain of the present invention can be for the production of secondary metabolites.

The product that obtains from method of the present invention is preferably enzyme, especially industrial enzymes such as protease, lipase, cellulase, oxidoreducing enzyme, amylase.

Other product that can produce by method of the present invention is medicinal enzyme.

Term " transhipment polypeptide " desire refers to carried a signal sequence that can make it stride across the cytolemma transportation by polypeptide expressed.More particularly, the transhipment polypeptide can be a kind of secrete polypeptide or a kind of polypeptide that relates to the secretory mechanism of above-mentioned bacillus cell.

The method that the present invention also provides a kind of production to belong to the bacterium of bacillus, wherein above-mentioned bacterium is owing to can not form gemma by the sudden change that has partly or completely lacked one or more gene that relates to the gemma forming process.

Have specific sudden change for producing in subtilis and other gram positive bacterium (10,24,25), gene integration and excision are a kind of methods commonly used.Herein, we point out that for to for introducing the sudden change that is limited in the karyomit(e) of other genus bacillus the Bacillus licheniformis, this method also is a kind of effective means.

Suppose to be close relative (26) between subtilis and Bacillus licheniformis, people just use allogenic allelotrope that gene is introduced chromosomal possibility to check and have produced interest so.According to the present invention, just may in other genus bacillus such as Bacillus licheniformis, use a large amount of genes that checked order to carry out the genome operation in the above described manner from subtilis.Although the frequency of integrating is lower than the frequency of homology reaction, but homology still is enough to make the spoIIAC allelotrope of Bacillus licheniformis to be incorporated on the karyomit(e) of subtilis, and, may occur on the correct site so estimate to integrate because these intasomies are asporous.

But, be bound to excision take place and can not get disappearance the subtilis host by being arranged in second site reorganization phenomenon of integrating the exchange spot place.Estimation high homology in this zone may have been introduced the focus of a reorganization, and all as a result filial generations (having checked at least 2000 from several intasomies) have all kept an intact spoIIAC gene.

As if opposite condition may be suitable for Bacillus licheniformis; And the gene that is forced into the chromosomal subtilis of Bacillus licheniformis can excise exactly.

Suppose that subtilis and Bacillus licheniformis following similarly development pathway, the effect of spoIIAC disappearance in the Bacillus licheniformis can be discussed according to the model of subtilis so.Really, Bacillus licheniformis DN286 spoIIACD3 differentiation becomes the spore cell on the two spore loads of the miscarriage of seeing (4) in a kind of spoIIAC mutant that extremely is similar to subtilis, and this has supported above-mentioned hypothesis fully.

Usually synthesize extracellular enzyme (in 27, looking back) in stationary phase morning before the stage in the late period of exponential growth and at the II that forms gemma.Therefore can estimate the minimum or not influence of expression influence of the sudden change reply said gene of spoIIAC, and except pondered-over beta-glucanase, dull and stereotyped test discloses the extracellular enzyme productive rate of comparing in the mutant with the parent bacterial strain does not have overall variation really.

Before being completed into, barrier film will in the spoIIA cell, express the gene of being expressed.This comprises the gene in all genes that were in for 0 stage and some II stages and such as abrB, hpr, the regulatory gene of sen and sin and so on (12).Affect and wherein exist 9 kinds of great majority that independently aprE expresses in the subtilis of gene or system or all control (12) to present the phenomenon of stationary phase early at least and may in the spoIIAC mutant, play a role effectively.It follows serine protease synthetic pattern and as the productive rate of enzyme in mutant and conforming to of parent seen in Fig. 4.Really, people (13) such as Arbidge uses a kind of asporous mutant that does not limit to report serine protease synthetic similar results in subtilis.

The domination of regulatory gene is less than aprE far away in the suffered subtilis of the expression of amyE.Although sen (28) and pai (29) also relate to the control to gene, the inhibition of catabolite and DegSU system are the main Controlling System of this gene (12).And the diastatic synthetic reason that is subjected to spoIIAC sudden change influence is not conspicuous.

The early stage Sigma Factors σ that forms gemma ^HMay accumulate in the spoIIAC mutant, this is because stoped σ ^FAnd σ ^ESynthetic; The former be because the disappearance, and the latter be since from precursor former-σ ^EActive σ ^EProduction depend on σ ^F(11).

Really evidence suggests σ in the spoIIA mutant ^HAccumulation increase (Errington, J to some extent; The personal comminication).Therefore, the decline of α-Dian Fenmei productive rate may be because E-σ ^APart is by E-σ ^HReplace institute extremely.

A main purpose of the present invention is to provide a kind of bacterium that is suitable for industrial enzymes production purpose.Mutant described herein does not have spore and gemma formation fully under laboratory condition molecular biology is indicating that the said mutation body can not generate statospore.Across almost the possibility of the reverse mutation of the disappearance of 400bp is minimum and do not have evidence to show that inhibition can bring problem.At last, above-mentioned bacterium for example is being equal to its parent aspect the basic protein enzymic synthesis.Material and method bacterial strain and growth conditions

DN286 is a kind of wild type strain of Bacillus licheniformis.

Bacillus licheniformis NCIMB6346 can obtain from NCIMB.

Subtilis 168 is to locate to obtain from D.A.Smith (University of Birmingham, Britain).

Use intestinal bacteria JM83 to make up all plasmids.

Use Luria meat soup and Luria bouillon agar (16) routinely, and adopt suitable microbiotic to select: penbritin (100mg/ml) and erythromycin (1mg/ml).Also use the basic salt culture medium of Spizizen (16), the Schaefer gemma forms substratum (16) and brain heart infusion (BHI) meat soup (Oxoid).Unless state in addition, all at 37 ℃ of following incubations.Plasmid

Use plasmid pUC19 in intestinal bacteria JM83, to clone.

Coming the complete spoIIA operon of clone's Bacillus licheniformis among the comfortable pUC13 (17) is to be provided by M.Yudkin (Oxford University, Britain), and

To temperature sensitive, it is the present from P.Youngman (University of Georgia, Athens, Ga, the U.S.) to the mutant pE194ts of pE194 in duplicating.The DNA operation

Most methods is all according to people's such as Sambrook (18) method or just described these methods (21) in the past.From sepharose, excise DNA and before ligation, use gene-removing II test kit (biological 101 companies) to carry out purifying.Adopt ABI 373A dna sequencing instrument, the dna sequencing of PCR product is undertaken by the automated DNA sequencing device that provides by molecular medicine system of Kings institute of London university.Sequencing primer SEQ ID NO.1:

5 '-CGATCATGGAAAATTTCATGGATG-3 ' is complementary to the zone of about 100 bases that are positioned at designed reorganization joint upstream, and joint wherein is corresponding to the 943rd to the 966th base of sequence openly.Enzymatic determination

The qualitative test of enzyme secretion is based on former described dull and stereotyped detection method (22).

In culture supernatant, use azo-casein to measure Sumizyme MP as substrate.37 ℃ of following balance buffer solution of potassium phosphate (50mM, pH9.0,1ml) and culture supernatant (1.0 ml) 3 minutes and come initiation reaction by the azo-casein solution that in phosphate buffer solution, adds 0.5ml 0.8%.In the suitable time period, with the reaction mixture of the ice-cold 20%TCA of 0.5ml precipitation 0.5ml, centrifugal this mixture is also measured the light absorption value of supernatant liquor under 405nm.Activity is represented in variation with the light absorption value of every milliliter of supernatant liquor of per minute.

Under 37 ℃, use Phadebas amylase substrate (Pharmacia) is measured amylase and is used the typical curve of the diastatic dilution foundation of being measured by Phacebas and Nelson-Somogyi reducing sugar test that it is converted into the release of the reducing sugar (maltose) from soluble starch in culture supernatant.Unit is maltose equivalent/min/ml supernatant liquor that mM discharges.All batch culture are carried out twice at least; The accompanying drawing that is provided is the representative that The above results can repeat form.Electron microscopy

Cell washed cell in centrifugal collection and the 10mM Tris buffered soln that contains 50mM NaCl of in containing 0.5% the minimum medium of maltose, growing as carbon source at pH8.Redye with lead citrate to cell dyeing and according to Robards and Wilson (23) with aqueous uranyl acetate (4%, 2 hour).Under Jeol 100S transmission microscopy, observe thin section.

The preparation of EXAMPLE Example 1spoIIAC disappearance

Used splicing (19) by overlapping extension (SOE) reaction.Using primer A (SEQID NO.2):

5 '-GCGGCGAATTCAGCTTGACCCGACGATGGATGAACTG-3 ' and primer B (SEQ ID NO.3):

5 '-reaction of CACGACCTCTTCTGAACTGAAGTTCTTTCACTTCATGGTCTTTAAGCTG-3 ' in amplification spoIIAC gene the promotor proximal region and using primer C (SEQ IDNO.4):

5 '-GACCATGAAGTGAAAGAACTTCAGTTCAGAAGAGGTCGTGATGGCC-3 ' and primer D (SEQ ID NO.5):

5 '-GCGGCGGATCCTGCCTGCAACATGAGCAGCCTCAGC-3 ' (Fig.1). independent reaction in the promotor distal region of amplification spoIIAC gene.The sequence that has underscore in primer A and D is represented EcoRI and BamHI site respectively.This reaction mixture comprises the template DNA (clone's of Bacillus licheniformis spoIIA operon) of 200ng, every kind of primer of 100pmol, and ultimate density is every kind of dNTP of 125mM, the MgCl of 6ml ₂(25mM), the Taq buffered soln of 10ml (* 10) and aseptic Millipore water (to 100ml).

The program of amplification is made up of the initial cycles of carrying out sex change in 10 minutes in Taq polysaccharase (Promega) back that adds 1 unit under 95 ℃, and covers this reaction mixture with the light mineral oil of 100ml.Subsequently 95 ℃ of following sex change 2 minutes, 55 ℃ of down annealing 2 minutes totally 35 circulations and extended 3 minutes down at 72 ℃.The extension step of 95 ℃/2 minutes, 55 ℃/2 minutes other circulation and 72 ℃/6 minutes has been finished this program.

Concentrate the PCR product of above-mentioned 464bp and 382bp by ethanol sedimentation, adopt gene-removing test kit to carry out purifying, and in SOE reaction (condition with top identical) above-mentioned product with primer A and D as template (getting 300ng for every kind), thereby the spoIIAC that has generated 806 base pairs that comprise Segment A D lacks (Fig. 1).Embodiment 2 introduces disappearance in Bacillus licheniformis and subtilis

Respectively Segment A D is cloned among the pUC19 by BamHI and the EcoRI restriction site that is included among primer A and the D, above-mentioned fragment is transformed among the intestinal bacteria JM83 and contains and carry the bacterium colony that inserts segmental plasmid containing on the LB penbritin flat board of 40mg/mlX-semi-lactosi (gal) screening.

After the recombinant plasmid of handling with calf intestinal alkaline phosphatase from a clone, above-mentioned recombinant plasmid is connected on the pE194ts by PstI site unique in each replicon.The mixture of ligation is transformed among the intestinal bacteria JM83 and the agarose gel electrophoresis by preparation in a small amount detects this recombinant chou.Use then from the plasmid of intestinal bacteria preparation and transform the protoplastis of Bacillus licheniformis DN286 (10) and the competent cell of subtilis 168 (20,7).

Under 28 ℃, contain at 50ml and to cultivate in the LB meat soup of erythromycin that to contain with pE194 be that the allelic Bacillus licheniformis of spoIIAC and the subtilis of basis disappearance spends the night.The soft agar that contains erythromycin with 3ml dilutes and biased sample, is coated in it on LB agar Em flat board and incubation under 28 ℃ (allowing to duplicate) and 40 ℃ (not allowing to duplicate).The frequency of integrating is the colony counts of the growing ratio with those colony counts of growing under unallowed temperature under the temperature that allows.Carrying out routine subsequently at the intasome of separating under 40 ℃ under 37 ℃ cultivates.

The excision of integrated plasmid be by under 30 ℃, cultivate cell in the LB meat soup that do not having microbiotic to select and realize.The sample of dilution is layered on the LB agar and under 37 ℃ and is incubated overnight, inoculate above-mentioned bacterium colony at the LB agar upper flat plate that contains erythromycin and do not conform to erythromycin.Sum and Em with bacterium colony ^rThe frequency of recently measuring excision of the number of bacterium colony.Disappearance among the embodiment 3 preparation spoIIAC

Disappearance in the spoIIAC of Bacillus licheniformis gene is extended (SOE) technology by overlap and is used splicing to prepare.Use has realized two kinds of independently pcr amplifications at the primer described in material and the method from clone's spoIIA operon.A kind of product (AB) comprises the distal end of downstream gene (spoIIAB) and the proximal region of spoIIAC gene.Second product (CD) has covered the part of distal region and the upstream non-coding region of spoIIAC.Use has the vast zone (overlap) of homology and causes the 3rd pcr amplification that comprises product A B and CD and inserted primer A and D in primer B and C.So obtained a terminal fragment (Segment A D sees Fig. 1) that contains the spoIIAC gene that comprises the 372bp disappearance.

Segment A D is cloned among the pUC19 and by PstI site unique in each replicon is connected on the pE194ts, be transformed into colibacillary shuttle plasmid pHWM2 (Fig. 2) thereby generated.Use then from the plasmid of intestinal bacteria preparation and transform the protoplastis of Bacillus licheniformis DN286 and the competent cell of subtilis 168.Confirmed all to contain pHWM2 and use above-mentioned clone can integrate and excise research by restriction endonuclease analysis from the clone of every kind of conversion.The allelic integration of spoIIAC and the excision of embodiment 4 disappearances

28 ℃ of cells of cultivating down the Bacillus licheniformis that contains pHWM2 and subtilis spend the night and with its plating on selectivity (containing Em) and nonselective substratum, at 45 ℃ of following incubations.The integrating frequency of Bacillus licheniformis is approximately 10 ^-4, and the integrating frequency of subtilis (allelotrope that contains Bacillus licheniformis) will hang down 100 times (table 1), integrating frequency wherein is calculating in the ratio of the cell of growing on the erythromycin flat board under 45 ℃.When after activating rolling-circle replication through cultivation under 28 ℃ in integrated plasmid, when the plasmid excision of several intasomies was measured, the frequency of Bacillus licheniformis was 10 ^-2With 10 ^-3Between.Table I is carried the excision frequency of the allelic pE194ts of disappearance spoIIAC of Bacillus licheniformis

Organism	Intasome	The hypertrophy stage (hour)	Test clone's number	The excision frequency	?Spo ^-Bacterium colony
Organism	Intasome	The hypertrophy stage (hour)	Test clone's number	The excision frequency	?Spo ^-Bacterium colony	Bacillus licheniformis	????1	????24	????150	??9×10 ^-2	????0
	????2	????24	????100	??2×10 ^-2	????0	Bacillus licheniformis	????1	????24	????150	??9×10 ^-2	????0
	????2	????24	????100	??2×10 ^-2	????0		????3	????24	????150	??6×10 ^-2	????44
	????4	????24	????150	??7×10 ^-2	????20		????3	????24	????150	??6×10 ^-2	????44
	????4	????24	????150	??7×10 ^-2	????20		????5	????24	????150	??5×10 ^-2	????25
Subtilis	????1	????24	????560	??1×10 ^-1	????0		????5	????24	????150	??5×10 ^-2	????25
Subtilis	????1	????24	????560	??1×10 ^-1	????0			????48	????114	??2×10 ^-1	????0
	????2	????24	????358	??1×10 ^-1	????0			????48	????114	??2×10 ^-1	????0
	????2	????24	????358	??1×10 ^-1	????0			????48	????152	??2×10 ^-1	????0
	????3	????24	????442	??2×10 ^-1	????0			????48	????152	??2×10 ^-1	????0
	????3	????24	????442	??2×10 ^-1	????0			????48	????184	??3×10 ^-1	????0

In two clones (intasome 1 and 2), excision is bound to by integration site and has reclaimed the Spo of wild-type ⁺Filial generation.But for other three clones, excision has also caused at Em by the phenomenon (see figure 2) of second site reorganization ^sThe disappearance of spoIIAC gene in the derivative.Interesting is, it is very unsettled inserting in subtilis, but is bound to excise at the place, insertion point, even still reclaims less than Spo after prolongation hypertrophy stage to 48 hour ^-Filial generation (Table I).The feature of embodiment 5 Bacillus licheniformis DN286 spoIIACD3 is determined

Selection is further studied from the deletion mycopremna of Bacillus licheniformis intasome 3 (table 1).Hybridize to from wild-type and on the chromosomal DNA with the Southern trace of the deletion mycopremna of EcoRI cutting from the spoIIA operon of the mark of Bacillus licheniformis, this shows with the 4.2kb fragment (data not shown) in the parent compares, and the littler hybridized fragment of a 3.8kb is arranged in mutant.The pcr amplification that uses primer A and D to carry out from the chromosomal DNA of mutant and parent bacterial strain shows that mutant has the disappearance of an about 370bp.When the sequence measured from the PCR product of this mutant, show that a disappearance (Figure 1B) has accurately been located at the tie point place between primer B and C.The morphology checking of spoIIA sudden change is provided by electron microscopy.Can see significantly and represent two the asymmetric barrier films (Fig. 3) of subtilis spoIIAC mutant in " spores on the two spore loads of miscarriage property " cell.

Above-mentioned disappearance has generated complete asporous culture, is what to detect less than spore in this culture.Growth is after 72 hours in BHI, minimum medium (Fig. 4) and Schaeffer gemma formation substratum (data not shown), and the frequency of the gemma of parent formation is approximately 2% in each case.

By having an instinct for low with under three kinds of same conditions, showing the gemma rate of formation that has 90% to the 100% Bacillus licheniformis NCIMB6346 that has formed gemma to compare proof DN286.

In any one substratum, in the spoIIAD3 derivative, all do not detect spore.Although there is not spore, the loss or the lysis that the time but do not have evidence to show in mutants which had, to have tangible viability when growth on BHI, and cell mass keeps being stabilized in about 4 * 10 between whole incubation period ⁹Cfu/ml.But in minimum medium, but have the loss of some viabilities when the incubation mutant surpasses 36 hours, and be higher than most after 10 times at cell mass, final cell mass reaches 3 * 10 ⁹Cfu/ml.Loss in the viability of the parent bacterial strain that grows in minimum medium is not too remarkable.Extracellular enzyme is synthetic among the embodiment 6 Bacillus licheniformis DN286 spoIIACD3

Original dull and stereotyped test is hinting that mutants which had is on the quantity of synthetic extracellular enzyme and some less difference are arranged between the parent.More particularly, compare β in mutant-1 with the parent bacterial strain, the hydrolysis area of 3-dextranase and carboxymethylcelluloenzyme enzyme reduces to some extent, but the synthetic major part of α-Dian Fenmei, DNA enzyme, polygalacturonic acid lyase, proteolytic enzyme, RNA enzyme and zytase is unaffected.

In abundant (BHI) and minimum medium, cultivated said mutation body and parent thereof 72 hours.Detect gemma formation and serine protease synthetic (Fig. 4).In parent and mutant, the production of proteolytic enzyme is similar.In minimum medium, the productive rate of enzyme reaches maximum and just keeps stable then in above-mentioned two kinds of bacterial strains after cultivating about 40 hours.In BHI, the productive rate of enzyme is suppressed slightly and reached maximum after cultivating about 48 hours in above-mentioned two kinds of bacterial strains.The decline of the suppression ratio of enzyme productive rate in salt culture medium is more not remarkable in BHI subsequently.In above-mentioned two kinds of substratum, the productive rate of serine protease is not subjected to the influence of spoIIAC disappearance.

Compare with parent, the synthetic of α-Dian Fenmei begins laterly all the time in the batch culture process of mutant, and this diastatic fermentation of result can continue longer for some time than the fermentation (84 hours) of proteolytic enzyme.In above-mentioned two kinds of substratum, the productive rate of the enzyme of mutant is approximately 70% of parent bacterial strain.But, if when expressing the productive rate of enzyme with the specific activity of the biological substance of per unit, the performance of said mutation body almost with parent quite, particularly when biological substance in minimum medium descends, growing the round-robin later stage especially like this.

Explained the present invention by the embodiment that only shows specific embodiments of the present invention.Because many other embodiments all are conspicuous on the basis of embodiment reading for the person of ordinary skill of the art, so these embodiment are not construed as limiting the invention.

The reference of quoting in the specification sheets

1.Diderchsen, B., G.B.Poulsen and P.L.J  rgensen.1991. is from the cloning and expression of the chromosomal alpha-amylase gene of bacstearothermophilus, microbiological research 142:793-796.

2.Leen, R.W.van, J.G.Ba khuis, R.F.W.C.van Beckhoven, M.Bruge, L.C.J.Dors sers, R.W.J.Hommes, P.J.Lemson, B.Noordam, N.L.M.Persoon and G.Wagemaker. uses industrial microorganism to produce people-interleukin, biology/technology 9:47-52.

3.de Boer, A.S., F.Priest and B.Diderichsen.1994. Bacillus licheniformis are in industrial use: summary, applied microbiology and biotechnology .40:595-598.

4.Errington J.1993. the gemma of subtilis forms: the adjusting of genetic expression and morphogenetic control, microbiology is looked back 57:1-33.

5.Lewis, P.J., S.R.Partridge and J.Errington.1994. σ-factor, the mensuration of cell fate in asymmetry and the subtilis, Proc. Natl. Acad. Sci.USA .91:3849-3853.

6.Kuroda, A., the formation to gemma of Y.Asami and J.Sekiguchi.1993. subtilis has the molecular cloning of specific cytohydrolist gene, JOURNAL OF MICROBIOLOGY .175:6260-6268.

7.Coppelecchia, R., the disappearance of H.de Grazia and C.P.Moran Jr.1991.spoIIAB has been blocked in early days endosporic formation in the subtilis, JOURNAL OF MICROBIOLOGY .173:6678-6685.

8.Sun D.P.Stragier, and P.Setlow.1989. identify a kind of new Sigma Factors .Genes Dev.3:141-149. that relates to compartmentation genetic expression in the process of the formation spore of subtilis

9.Fort P., and P.J.Piggot.1984. gemma in subtilis forms the nucleotide sequence of locus spoIIA, gene JOURNAL OF MICROBIOLOGY .130:2147-2153.

10.Tangney, M., P.L.J  rgensen, B.Diderichsen and S.T.J  rgensen, 1995. one kinds of novel method .FEMS Microbiol.Letts.125:107-114. that are used for integrating and stably carrying out DNA cloning the genus bacillus that is difficult for transforming

11.Patrridge, S.R., D.Foulger and J.Errington.1991. has the specific middle S that transcribes subtilis to prespore ^FEffect, molecular microbiology .5:757-767.

12.Smith, I.1993. control the modulability protein of growth development in late period, p.785-800.InA.L.Sonenshein, R.Losick and J.A.Hoch (ed.), subtilis and other gram positive bacterium: biological chemistry, physiology and molecular genetics, U.S. microbiology association, Washington D.C..

13.Arbidge, M.V., B.A.Balthus, the fermentation of J.Schultz and D.Crabb.1993. bacterium, p.871-895.In A.L.Sonenshein, R.Losick and J.A.Hoch (ed.), subtilis and other gram positive bacterium: biological chemistry, physiology and molecular genetics, U.S. microbiology association, the Washington D.C..

14.Waites, W.M., D.Kay, I.W.Dawes, D.A.Wood, the formation of gemma in the S.C.Warren andJ.Mandlestam.1970. subtilis, the correction of the biochemical phenomenon of morphological change in asporous mutant, journal of biological chemistry .118:667-676.

15.Coote, the formation of gemma in the J.G.1992. subtilis, the sign of few spore mutant and with the comparison of the phenotype of no spore mutant, gene JOURNAL OF MICROBIOLOGY .71:1-15.

16.Harwood, C.R.and s.M.Cutting.1990. appendix 1-substratum p.545-550.In, the molecular biology method .Wiley of C.R.Harwood and S.M.Cutting (eds.) genus bacillus, Chichester, UK.

17.Yudkin, M.D., the gemma of L.Appleby and A.J.Smith.1989. subtilis forms the nucleotide sequence of the Bacillus licheniformis homologous chromosomes of locus spoIIA, gene JOURNAL OF MICROBIOLOGY .135:767-775.

18.Sambrook, J., E.F.Fritsch and T.Manniatis.1989. molecular cloning laboratory manual, cold spring harbor laboratory, cold spring port, New York.

19.Horton, R.M., H.D.Hunt, S.N.Ho, J.K.Pullen and L.R.Pease.1989. does not use the heterozygote gene of the transformation of restriction enzyme: extend by overlap and carry out gene splicing, gene .77:61-68.

20.Cutting, S.M.and P.B.Van der Horn.1990. genetic analysis, P.27-74.In, C.R.Harwood and S.M.Cutting (eds.). the molecular biology method .Wiley of genus bacillus, Chichester, UK.

21.Aquino de Muro, M., W.J.Mitchell and F.G.Priest.1992. breaks up the mosquito-pathogenic strains of the Bacillus sphaericus of non-toxicity mutation, gene JOURNAL OF MICROBIOLOGY .138:1159-1166. by the ribosomal RNA gene unrestricted model

22.Priest F.G.and R.Grigorova.1990. is used to study the ecological approach that statospore forms bacterium, micro-biological process .22:565-591.

23.Robards, the method .Wiley in A.W.and A.J.Wilson (eds.) the .1993. electron microscopy, Chichester, UK.

24.Youngman, P.1990. in subtilis, use transposon and integrative vector to carry out mutagenesis and make up genetic fusant .p.221-226.In, C.R.Harwood and S.M.Cutting (eds.). the molecular biology method .John Wiley﹠amp of genus bacillus; Sons, New York.

25.Biswas, I., A.Gruss, S.D.Ehrlich and E.Maguin.1993. high efficiency gene, deactivation of gram positive bacterium and exchange system, bacteriology magazine .175:3628-3635.

26.Priest, F.G.1993. taxonomy of genus bacillus and ecological .p.3-16.In A.N.Sonenshein, R.Losick and J.A.Hoch (eds.). subtilis and other gram positive bacterium: biological chemistry, physiology and molecular genetics, U.S. microbiology association, the Washington D.C..

27.Priest extracellular enzyme is synthetic in the F.G.1977. bacillus, the bacteriology summary.

28.Wang, S.L., a L.F.Wang and R.H.Doi.1988. clone and nucleotide sequence of regulating new bacillus natto (subtilis) the gene senN of exoprotein genetic expression, gene JOURNAL OF MICROBIOLOGY .134:3264-3276.

29.Honjo, M., A.Nakayama, K.Fukazawa, K.Kawamura, K.Ando, M.Mori and Y.Furutani.1990. gene that relates to the new subtilis of negative control gemma formation and degrading enzyme production, bacteriology magazine .172:1783-1790.

Sequence table (1) general information: (i) applicant:

(A) name: NOVO NORDISK A/S

(B) street: Novo Alle

(C) city: Bagsvaerd

(E) country: Denmark

(F) postcode (ZIP): DK-2880

(G) phone :+45 4,442 2668

(H) fax :+45 4,442 6080 (ii) denominations of invention: be used to produce (iii) sequence number of method of useful proteins: 5 (iv) computer-reader forms:

(A) storage media type: diskette

(B) computer: IBM PC compatible

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release#1.0, #1.30 version (EPO) (2) SEQ ID NO:1 information: (i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): other nucleic acid

(A) describe :/desc=" probe " is feature (ix):

(A) title/keyword: misc-feature

(B) location: 1..24 (xi) sequence description: SEQ ID NO:1:CGATCATGGA AAATTTCATG GATG 24 (2) SEQ ID NO:2 information: (i) sequence signature:

(A) length: 37 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): other nucleic acid

(A) describe :/desc=" probe " is feature (ix):

(A) title/keyword: misc-feature

(B) location: 1..37 (xi) sequence description: SEQ ID NO:2:GCGGCGAATT CAGCTTGACC CGACGATGGA TGAACTG 37 (2) SEQ ID NO:3 information: (i) sequence signature:

(A) length: 49 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): other nucleic acid

(A) describe :/desc=" probe " is feature (ix):

(A) title/keyword: misc-feature

(B) location: 1..49 (xi) sequence description: SEQ ID NO:3:CACGACCTCT TCTGAACTGA AGTTCTTTCA CTTCATGGTC TTTAAGCTG 49 (2) SEQ ID NO:4 information: (i) sequence signature:

(A) length: 46 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): other nucleic acid

(A) describe :/desc=" probe " is feature (ix):

(A) title/keyword: misc-feature

(B) location: 1..46 (xi) sequence description: SEQ ID NO:4:GACCATGAAG TGAAAGAACT TCAGTTCAGA AGAGGTCGTG ATGGCC 46 (2) SEQ ID NO:5 information: (i) sequence signature:

(A) length: 46 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): other nucleic acid

(A) describe :/desc=" probe " is feature (ix):

(A) title/keyword: misc-feature

(B) location: 1..46 (xi) sequence description: SEQ ID NO:5:GACCATGAAG TGAAAGAACT TCAGTTCAGA AGAGGTCGTG ATGGcC 46

Claims

1. method that is used to produce metabolite, this method comprises i) under the condition that DNA construct is expressed and said metabolite is produced of the polypeptide relevant that help encoding with the production of said metabolite, cultivate the bacterium that can not form the bacillus of gemma owing to suddenly change, said bacterium comprises said construct, and ii) reclaiming said metabolite, its prerequisite is that said bacterium does not belong to subtilis.

2. the process of claim 1 wherein that said bacterium belongs to the group of the kind that comprises Bacillus licheniformis, slow genus bacillus, bacillus amyloliquefaciens, bacillus thuringiensis.

3. claim 1 or 2 method, wherein said sudden change is selected from the group of the sudden change that comprises Spo2-sudden change, Spo3-sudden change, SpoIIAC-sudden change.

4. arbitrary method of claim 1 to 3, wherein said sudden change is irreversible.

5. arbitrary method of claim 1 to 4, wherein said metabolite is a kind of endogenous or exogenous polypeptid.

6. the method for claim 5, wherein said polypeptide is transported.

7. claim 5 or 6 method, wherein said polypeptide is a kind of enzyme.

8. arbitrary method of claim 5 to 7, wherein said enzyme is a kind of industrial enzymes.

9. arbitrary method of claim 5 to 7, wherein said enzyme is a kind of medicinal enzyme.

10. a production belongs to the method for the bacterium of bacillus, and wherein above-mentioned bacterium is because sudden change has partly or completely lacked one or more gene that relates to the gemma forming process and can not form gemma.

11. the method for claim 10, wherein said bacterium belong to the group of the kind that comprises Bacillus licheniformis, slow genus bacillus, bacillus amyloliquefaciens, bacillus thuringiensis.

12. the method for claim 10 or 11, wherein said sudden change are selected from the group of the sudden change that comprises Spo2-sudden change, Spo3-sudden change, SpoI IAC-sudden change.

13. arbitrary method of claim 10 to 12, wherein said sudden change is irreversible.

14. a bacterium that belongs to the bacillus except that subtilis, wherein said bacterium can not form gemma owing to suddenly change.

15. the bacterium of claim 14, wherein said bacterium belong to the group of the kind that comprises Bacillus licheniformis, slow genus bacillus, bacillus amyloliquefaciens, bacillus thuringiensis.

16. the bacterium of claim 14 or 15, wherein said sudden change are selected from the group of the sudden change that comprises Spo2-sudden change, Spo3-sudden change, SpoIIAC-sudden change.

17. arbitrary bacterium of claim 14 to 16, wherein said sudden change is irreversible.