CN113136382B - Method for synthesizing glyoxylic acid by utilizing corynebacterium glutamicum based on CRISPII regulation and control - Google Patents

Abstract

The invention provides a method for synthesizing glyoxylate by utilizing corynebacterium glutamicum based on CRISPR regulation, which comprises the steps of replacing an acetaldehyde dehydrogenase coding gene of the corynebacterium glutamicum by a dCas9 expression cassette gene, replacing a lactate dehydrogenase coding gene of the corynebacterium glutamicum by an sgRNA transcription unit of the isocitrate dehydrogenase coding gene and an malate synthase coding gene, overexpressing an isocitrate lyase coding gene of the corynebacterium glutamicum to obtain an engineering strain of the corynebacterium glutamicum, and culturing the engineering strain to ferment and synthesize glyoxylate. The invention takes corynebacterium glutamicum as an initial strain, removes a lactate dehydrogenase coding gene and an acetaldehyde dehydrogenase coding gene which are key enzymes for the tributary metabolism, establishes a CRISPII regulation system, and establishes a method for biosynthesizing glyoxylic acid by using corynebacterium glutamicum through the expression level down-regulation of an isocitrate dehydrogenase coding gene and an malate synthase coding gene and the over-expression of an isocitrate lyase coding gene.

Description

Method for synthesizing glyoxylic acid by utilizing corynebacterium glutamicum based on CRISPI regulation and control

Technical Field

The invention relates to the technical field of bioengineering, in particular to a method for synthesizing glyoxylic acid by utilizing corynebacterium glutamicum based on CRISPR regulation and control for glyoxylic acid biosynthesis.

Background

Glyoxylic acid (Glyoxylic acid) is the smallest molecular weight substance in the family of uronic acids, is an important organic acid in the TCA (tricarboxylic acid) cycle and the Glyoxylic acid cycle of an organism, affects the metabolic balance of the organism, and its derivatives are as many as tens of species, of which vanillin, ethyl vanillin, allantoin, p-hydroxyphenylalanine, p-hydroxyphenylacetamide, and the like are typical. Glyoxylic acid derivatives are widely applied to industries such as food additives, cakes, candies, baked foods, cigarettes, wines, spices, cosmetics, medicines and the like, along with the increase of the demand of glyoxylic acid, the pollution caused by glyoxylic acid production by a chemical method is increasingly serious, and the synthesis of glyoxylic acid by a biological method is gradually an important way for reducing pollution.

At present, glyoxylic acid is synthesized by a biological method mainly through a biocatalytic reaction of resting cells of yeast, glycolic acid is oxidized into glyoxylic acid by using glycolate oxidase, and during the reaction, glycolic acid which is a derivative of petroleum is required to be used as a substrate, and catalase and FMN are added at the same time. Compared with a chemical method, the method reduces pollution, but has the defects of complex operation and high production cost, thereby limiting the industrial application of the method.

Based on the above, research on a fermentation method of genetically engineered bacteria more beneficial to sustainable development is started, and among them, the CRISPRi technology of the type ii CRISPR/Cas9 system of DNA endonuclease guided by RNA, that is, improving synthesis efficiency by regulating gene transcription and protein expression level, is gradually becoming a research direction of people's attention.

The CRISPRi system consists of two components, dCas9 protein, which loses endonuclease activity, and sgRNA, wherein the sgRNA consists of 3 parts, i.e., a recognition sequence for a specific nucleotide region of a 20nt target gene, a 42nt dCas9 protein binding sequence, and a 40nt transcription terminator sequence. The CRISPII has the working mechanism that when the sgRNA guides dCas9 protein to be combined at a specific position of DNA, a compound formed by the sgRNA, the protein and the dCas9 protein can form steric hindrance, so that the purpose of regulating the gene expression level is achieved.

For researchers, it is significant to adopt the CRISPRi technology to regulate glyoxylate synthesis, thereby facilitating the use of biological methods to realize the industrial production of glyoxylate, but reports on the production of glyoxylate by fermentation methods of genetically engineered bacteria in the prior art are few.

Disclosure of Invention

In view of this, the invention aims to provide a method for synthesizing glyoxylic acid by utilizing corynebacterium glutamicum based on CRISPII regulation and control, so that a process for synthesizing glyoxylic acid by utilizing corynebacterium glutamicum can be constructed by utilizing CRISPII technology, and the biosynthesis of glyoxylic acid is facilitated.

In order to achieve the purpose, the technical scheme of the invention is realized as follows:

a method for synthesizing glyoxylate by utilizing corynebacterium glutamicum comprises replacing an acetaldehyde dehydrogenase coding gene of the corynebacterium glutamicum by a dCas9 expression cassette gene, replacing a lactate dehydrogenase coding gene of the corynebacterium glutamicum by an sgRNA transcription unit of the isocitrate dehydrogenase coding gene and a malate synthase coding gene, overexpressing the isocitrate lyase coding gene of the corynebacterium glutamicum to obtain an engineering strain of the corynebacterium glutamicum, and culturing the engineering strain to synthesize glyoxylate by fermentation.

Further, the replacement of the acetaldehyde dehydrogenase encoding gene by the dCas9 expression cassette gene comprises the steps of constructing a dCas9 expression cassette gene targeting plasmid, transferring the dCas9 expression cassette gene targeting plasmid into a wild-type Corynebacterium glutamicum strain through electrotransformation, and replacing the acetaldehyde dehydrogenase encoding gene by the dCas9 expression cassette gene through two times of homologous recombination.

Further, the construction of the dCas9 expression cassette gene targeting plasmid comprises:

a1. amplifying upper and lower homologous arm segments of an aldehyde dehydrogenase coding gene and a promoter posd gene segment by using a corynebacterium glutamicum genome as a template;

a2. dCas9-Peasy plasmid is taken as a template, and dCas9 gene segments are amplified;

a3. overlapping the gene segments amplified in the steps a1 and a2 by a fusion PCR technology;

a4. and (2) carrying out double enzyme digestion on the lapped fragment obtained in the step a3 and an empty plasmid pK18mobsacB by using Nhe I and Xho I, purifying an obtained enzyme digestion product, connecting the enzyme digestion product by using T4 ligase at 16 ℃ overnight, transforming the enzyme digestion product into E.coli TransT1 competent cells, and obtaining a targeting plasmid dCas9-pK18mobsacB through empirical screening.

Furthermore, the replacement of the lactate dehydrogenase encoding gene by the sgRNA transcription unit of the isocitrate dehydrogenase encoding gene and the malate synthase encoding gene comprises constructing a sgRNA transcription unit targeting plasmid of the isocitrate dehydrogenase encoding gene and the malate synthase encoding gene, transferring the sgRNA transcription unit targeting plasmid into a corynebacterium glutamicum strain in which the acetaldehyde dehydrogenase encoding gene is replaced by a dCas9 expression cassette gene through electrical transformation, and replacing the lactate dehydrogenase encoding gene by the isocitrate dehydrogenase encoding gene and the sgRNA transcription unit of the malate synthase encoding gene through two homologous recombinations.

Further, the construction of the sgRNA transcription unit targeting plasmid of the isocitrate dehydrogenase encoding gene and malate synthase encoding gene comprises:

b1. amplifying the upper and lower homologous arm segments of the lactate dehydrogenase coding gene by taking a corynebacterium glutamicum genome as a template;

b2. amplifying an sgRNA transcription unit component of an isocitrate dehydrogenase encoding gene and an sgRNA transcription unit component of a malate synthase encoding gene by utilizing fusion PCR, wherein the sgRNA transcription unit component of the isocitrate dehydrogenase encoding gene comprises a promoter psod gene sequence, a 20bp sgRNA gene sequence, a Cas9 protein binding region gene sequence and a terminator rrnB gene sequence, and the sgRNA transcription unit component of the malate synthase encoding gene comprises a promoter ptuf gene sequence, a 20bp sgRNA gene sequence, a Cas9 protein binding region gene sequence and a terminator rrnB gene sequence;

b3. and (3) constructing sgRNA transcription unit targeting plasmids of the isocitrate dehydrogenase coding gene and the malate synthase coding gene by using the upper and lower homologous arm fragments in the step b1 and sgRNA components of the isocitrate dehydrogenase coding gene and the malate synthase coding gene in the step b2 through a Golden Gate cloning method.

Furthermore, the method for overexpressing the coding gene of the isocitrate lyase of the corynebacterium glutamicum comprises the steps of constructing an overexpression plasmid of the coding gene of the isocitrate lyase, transferring the overexpression plasmid of the coding gene of the isocitrate lyase into a corynebacterium glutamicum strain which is subjected to electrotransformation, replaces an acetaldehyde dehydrogenase coding gene with a dCas9 expression cassette gene, replaces a lactate dehydrogenase coding gene with an sgRNA transcription unit of the coding gene of the isocitrate dehydrogenase and a malate synthase, and overexpresses a synthetic gene of the isocitrate lyase to obtain the corynebacterium glutamicum engineering strain.

Further, the construction of the plasmid for overexpression of the isocitrate lyase coding gene comprises:

c1. amplifying a promoter psod gene segment, an isocitrate lyase coding gene segment and a terminator rrnB gene segment by taking a corynebacterium glutamicum genome as a template, and overlapping;

c2. carrying out double enzyme digestion on the c1 lapped fragment and the pXMJ19GZ plasmid by utilizing HindIII and BamHI, purifying an obtained enzyme digestion product, connecting the enzyme digestion product at 16 ℃ overnight by using T4 ligase, transforming the enzyme digestion product into E.coli TransT1 competent cells, and obtaining the isocitrate lyase coding gene overexpression plasmid through verification screening.

Further, the electrically transforming the dCas9 expression cassette gene targeting plasmid, or sgRNA transcription unit targeting plasmid, or isocitrate lyase coding gene overexpression plasmid into the Corynebacterium glutamicum strain comprises:

d1. inoculating the overnight-cultured corynebacterium glutamicum strain into a seed culture medium according to the inoculation amount of 10%, shaking and culturing, when the OD600 reaches 0.5-0.7, centrifugally collecting thalli at 4 ℃ at 4000r/min, removing supernatant, adding 10% glycerol, and slightly washing twice to obtain corynebacterium glutamicum competent cells;

d2. sucking plasmid and corynebacterium glutamicum competent cells in a centrifugal tube, mixing gently, transferring into an electric shock cup, standing for 5min, and starting electric shock under the conditions of 2.5kV/m voltage, 250 omega resistance and 25 muF capacitance;

d3. immediately adding a preheated incubation culture medium into the electric shock cup after electric shock is finished, transferring the mixture into a centrifuge tube after heavy suspension and mixing, heating the mixture in a constant temperature heater at 48 ℃ for 6min, and then culturing the mixture at 30 ℃ for 4h at 180 r/min;

d4. centrifuging, removing supernatant, spreading the bacterial liquid on LB solid medium plate containing kanamycin, and culturing at constant temperature of 30 ℃ for 48-72h.

Further, the dCas9 expression cassette gene replaces an acetaldehyde dehydrogenase coding gene, and the sgRNA transcription units of the isocitrate dehydrogenase coding gene and the malate synthase coding gene replace a lactate dehydrogenase coding gene, wherein the two homologous recombinations comprise:

e1. after the plasmid is electrically transformed into the corynebacterium glutamicum strain for 48-72 hours, carrying out molecular verification on a single colony growing on a solid culture medium containing kanamycin, and determining that the plasmid is subjected to first homologous recombination and is integrated onto a corynebacterium glutamicum chromosome;

e2. selecting a positive single colony which is determined to generate the first homologous recombination, transferring the positive single colony into an incubation culture medium, culturing the positive single colony for 12 hours at 30 ℃ at 180r/min, enabling the positive single colony to freely grow under the antibiotic-free condition, and enabling the positive single colony to generate the second homologous recombination;

e3. the bacterial liquid was diluted and spread on LB solid medium containing 10% sucrose, and cultured overnight at 30 ℃. Correspondingly expanding and culturing the grown transformants on an LB solid culture medium containing 10% of cane sugar and kanamycin one by one;

e4. positive transformants were determined for the strains which underwent the second homologous recombination based on single colonies which grew on the sucrose-containing medium but not on the kanamycin-containing medium, and the obtained positive transformants were verified by PCR of the inoculum.

Further, the step of culturing the engineering strain to ferment and synthesize the glyoxylic acid comprises the steps of inoculating the engineering strain into a seed culture medium, shaking the flask at 30 ℃ and 180r/min for overnight culture, then inoculating into a CD culture medium containing 5% of glucose for shaking culture, and sampling at regular time during the culture to measure the growth concentration of thalli.

Compared with the prior art, the invention has the following advantages:

the invention relates to a method for synthesizing glyoxylate by utilizing corynebacterium glutamicum, which takes the corynebacterium glutamicum as an initial strain, knocks out a tributary metabolism key enzyme lactate dehydrogenase coding gene, establishes a CRISPII regulation system, utilizes the system to reduce the expression level of an isocitrate dehydrogenase coding gene and an malate synthase coding gene in tributary metabolism, and overexpresses the isocitrate lyase coding gene.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate an embodiment of the invention and, together with the description, serve to explain the invention and not to limit the invention. In the drawings:

FIG. 1 is a schematic diagram of a metabolic engineering strategy for the synthesis of glyoxylate by Corynebacterium glutamicum;

FIG. 2 is a schematic diagram illustrating the principle of homologous recombination according to an embodiment of the present invention;

FIG. 3 shows the PCR verification result of plasmid dCas9-pK18mobsacB according to the present invention (in the figure, D: the gene verification result of dCas9 expression cassette; +: positive control; 0: negative control; M: DL15000 DNA Marker);

FIG. 4 shows the PCR result of the engineered bacterium C.glutamcum/dCas 9. Delta. Aldh (in the figure, Q: aldh gene verification result; d: dCas9 gene verification result; positive control; 0: negative control; M: DL2000/5000DNA Marker);

FIG. 5 shows the restriction enzyme digestion verification of the plasmid icd-ms-pK18mobsacB (in the figure, Z: icd-ms-pK18mobsacB plasmid restriction enzyme digestion verification result; M: DL15000 DNA Marker);

FIG. 6 shows the PCR result of the engineered bacterium C.glutamcum/icd-ms Deltalldh (Q: lldh gene verification result; c: icd-sgRNA gene verification result; M: ms-sgRNA gene verification result; +: positive control; 0: negative control; M: DL2000 DNA Marker);

FIG. 7 shows the result of the restriction enzyme of icl-pXMJ19GZ plasmid (in the figure, Z: icl-pXMJ19GZ plasmid restriction enzyme verification result; M: DL15000 DNA Marker);

FIG. 8 shows the PCR result of the engineered strain C. Glutamicum/icl (S: icl gene verification result; +: positive control; 0: negative control; M: DL2000 DNA Marker);

FIG. 9 is a comparison of the growth of wild bacteria and engineered bacteria in accordance with the present invention;

FIG. 10 shows the glyoxylate content of the fermentation broth after 48h fermentation of the wild strain in the example of the invention;

FIG. 11 shows the glyoxylate content in the fermentation broth after 48h of fermentation of engineering bacteria C.

Detailed Description

It should be noted that the embodiments and features of the embodiments may be combined with each other without conflict.

The present invention will be described in detail below with reference to the embodiments with reference to the attached drawings.

The embodiment relates to a method for synthesizing glyoxylic acid by utilizing corynebacterium glutamicum based on CRISPII regulation and control.

Corynebacterium glutamicum (Corynebacterium glutamicum ATCC 13032, C.glutamicum ATCC 13032 for short) is used as a food safety level microorganism, and has the advantages of easy culture, no spore production, high yield, biological safety and the like. With the completion of the whole genome sequencing of corynebacterium glutamicum and the accumulation of various omics data, the targeted modification and the construction of engineering strains are realized, in the C.glutamicum glycolysis pathway and the TCA cycle process, a complex network system exists among pyruvic acid, lactic acid, citric acid, isocitric acid, glyoxylic acid and malic acid, the complex network system is complicated and interrelated, and the targeted modification can lead the corynebacterium glutamicum to have higher production efficiency when being used as an engineering strain.

The glyoxylate synthesis method of this example, as a whole, involved replacing the acetaldehyde dehydrogenase encoding gene (aldh gene) of C.glutamicum by the dCas9 expression cassette gene, replacing the lactate dehydrogenase encoding gene (lldh gene) of C.glutamicum by the sgRNA transcription unit of the isocitrate dehydrogenase encoding gene (icd gene) and malate synthase encoding gene (ms gene), and overexpressing the isocitrate lyase encoding gene (icl gene) of C.glutamicum, to give an engineered strain of C.glutamicum, and culturing the engineered strain to synthesize glyoxylate by fermentation.

Among them, the engineering strategy for synthesizing glyoxylate metabolism by using corynebacterium glutamicum is shown in fig. 1 as a whole, and specifically, this example uses dCas9 expression cassette gene as an example, and the above-mentioned replacement of aldh gene by dCas9 expression cassette gene includes the construction of dCas9 expression cassette gene targeting plasmid (dCas 9-pK18 mobsacB), the targeting plasmid dCas9-pK18mobsacB is transferred into wild-type corynebacterium glutamicum strain by electrotransformation, and through two homologous recombinations, dCas9 expression cassette gene is replaced by aldh gene.

The replacement of the lldh gene by the sgRNA transcription unit of the icd gene and the ms gene comprises the steps of constructing a sgRNA transcription unit targeting plasmid (icd-ms-pK 18 mobsacB) of the icd gene and the ms gene, transferring the sgRNA transcription unit targeting plasmid icd-ms-pK18mobsacB into a corynebacterium glutamicum strain of which the aldh gene is replaced by a dCas9 expression cassette gene through electric transformation, and performing homologous recombination twice to ensure that the lldh gene is replaced by the sgRNA transcription unit of the icd gene and the ms gene.

The overexpression icl gene comprises constructing an icl gene overexpression plasmid, transferring the icl gene overexpression plasmid into a corynebacterium glutamicum strain in which an aldh gene is replaced by a dCas9 expression cassette gene and an lldh gene is replaced by a sgRNA transcription unit of an icd gene and an ms gene through electric transformation, and overexpressing an icl gene to obtain the corynebacterium glutamicum engineering strain.

In the above construction of targeting plasmid dCas9-pK18mobsacB, in order to integrate dCas9 gene into c.glutamcum genome, the acetaldehyde dehydrogenase encoding gene alldh in c.glutamcum tributary metabolism was selected as its substitute gene to replace dCas9 to the corresponding position of the alldh gene, and the replacement specifically included the following steps:

a1. amplifying upper and lower homologous arm fragments of aldh gene and promoter posd gene fragment by using C.glutamicum genome as a template;

a2. dCas9-Peasy plasmid is taken as a template, and dCas9 gene segments are amplified;

a3. overlapping the gene fragments amplified in the a1 and a2 steps by using a Fusion PCR technology (Fusion PCR);

a4. and (3) carrying out double enzyme digestion on the overlapped fragment obtained in the step a3 and the empty plasmid pK18mobsacB by using Nhe I and Xho I, purifying an obtained enzyme digestion product, connecting the enzyme digestion product at 16 ℃ overnight by using T4 ligase, transforming the enzyme digestion product into E.coli TransT1 competent cells, and obtaining the targeting plasmid dCas9-pK18mobsacB through empirical screening.

In the above steps, the dCas9-Peasy plasmid is generally preserved in a laboratory, and the dCas9-Peasy plasmid can be replaced by other plasmids having the same function and meeting the use requirement of the embodiment. For the purification treatment of the digestion product, the purification method can be performed according to the known conventional method, and the above-mentioned verification screening is performed to obtain the targeting plasmid dCas9-pK18mobsacB. The verification screening adopts a known PCR verification method, primers are designed by using dCas9 gene sequences, bands can be amplified to be positive transformants, and other verification screening is similar to the positive transformants.

In this embodiment, in the construction of the sgRNA transcription unit targeting plasmid of the icd gene and the ms gene, in order to knock out the lactate dehydrogenase encoding gene lldh, which is a key enzyme in the metabolism of c.glutamicum tributaries, and to integrate the sgRNA transcription units of the icd and ms genes into the c.glutamicum chromosome, the corresponding position of the lldh gene is selected as the target position, and the lgrna transcription unit is replaced by the lldh gene, where the replacement specifically includes the following steps:

b1. amplifying the upper and lower homologous arm segments of the lactate dehydrogenase coding gene by taking the corynebacterium glutamicum genome as a template;

b2. the sgRNA transcription unit components of the isocitrate dehydrogenase encoding gene and the malate synthase encoding gene are respectively amplified by utilizing a known fusion PCR method. The sgRNA transcription unit component of the isocitrate dehydrogenase encoding gene comprises a promoter psod gene sequence, a 20bp sgRNA gene sequence CGCGAGCAGCGGTGCTTCGT (non-coding chain sequence), a Cas9 protein binding region gene sequence and a terminator rrnB gene sequence, and the sgRNA transcription unit component of the malate synthase encoding gene comprises a promoter ptuf gene sequence, a 20bp sgRNA gene sequence GGAAATCCTCGTACGCCTCT (non-coding chain sequence), a Cas9 protein binding region gene sequence and a terminator rrnB gene sequence;

b3. constructing a targeting plasmid icd-ms-pK18mobsacB by a Golden Gate cloning method through sgRNA components of the upper and lower homologous arm fragments in the step b1 and the isocitrate dehydrogenase encoding gene and the malate synthase encoding gene in the step b2.

It should be noted that the Golden Gate cloning method in the step b3 further includes the following steps:

firstly, constructing a tool plasmid PX-ACKT-LacZ, which comprises the following steps: the upper homologous jiyin sequence of the lldh gene, the lower homologous sequence of the lacZ gene and the lldh gene. The two ends of the LacZ gene are provided with Bsa I enzyme cutting sites, overhang with the length of 4 bp at one end is complementary with overhang at one end of an sgICL transcription unit component, the other end is complementary with overhang at one end of an sgMS transcription unit component, and the overhang between the sgICL transcription unit component and the sgMS transcription unit component is complementary.

Respectively amplifying an sgMS transcription unit component and an sgICL transcription unit component, carrying out enzyme digestion connection after enzyme digestion tool plasmid PX-ACKT-LacZ is respectively purified, wherein the concentrations of sgICL and sgMS are 45ng, PX-ACKT-LacZ 80ng, bsa I endonuclease, T4 ligase 0.751 mu L, DTT 1 mu L, ATP0.41 mu L, and the total reaction system is 10 mu L. And transforming the connecting product into escherichia coli, screening and verifying, and finally constructing the targeting plasmid PX-ACKT-sgICL-sgMS with lldh upper and lower homologous arms, an sgMS transcription unit component and an sgICL transcription unit component.

Meanwhile, it should be noted that the promoters psod, ptuf and the terminator rrnB adopted in the sgRNA assembly in this embodiment are natural promoters and terminators, and generally, because the transcription range thereof is large, the promoters cannot accurately transcribe the specific target recognition sequence of the target RNA combined by the Cas9 protein, so that the precise cleavage of the Cas9 protein to the target position may be affected in the CRISPR/Cas9 system, and for the CRISPRi system, the control range and the strength of the CRISPRi system to the target gene are only affected.

In this embodiment, the fermentation broth of the obtained engineered strain is tested to find that the glyoxylate fermented by the obtained engineered strain is accumulated compared with the wild strain, so that the natural promoter and terminator described in this embodiment can be applied to the CRISPRi regulatory system and play a role in regulating and controlling the target gene.

In this example, the construction of the icl gene overexpression plasmid specifically includes the following steps:

c1. amplifying a promoter psod gene fragment, an isocitrate lyase coding gene fragment and a terminator rrnB gene fragment by using the C.glutamcum genome as a template, and overlapping;

c2. carrying out double enzyme digestion on the c1 lapped fragment and the pXMJ19GZ plasmid by utilizing HindIII and BamHI, purifying an obtained enzyme digestion product, connecting the enzyme digestion product at 16 ℃ overnight by using T4 ligase, transforming the enzyme digestion product into E.coli TransT1 competent cells, and obtaining the isocitrate lyase coding gene over-expression plasmid icl-pXMJ19GZ by empirical screening.

Based on the above construction of targeting plasmids, when the dCas9 expression cassette gene targeting plasmid dCas9-pK18mobsacB, sgRNA transcription unit targeting plasmid icd-ms-pK18mobsacB, or isocitrate lyase coding gene overexpression plasmid icl-pXMJ19GZ is transformed into corynebacterium glutamicum strain by electrotransformation, the method specifically comprises the following steps:

d1. inoculating the overnight cultured corynebacterium glutamicum strain into a seed culture medium according to the inoculation amount of 10%, shaking and culturing, when the OD600 reaches 0.5-0.7, centrifugally collecting thalli at 4 ℃ at 4000r/min, removing supernatant, adding 10% glycerol, and slightly washing twice to obtain the corynebacterium glutamicum competent cells.

d2. Sucking plasmid and corynebacterium glutamicum competent cells in a centrifugal tube, mixing gently, transferring into an electric shock cup, standing for 5min, and starting electric shock under the conditions of 2.5kV/m voltage, 250 omega resistance and 25 muF capacitance;

d3. immediately adding a preheated incubation culture medium into the electric shock cup after electric shock is finished, transferring the mixture into a centrifuge tube after heavy suspension and mixing, heating the mixture in a constant temperature heater at 48 ℃ for 6min, and then culturing the mixture at 30 ℃ for 4h at 180 r/min;

d4. centrifuging, removing supernatant, spreading the bacterial liquid on LB solid medium plate containing kanamycin, and culturing at constant temperature of 30 ℃ for 48-72h.

In the above-mentioned electrotransformation step, C.preparation of glutamicum competent cells, which can be specifically referred to, for example, the existing literature (JANG K, BRITZ M.improved electrotransformation frequencies of Corynebacterium glutamicum using cells-surface microorganisms [ J ]. Biotechnology Letters,2000,22 (7): 539-545.DOI

In addition, in the above-mentioned dCas9 expression cassette gene replacement aldh gene of this embodiment, the c. Glutamicum strain utilizes a sucrose lethal gene sacB reverse screening technique, and performs gene knockout by two homologous recombination methods, the principle of which can be shown in fig. 2, and the two homologous recombination specifically includes the following steps:

e1. electrically transforming a targeting plasmid dCas9-pK18mobsacB into a wild type C.glutamicumaTCC 13032 strain for 48-72h, selecting a single colony growing on a solid culture medium containing kanamycin for molecular verification, designing a primer by using a dCas9 gene sequence, and amplifying a band as a positive transformant to determine that the plasmid is subjected to first homologous recombination and is integrated on a corynebacterium glutamicum chromosome;

e2. selecting a positive single colony which is determined to generate the first homologous recombination, transferring the positive single colony into an incubation culture medium, culturing for 12 hours at 30 ℃ and 180r/min, enabling the positive single colony to freely grow under the antibiotic-free condition, and generating the second homologous recombination;

e3. the bacterial liquid was diluted and spread on LB solid medium containing 10% sucrose, and cultured overnight at 30 ℃. Correspondingly expanding and culturing the grown transformants on an LB solid culture medium containing 10% of cane sugar and kanamycin one by one;

e4. positive transformants were determined for the strains that underwent the second homologous recombination based on single colonies that grew on the sucrose-containing medium but did not grow on the kanamycin-containing medium, and further verified by PCR of the bacterial broth, no band could be amplified with the sac gene sequence design primer, and a band could be amplified with the dCas9 gene sequence design primer, i.e. positive transformants that were the positive engineered strain c.

In the steps, the method for carrying out bacteria liquid PCR verification on the single bacterial colony specifically comprises the steps of adding 20 mu L of sterile water into a 200 mu L centrifugal tube, dipping a small amount of single bacteria into the centrifugal tube by using a gun tip, fully blowing, sucking and uniformly mixing. And then cracking the bacterial liquid for 20min at the constant temperature of a heater at 100 ℃, and then quickly freezing the bacterial liquid for 5min in a refrigerator at the temperature of-40 ℃ so as to fully crack cell walls. And (3) performing PCR verification by using the lysate as a template, wherein the positive transformant is obtained by obtaining the inserted gene band and the knocked-out gene band in batches.

Transferring the plasmid icd-ms-pK18mobsacB into the C.glutamiccumdCas9/delta aldh according to the same method as the positive engineering strain C.glutamiccumdCas9/delta aldh, carrying out homologous recombination twice, and replacing lldh gene to obtain the positive engineering strain C.glutamiccumic-ms/delta lldh.

The icl gene overexpression plasmid icl-pXMJ19GZ is transferred into C.glutamicum/icd-ms delta lldh to obtain the positive engineering strain C.glutamicum/icl.

In this case, the step of synthesizing glyoxylic acid by fermentation of the engineered strain c. Glutamicum/icl obtained by culturing in this example specifically includes inoculating the engineered strain to a seed culture medium, shaking overnight at 30 ℃ and 180r/min, then inoculating to a CD culture medium containing 5% glucose, shaking for culture, sampling at regular time during culture to determine the growth concentration of the cells, and adjusting the pH to maintain the pH at 6.5-7.5, thereby obtaining the biosynthetic production of glyoxylic acid.

The glyoxylate biosynthesis method of the present invention will be further described with reference to specific examples based on the general description of the synthesis method of this example given above.

In the example of this embodiment, unless otherwise stated, various techniques such as fusion PCR technique, gene verification primer design, bacteria liquid PCR verification, etc. involved therein are all performed by the conventional operation procedures in the existing genetic engineering, and certainly not only the example, but also all the techniques involved in this embodiment.

Each of the T clone plasmid, targeting tool plasmid, and e.coli TranT1 can be obtained commercially.

Among the reagents used, they are also commercially available, for example, high-Fidelity DNA polymerase is available from beijing holotype gold biologicals, T4 DNA ligase, restriction endonuclease, and T4 DNA ligase are available from NEB (beijing) ltd, genome extraction kit, plasmid miniprep kit, ultra-thin DNA product purification kit, and agarose gel DNA recovery kit are available from tiangen biochemical technology (beijing) ltd, and Polymerase Chain Reaction (PCR) primers can be synthesized by bio-engineering (shanghai) ltd.

Among the used equipment, the PCR amplification instrument can adopt Eppendorf Mastercycler gradient, the full-automatic Gel imaging system can adopt BioRad Molecular Imager Gel DOXR, the desktop high-speed centrifuge can adopt Eppendorf Mini Spin, the high-speed refrigerated centrifuge can adopt Thermo Sorvall Evolution RC, the enzyme labeling instrument can adopt biotek Power wave, and the high performance liquid chromatography instrument can adopt Agilent 1260Infinity.

The plasmids and strain lists used in this example:

the culture medium or culture conditions to be used may be specifically set as follows:

coli culture conditions were: LB culture medium, 37 ℃ culture, ampicillin working concentration is 100 mug/L, kanamycin working concentration is 50 mug/L;

culture conditions of glutamicum ATCC 13032 were: the culture was carried out at 37 ℃ and the working concentration of kanamycin was 30. Mu.g/L.

The formula of the culture medium is as follows:

LB medium: 10g/L Tryptone (Tryptone), 10g/L NaCl and 5g/L yeast Extract (Extract), and adjusting the pH value to be about 7; agar powder 20g/L was added to the solid medium.

SOC medium (g/L): 20g/L Tryptone (Tryptone), 5g/L yeast Extract (Extract), 0.5g/L NaCl,250mM KCl 10mL,1M glucose 2mL,2M MgCl 2.5mL, and the pH value was adjusted to about 7.

CD culture medium: 1g/L KH2PO4,1g/L NH4NO3,3g/L (NH 4) 2SO4,0.5g/L MgSO4,0.01g/L Fe2 (SO 4) 3,0.2g/L CaCl2,0.001g/L ZnSO4,0.01g/L MnSO4,0.002g/L CuSO4 and 0.002g/L biotin, and the pH value is adjusted to about 7.

6. Incubation medium: 10g/L Tryptone (Tryptone), 10g/L NaCl,5g/L yeast Extract (Extract), 1g/L sodium acetate, adjusting the pH value to about 7.

7. Seed culture medium: 10g/L of corn steep liquor, 25g/L of glucose and 20g/L of agar, and adjusting the pH value to about 7.

8. Fermentation medium: 50g/L glucose, 5g/L sodium acetate, 0.1g/L NHNO3,1.5g/L KH2PO4,0.3g/L CaCl2,0.25g/L MgSO4,5g/L (NH 4) 2SO4, and the pH value is adjusted to about 7.

In a specific example, based on the above-mentioned overall method design, in order to replace the gene of dCas9 expression cassette with aldh gene, the c.glutamicum genome is used as template to amplify the upper and lower homologous arm fragments of aldh gene and promoter psod gene fragment, dCas9-Peasy plasmid is used as template to amplify dCas9 gene fragment, and then they are overlapped by fusion PCR technique and connected with plasmid pK18mobsacB to obtain recombinant plasmid dCas9-pK18mobsacB.

After the construction is completed, PCR verification can be performed on the single colony, specifically, single colony liquid culture is selected, 20 μ L of bacterial liquid is taken, heating is performed in a constant temperature heater for 20min at 100 ℃ in a high temperature pyrolysis mode, the obtained lysate can be used as a PCR template, PCR verification is performed by using a verification primer as a primer, and the obtained band is shown in FIG. 3. At this time, as shown in FIG. 3, the size of the dCas9 expression cassette gene is consistent with that of the positive control band, indicating that the targeting plasmid dCas9-pK18mobsacB is successfully constructed.

Then, the targeting plasmid dCas9-pK18mobsacB was transformed into wild type C.glutamicmATCC 13032 strain by electric transformation, and the gene of the dCas9 expression cassette was substituted for the aldh gene by two homologous recombinations. Next, knock-out gene verification primers were designed using aldh gene sequence as a template, and knock-in gene verification primers were designed using dCas9 gene sequence as a template as shown in the following table.

Primers PCAS1F and PCAS2R verify whether the dCas9 gene is knocked in, and the dCas9-Peasy plasmid is positive; verifying whether the aldh gene in the transformant is knocked out by using primers QALDHF and QALDHR, wherein C.glutamcum is a positive control; the primers SACYZF and SACYZR verify whether the reverse screening marker sacB gene in the transformant is knocked out, and pK18mobsacB is a positive control; primers QYZF and QYZR verify the presence of the known gene of c.glutamcum itself, which is a positive control.

The bacteria liquid PCR verification result is shown in figure 4 by carrying out bacteria liquid PCR verification, the aldh gene can not be amplified, and the dCas9 gene is consistent with the positive control strip size, namely, the engineering bacteria C.glutamicum/dCas9 delta aldh with the dCas9 expression cassette gene replacing the aldh gene is successfully constructed.

Then, in order to replace the sgRNA transcription units of the icd gene and the ms gene with the lldh gene, the upper and lower homologous arm fragments of the lldh gene are amplified by using the C.glutamcum genome as a template, sgRNA components of the icd gene and the ms gene are amplified by using two times of PCR through extending primers, and a targeting plasmid icd-ms-pK18mobsacB is constructed by using a Golden Gate cloning method. Then, the plasmid can be subjected to enzyme digestion verification, and as shown in FIG. 5, two fragments of 5400bp and 3000bp are obtained after enzyme digestion, and the sizes of the two fragments are consistent with those of pK18mobsacB plasmid and sgRNA transcription unit fragments of icd and ms genes, so that the successful construction of the targeting plasmid icd-ms-pK18mobsacB can be demonstrated.

Then, the targeting plasmid icd-ms-pK18mobsacB is transferred into the engineering bacterium C.glutamcum/dCas 9 delta aldh which is verified to be correct by electric transformation, and the gene of the sgRNA transcription unit of the icd and the ms gene replaces the lldh gene by homologous recombination for two times. And then designing a knock-out gene verification primer by taking the lldh gene sequence as a template, designing a knock-in gene verification primer by taking the icd gene sgRNA transcription unit gene sequence and the ms gene sgRNA transcription unit gene as templates, and carrying out bacterial liquid PCR verification, wherein the lldh gene does not amplify a strip, and the sizes of the icd-sgRNA gene and the ms-sgRNA gene are consistent with the size of a positive control strip, namely the successful construction of the engineering bacterium C.glutamicum/icd-ms delta lldh gene replaced by the icd and ms gene sgRNA transcription unit genes is shown.

And then, amplifying an icl gene fragment and a promoter psid gene fragment by using the C.glutamcum genome as a template, overlapping, and connecting with a pXMJ19GZ plasmid to obtain an over-expression plasmid icl-pXMJ19GZ. Enzyme digestion verification is carried out on the over-expression plasmid, as shown in figure 7, 6500bp and 1600bp fragments are obtained after enzyme digestion, the sizes of the fragments are consistent with those of the pXMJ19GZ plasmid, the icl gene and the promoter psod gene overlapping fragments, and the success of construction of the recombinant over-expression plasmid is also shown.

Then, the over-expression plasmid icl-pXMJ19GZ is transferred to the engineering bacterium C.glutamicum/icd-ms delta lldh which is verified to be correct by electric transformation, and then a single colony growing on a solid culture medium containing chloramphenicol is picked for bacterial liquid PCR verification, as shown in FIG. 8, the size of the amplified icl gene is consistent with that of a positive control strip, which can prove that the engineering bacterium C.glutamicum/icl is successfully constructed.

Finally, in order to verify the glyoxylate synthesis capacity of the engineering strain C.glutamicum/icl obtained by the method of the embodiment, the obtained engineering strain C.glutamicum/icl and the wild strain C.glutamicum mATCC 13032 are respectively inoculated into a seed culture medium, the temperature is 30 ℃,180r/min, shaking flask shaking overnight culture is carried out, the obtained engineering strain C.glutamicum/icl and the wild strain C.glutamicum mATCC 13032 are respectively inoculated into a CD culture medium containing 5% glucose at equal OD values, shaking flask shaking culture is carried out for 48h under the same conditions, timed sampling is carried out, and the growth concentration of thalli is measured. The growth conditions of the two are shown in FIG. 9, and it can be seen from FIG. 9 that the growth trends of the wild strain and C.glutamicum/icl are almost the same, which shows that the expression levels of icd and ms genes are reduced while the aldh and lldh genes are knocked out, the glycolysis pathway and TCA cycle of the C.glutamicum strain are not affected, and the strain can grow normally.

And detecting the yield of glyoxylic acid in the fermentation liquid of the engineering strain, inoculating the engineering strain C.glutamcum/icl and the wild strain C.glutamcum ATCC 13032 into a CD culture medium containing 5 percent of glucose at equal OD values, fermenting the CD culture medium by taking 5 percent of glucose as a carbon source, continuously culturing for 48h, and collecting the fermentation liquid. Samples were taken periodically during the culture and the cell growth concentration was measured.

After the culture is finished, centrifuging the reserved sample to be detected for 10min at 8000r/min, sucking the supernatant, filtering and diluting the supernatant by using a 0.22 mu m cellulose acetate filter membrane, and detecting the content of glyoxylate in the fermentation liquid by using a high performance liquid chromatography. The detection conditions are set as follows: agilent 1200 high performance liquid chromatograph, ultraviolet detector, BDS HYPERSIL C column, 4.6X 200mm, mobile phase is 20mmol/L KH2PO4 (pH2.8) and acetonitrile mixed solution, detection wavelength is 210nm, column temperature is 29 ℃, flow rate is 0.5mL/min, and sample injection amount is 20 muL.

The detection result is shown in fig. 10 and fig. 11, and the content of glyoxylate in the engineering bacterium c.glutamcum/icl fermentation broth is 5mg/mL through calculation, while glyoxylate in the wild bacterium c.glutamcum fermentation broth is hardly accumulated. Therefore, in the glyoxylate metabolic pathway of engineering bacteria C.glutamicum/icl, the expression of a malate synthase gene and an isocitrate dehydrogenase encoding gene is reduced by knocking out the lactate dehydrogenase encoding gene, so that the glyoxylate metabolic pathway branch is cut off, and the formation of byproducts is restrained, thereby accumulating glyoxylate, realizing the unprecedented process and being beneficial to the biosynthesis of glyoxylate.

In this embodiment, the CRISPRi technology is used, the expression of target genes, i.e., isocitrate dehydrogenase and malate synthase, can be regulated at the transcriptional level, the disadvantages of the conventional gene knockout method can be avoided, and the metabolic pathway of c. Meanwhile, the method can strengthen the expression of isocitrate lyase, block the formation of lactic acid which is a metabolite of a tributary, ensure that the growth speed of engineering bacteria is basically the same as that of a wild type, and achieve the aim of biosynthesizing glyoxylate without influencing growth, thereby laying a foundation for biosynthesizing production of glyoxylate and providing reference for the research of other metabolic engineering products.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and should not be taken as limiting the scope of the present invention, which is intended to cover any modifications, equivalents, improvements, etc. within the spirit and scope of the present invention.

SEQUENCE LISTING

<110> university of Hebei science and technology

<120> CRISPR-based method for synthesizing glyoxylic acid by utilizing corynebacterium glutamicum

<130> 13126

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 4107

<212> DNA

<213> Streptococcus pyogenes

<400> 1

atggataaga aatactcaat aggcttagct atcggcacaa atagcgtcgg atgggcggtg 60

atcactgatg aatataaggt tccgtctaaa aagttcaagg ttctgggaaa tacagaccgc 120

cacagtatca aaaaaaatct tataggggct cttttatttg acagtggaga gacagcggaa 180

gcgactcgtc tcaaacggac agctcgtaga aggtatacac gtcggaagaa tcgtatttgt 240

tatctacagg agattttttc aaatgagatg gcgaaagtag atgatagttt ctttcatcga 300

cttgaagagt cttttttggt ggaagaagac aagaagcatg aacgtcatcc tatttttgga 360

aatatagtag atgaagttgc ttatcatgag aaatatccaa ctatctatca tctgcgaaaa 420

aaattggtag attctactga taaagcggat ttgcgcttaa tctatttggc cttagcgcat 480

atgattaagt ttcgtggtca ttttttgatt gagggagatt taaatcctga taatagtgat 540

gtggacaaac tatttatcca gttggtacaa acctacaatc aattatttga agaaaaccct 600

attaacgcaa gtggagtaga tgctaaagcg attctttctg cacgattgag taaatcaaga 660

cgattagaaa atctcattgc tcagctcccc ggtgagaaga aaaatggctt atttgggaat 720

ctcattgctt tgtcattggg tttgacccct aattttaaat caaattttga tttggcagaa 780

gatgctaaat tacagctttc aaaagatact tacgatgatg atttagataa tttattggcg 840

caaattggag atcaatatgc tgatttgttt ttggcagcta agaatttatc agatgctatt 900

ttactttcag atatcctaag agtaaatact gaaataacta aggctcccct atcagcttca 960

atgattaaac gctacgatga acatcatcaa gacttgactc ttttaaaagc tttagttcga 1020

caacaacttc cagaaaagta taaagaaatc ttttttgatc aatcaaaaaa cggatatgca 1080

ggttatattg atgggggagc tagccaagaa gaattttata aatttatcaa accaatttta 1140

gaaaaaatgg atggtactga ggaattattg gtgaaactaa atcgtgaaga tttgctgcgc 1200

aagcaacgga cctttgacaa cggctctatt ccccatcaaa ttcacttggg tgagctgcat 1260

gctattttga gaagacaaga agacttttat ccatttttaa aagacaatcg tgagaagatt 1320

gaaaaaatct tgacttttcg aattccttat tatgttggtc cattggcgcg tggcaatagt 1380

cgttttgcat ggatgactcg gaagtctgaa gaaacaatta ccccatggaa ttttgaagaa 1440

gttgtcgata aaggtgcttc agctcaatca tttattgaac gcatgacaaa ctttgataaa 1500

aatcttccaa atgaaaaagt actaccaaaa catagtttgc tttatgagta ttttacggtt 1560

tataacgaat tgacaaaggt caaatatgtt actgaaggaa tgcgaaaacc agcatttctt 1620

tcaggtgaac agaagaaagc cattgttgat ttactcttca aaacaaatcg aaaagtaacc 1680

gttaagcaat taaaagaaga ttatttcaaa aaaatagaat gttttgatag tgttgaaatt 1740

tcaggagttg aagatagatt taatgcttca ttaggtacct accatgattt gctaaaaatt 1800

attaaagata aagatttttt ggataatgaa gaaaatgaag atatcttaga ggatattgtt 1860

ttaacattga ccttatttga agatagggag atgattgagg aaagacttaa aacatatgct 1920

cacctctttg atgataaggt gatgaaacag cttaaacgtc gccgttatac tggttgggga 1980

cgtttgtctc gaaaattgat taatggtatt agggataagc aatctggcaa aacaatatta 2040

gattttttga aatcagatgg ttttgccaat cgcaatttta tgcagctgat ccatgatgat 2100

agtttgacat ttaaagaaga cattcaaaaa gcacaagtgt ctggacaagg cgatagttta 2160

catgaacata ttgcaaattt agctggtagc cctgctatta aaaaaggtat tttacagact 2220

gtaaaagttg ttgatgaatt ggtcaaagta atggggcggc ataagccaga aaatatcgtt 2280

attgaaatgg cacgtgaaaa tcagacaact caaaagggcc agaaaaattc gcgagagcgt 2340

atgaaacgaa tcgaagaagg tatcaaagaa ttaggaagtc agattcttaa agagcatcct 2400

gttgaaaata ctcaattgca aaatgaaaag ctctatctct attatctcca aaatggaaga 2460

gacatgtatg tggaccaaga attagatatt aatcgtttaa gtgattatga tgtcgatgcc 2520

attgttccac aaagtttcct taaagacgat tcaatagaca ataaggtctt aacgcgttct 2580

gataaaaatc gtggtaaatc ggataacgtt ccaagtgaag aagtagtcaa aaagatgaaa 2640

aactattgga gacaacttct aaacgccaag ttaatcactc aacgtaagtt tgataattta 2700

acgaaagctg aacgtggagg tttgagtgaa cttgataaag ctggttttat caaacgccaa 2760

ttggttgaaa ctcgccaaat cactaagcat gtggcacaaa ttttggatag tcgcatgaat 2820

actaaatacg atgaaaatga taaacttatt cgagaggtta aagtgattac cttaaaatct 2880

aaattagttt ctgacttccg aaaagatttc caattctata aagtacgtga gattaacaat 2940

taccatcatg cccatgatgc gtatctaaat gccgtcgttg gaactgcttt gattaagaaa 3000

tatccaaaac ttgaatcgga gtttgtctat ggtgattata aagtttatga tgttcgtaaa 3060

atgattgcta agtctgagca agaaataggc aaagcaaccg caaaatattt cttttactct 3120

aatatcatga acttcttcaa aacagaaatt acacttgcaa atggagagat tcgcaaacgc 3180

cctctaatcg aaactaatgg ggaaactgga gaaattgtct gggataaagg gcgagatttt 3240

gccacagtgc gcaaagtatt gtccatgccc caagtcaata ttgtcaagaa aacagaagta 3300

cagacaggcg gattctccaa ggagtcaatt ttaccaaaaa gaaattcgga caagcttatt 3360

gctcgtaaaa aagactggga tccaaaaaaa tatggtggtt ttgatagtcc aacggtagct 3420

tattcagtcc tagtggttgc taaggtggaa aaagggaaat cgaagaagtt aaaatccgtt 3480

aaagagttac tagggatcac aattatggaa agaagttcct ttgaaaaaaa tccgattgac 3540

tttttagaag ctaaaggata taaggaagtt aaaaaagact taatcattaa actacctaaa 3600

tatagtcttt ttgagttaga aaacggtcgt aaacggatgc tggctagtgc cggagaatta 3660

caaaaaggaa atgagctggc tctgccaagc aaatatgtga attttttata tttagctagt 3720

cattatgaaa agttgaaggg tagtccagaa gataacgaac aaaaacaatt gtttgtggag 3780

cagcataagc attatttaga tgagattatt gagcaaatca gtgaattttc taagcgtgtt 3840

attttagcag atgccaattt agataaagtt cttagtgcat ataacaaaca tagagacaaa 3900

ccaatacgtg aacaagcaga aaatattatt catttattta cgttgacgaa tcttggagct 3960

cccgctgctt ttaaatattt tgatacaaca attgatcgta aacgatatac gtctacaaaa 4020

gaagttttag atgccactct tatccatcaa tccatcactg gtctttatga aacacgcatt 4080

gatttgagtc agctaggagg tgactaa 4107

<210> 2

<211> 2220

<212> DNA

<213> Corynebacterium glutamicum

<400> 2

atgactgaac aggaactgtt gtctgctcag actgccgaca acgctggaac tgacagcacc 60

gaacgcgttg acgcgggcgg aatgcaggtt gcaaaagttc tctacgactt tgtaaccgaa 120

gcggtactcc ctcgcgtggg tgtggatgcg gaaaagttct ggtccggatt cgccgccatc 180

gcccgggacc tcaccccacg caaccgcgag ctgcttgctc gccgcgatga actgcagatg 240

cttatcgacg actaccaccg caacaactcc ggcaccatcg accaagaggc gtacgaggat 300

ttcctcaaag aaatcggata cttggttgag gagccagaag ctgcagaaat ccgtacccaa 360

aacgtcgata cggaaatctc cagcaccgca ggacctcagc tggttgttcc aattctgaac 420

gcacgcttcg cgctgaacgc tgccaatgct cgctggggtt ccctctacga tgcgttgtac 480

ggcaccaacg ccatcccaga aactgatggc gctgaaaagg gcaaggagta caacccggtc 540

cgcggccaga aggtcatcga gtggggtcgt gaattcctcg acagcgttgt cccactggac 600

ggtgcttcgc atgccgatgt tgagaagtac aacatcaccg atggaaagct tgcagcccac 660

attggagata gcgtctaccg actgaaaaac cgtgaatcct accgtggctt caccggcaac 720

ttccttgatc cagaagcaat cctgctggaa accaacggcc tgcacatcga gctgcagatc 780

gatcctgtcc acccaatcgg caaggcagac aagactggtc tcaaagacat cgttttggaa 840

tctgcgatca ccacgatcat ggacttcgaa gactccgttg cagctgttga tgctgaagac 900

aagaccttag gttactctaa ctggttcgga ctcaacaccg gcgaactgaa agaagagatg 960

tccaagaacg gacgcatctt cacccgtgag ctcaacaagg accgcgtcta cattggccgc 1020

aatggtaccg agctggttct gcacggtcgt tccctgctgt tcgtccgcaa cgttggtcac 1080

ctcatgcaaa acccatccat cttgattgat ggcgaggaga tcttcgaagg catcatggat 1140

gctgtcttga ccactgtttg tgccatccca ggaattgctc cgcagaacaa gatgcgcaat 1200

tcccgcaagg gctccatcta catcgtgaag cctaagcagc acggccctga agaagtcgcg 1260

ttcaccaacg agctcttcgg ccgcgttgag gatctgcttg atctgccacg ccacaccttg 1320

aaggttggtg ttatggatga ggagcgtcgc acgtccgtga acctggatgc cagcatcatg 1380

gaagttgctg accgcttggc attcatcaac actggcttcc tggaccgcac cggcgatgaa 1440

atccacacct ccatggaagc aggcgccatg gtgcgcaagg ctgatatgca gaccgcaccg 1500

tggaagcagg cctacgagaa caacaacgtt gatgcaggta ttcagcgtgg tcttcctggc 1560

aaggctcaga tcggtaaggg catgtgggcg atgactgaac tcatggcaga aatgctggag 1620

aagaagatcg gccagccacg cgaaggcgcc aacactgcat gggttccttc accaactggt 1680

gcgacgctgc acgcaacgca ctaccacttg gttgatgtgt tcaaggttca agacgaactg 1740

cgtgctgccg gccgccgcga cagcctgcgc aacattctca ccattccaac cgcaccaaac 1800

accaattggt ctgaggaaga gaagaaggaa gagatggaca acaactgcca gtccatcctc 1860

ggatacgttg tgcgctgggt tgagcacggt gttggttgct ccaaggttcc agacatccat 1920

gacatcgacc tcatggaaga ccgcgcaacg ctgcgtattt cctcgcagat gctggccaac 1980

tggatccgcc atgatgttgt ctcgaaggag caggtcttgg agtcactgga acgaatggca 2040

gtggtcgtcg acaagcaaaa tgcgggcgac gaggcctacc gcgatatggc gccgaactac 2100

gacgcctccc tcgccttcca ggcggctaag gacttgattt tcgaaggcac caagtcccca 2160

tcgggctaca ccgagcccat cttgcacgca cgccgccgcg agttcaaagc aaaaaactaa 2220

<210> 3

<211> 2217

<212> DNA

<213> Corynebacterium glutamicum

<400> 3

atggctaaga tcatctggac ccgcaccgac gaagcaccgc tgctcgcgac ctactcgctg 60

aagccggtcg tcgaggcatt tgctgctacc gcgggcattg aggtcgagac ccgggacatt 120

tcactcgctg gacgcatcct cgcccagttc ccagagcgcc tcaccgaaga tcagaaggta 180

ggcaacgcac tcgcagaact cggcgagctt gctaagactc ctgaagcaaa catcattaag 240

cttccaaaca tctccgcttc tgttccacag ctcaaggctg ctattaagga actgcaggac 300

cagggctacg acatcccaga actgcctgat aacgccacca ccgacgagga aaaagacatc 360

ctcgcacgct acaacgctgt taagggttcc gctgtgaacc cagtgctgcg tgaaggcaac 420

tctgaccgcc gcgcaccaat cgctgtcaag aactttgtta agaagttccc acaccgcatg 480

ggcgagtggt ctgcagattc caagaccaac gttgcaacca tggatgcaaa cgacttccgc 540

cacaacgaga agtccatcat cctcgacgct gctgatgaag ttcagatcaa gcacatcgca 600

gctgacggca ccgagaccat cctcaaggac agcctcaagc ttcttgaagg cgaagttcta 660

gacggaaccg ttctgtccgc aaaggcactg gacgcattcc ttctcgagca ggtcgctcgc 720

gcaaaggcag aaggtatcct cttctccgca cacctgaagg ccaccatgat gaaggtctcc 780

gacccaatca tcttcggcca cgttgtgcgc gcttacttcg cagacgtttt cgcacagtac 840

ggtgagcagc tgctcgcagc tggcctcaac ggcgaaaacg gcctcgctgc aatcctctcc 900

ggcttggagt ccctggacaa cggcgaagaa atcaaggctg cattcgagaa gggcttggaa 960

gacggcccag acctggccat ggttaactcc gctcgcggca tcaccaacct gcatgtccct 1020

tccgatgtca tcgtggacgc ttccatgcca gcaatgattc gtacctccgg ccacatgtgg 1080

aacaaagacg accaggagca ggacaccctg gcaatcatcc cagactcctc ctacgctggc 1140

gtctaccaga ccgttatcga agactgccgc aagaacggcg cattcgatcc aaccaccatg 1200

ggtaccgtcc ctaacgttgg tctgatggct cagaaggctg aagagtacgg ctcccatgac 1260

aagaccttcc gcatcgaagc agacggtgtg gttcaggttg tttcctccaa cggcgacgtt 1320

ctcatcgagc acgacgttga ggcaaatgac atctggcgtg catgccaggt caaggatgcc 1380

ccaatccagg attgggtaaa gcttgctgtc acccgctccc gtctctccgg aatgcctgca 1440

gtgttctggt tggatccaga gcgcgcacac gaccgcaacc tggcttccct cgttgagaag 1500

tacctggctg accacgacac cgagggcctg gacatccaga tcctctcccc tgttgaggca 1560

acccagctct ccatcgaccg catccgccgt ggcgaggaca ccatctctgt caccggtaac 1620

gttctgcgtg actacaacac cgacctcttc ccaatcctgg agctgggcac ctctgcaaag 1680

atgctgtctg tcgttccttt gatggctggc ggcggactgt tcgagaccgg tgctggtgga 1740

tctgctccta agcacgtcca gcaggttcag gaagaaaacc acctgcgttg ggattccctc 1800

ggtgagttcc tcgcactggc tgagtccttc cgccacgagc tcaacaacaa cggcaacacc 1860

aaggccggcg ttctggctga cgctctggac aaggcaactg agaagctgct gaacgaagag 1920

aagtccccat cccgcaaggt tggcgagatc gacaaccgtg gctcccactt ctggctgacc 1980

aagttctggg ctgacgagct cgctgctcag accgaggacg cagatctggc tgctaccttc 2040

gcaccagtcg cagaagcact gaacacaggc gctgcagaca tcgatgctgc actgctcgca 2100

gttcagggtg gagcaactga ccttggtggc tactactccc ctaacgagga gaagctcacc 2160

aacatcatgc gcccagtcgc acagttcaac gagatcgttg acgcactgaa gaagtaa 2217

<210> 4

<211> 1521

<212> DNA

<213> Corynebacterium glutamicum

<400> 4

atgactgtct acgcaaatcc aggaaccgaa ggctcgatcg ttaactatga aaagcgctac 60

gagaactaca ttggtggcaa gtgggttcca ccggtagagg gccagtacct tgagaacatt 120

tcacctgtca ctggtgaagt tttctgtgag gtcgcacgtg gcaccgcagc ggacgtggag 180

cttgcactgg atgctgcaca tgcagccgct gatgcgtggg gcaagacttc tgtcgctgaa 240

cgtgctctga tcctgcaccg cattgcggac cgcatggaag agcacctgga agaaatcgca 300

gttgcagaaa cctgggagaa cggcaaggca gtccgtgaga ctcttgctgc agatatccca 360

ctggcaatcg accacttccg ctactttgct ggcgcgatcc gtgctcagga agatcgttcc 420

tcacagatcg accacaacac tgttgcttac cacttcaacg agccaatcgg tgttgttggt 480

cagatcattc cttggaactt cccaatcctc atggctacct ggaagctcgc accggcactt 540

gctgcaggta acgcgatcgt catgaagcca gctgagcaga ccccagcatc cattttgtat 600

ctgattaaca tcatcggcga tctcatccca gagggcgtcc tcaacatcgt caacggactc 660

ggcggtgaag caggcgctgc actgtccggc tctaatcgga ttggcaagat tgctttcacc 720

ggttccaccg aggtcggcaa gctgatcaac cgcgctgcat ccgacaagat cattcctgtc 780

accctggagc tcggcggtaa gtccccatcc atcttcttct ccgatgttct gtcacaggat 840

gacgccttcg cagagaaggc agttgaaggc ttcgcgatgt tcgccctcaa tcagggtgaa 900

gtttgtacct gtccttcccg tgcacttgtt catgagtcca tcgctgatga attcctcgag 960

cttggcgtga agcgagttca gaacatcaag ctgggtaacc cacttgatac tgaaaccatg 1020

atgggtgctc aggcgtccca ggagcagatg gacaagatct cctcctacct gaagatcggc 1080

ccagaagaag gcgctcaaac cctcactggt ggcaaggtca acaaggttga tggcatggag 1140

aacggttact acattgagcc aaccgttttc cgcggcacca acgacatgag gatcttccgc 1200

gaggaaatct tcggaccagt cctttctgtt gctaccttca gcgacttcga tgaggccatc 1260

cgtattgcaa acgacaccaa ctacggcctc ggcgctggtg tctggagccg tgaccaaaac 1320

accatttatc gtgcaggtcg cgcaatccag gctggtcgag tttgggtcaa ccagtaccac 1380

aactacccag cgcactccgc tttcggtgga tacaaggagt ccggcatcgg ccgtgagaac 1440

cacctcatga tgctgaacca ctaccagcag accaagaacc tgttggtctc ctacgatcca 1500

aacccaaccg gactgttctg a 1521

<210> 5

<211> 945

<212> DNA

<213> Corynebacterium glutamicum

<400> 5

atgaaagaaa ccgtcggtaa caagattgtc ctcattggcg caggagatgt tggagttgca 60

tacgcatacg cactgatcaa ccagggcatg gcagatcacc ttgcgatcat cgacatcgat 120

gaaaagaaac tcgaaggcaa cgtcatggac ttaaaccatg gtgttgtgtg ggccgattcc 180

cgcacccgcg tcaccaaggg cacctacgct gactgcgaag acgcagccat ggttgtcatt 240

tgtgccggcg cagcccaaaa gccaggcgag acccgcctcc agctggtgga caaaaacgtc 300

aagattatga aatccatcgt cggcgatgtc atggacagcg gattcgacgg catcttcctc 360

gtggcgtcca acccagtgga tatcctgacc tacgcagtgt ggaaattctc cggcttggaa 420

tggaaccgcg tgatcggctc cggaactgtc ctggactccg ctcgattccg ctacatgctg 480

ggcgaactct acgaagtggc accaagctcc gtccacgcct acatcatcgg cgaacacggc 540

gacactgaac ttccagtcct gtcctccgcg accatcgcag gcgtatcgct tagccgaatg 600

ctggacaaag acccagagct tgagggccgt ctagagaaaa ttttcgaaga cacccgcgac 660

gctgcctatc acattatcga cgccaagggc tccacttcct acggcatcgg catgggtctt 720

gctcgcatca cccgcgcaat cctgcagaac caagacgttg cagtcccagt ctctgcactg 780

ctccacggtg aatacggtga ggaagacatc tacatcggca ccccagctgt ggtgaaccgc 840

cgaggcatcc gccgcgttgt cgaactagaa atcaccgacc acgagatgga acgcttcaag 900

cattccgcaa ataccctgcg cgaaattcag aagcagttct tctaa 945

Claims (10)

1. A method for synthesizing glyoxylic acid by utilizing corynebacterium glutamicum based on CRISPII regulation and control is characterized by comprising the following steps: the method comprises the steps of replacing an acetaldehyde dehydrogenase coding gene of corynebacterium glutamicum through a dCas9 expression cassette gene, replacing a lactate dehydrogenase coding gene of the corynebacterium glutamicum through an sgRNA transcription unit of the isocitrate dehydrogenase coding gene and a malate synthase coding gene, over-expressing the isocitrate lyase coding gene of the corynebacterium glutamicum to obtain a corynebacterium glutamicum engineering strain, and culturing the engineering strain to synthesize glyoxylic acid through fermentation;

wherein the sequence of the dCas9 expression cassette gene is shown as SEQ ID NO. 1;

the sequence of the malate synthase coding gene is shown as SEQ ID NO. 2;

the sequence of the isocitrate dehydrogenase encoding gene is shown in SEQ ID NO 3;

the sequence of the acetaldehyde dehydrogenase coding gene is shown as SEQ ID NO. 4;

the sequence of the lactate dehydrogenase coding gene is shown as SEQ ID NO. 5.

2. The method for synthesizing glyoxylic acid by using corynebacterium glutamicum based on CRISPRi regulation of claim 1, wherein the method comprises the following steps: the replacement of the acetaldehyde dehydrogenase coding gene by the dCas9 expression cassette gene comprises the steps of constructing a dCas9 expression cassette gene targeting plasmid, transferring the dCas9 expression cassette gene targeting plasmid into a wild Corynebacterium glutamicum strain through electrotransformation, and replacing the acetaldehyde dehydrogenase coding gene by the dCas9 expression cassette gene through two times of homologous recombination.

3. The method for synthesizing glyoxylic acid by using corynebacterium glutamicum based on CRISPRi regulation of claim 2, wherein the method comprises the following steps: the construction of the dCas9 expression cassette gene targeting plasmid comprises the following steps:

a1. amplifying upper and lower homologous arm segments of an aldehyde dehydrogenase coding gene and a promoter posd gene segment by using a corynebacterium glutamicum genome as a template;

a2. dCas9-Peasy plasmid is taken as a template, and dCas9 gene segments are amplified;

a3. overlapping the gene fragments amplified in the steps a1 and a2 by a fusion PCR technology;

a4. and (2) carrying out double enzyme digestion on the lapped fragment obtained in the step a3 and an empty plasmid pK18mobsacB by using Nhe I and Xho I, purifying an obtained enzyme digestion product, connecting the enzyme digestion product by using T4 ligase at 16 ℃ overnight, transforming the enzyme digestion product into E.coli TransT1 competent cells, and carrying out verification screening to obtain a targeting plasmid dCas9-pK18mobsacB.

4. The method for synthesizing glyoxylic acid by using corynebacterium glutamicum based on CRISPRi regulation of claim 2, wherein the method comprises the following steps: the replacement of the lactate dehydrogenase coding gene by the sgRNA transcription unit of the isocitrate dehydrogenase coding gene and the malate synthase coding gene comprises the steps of constructing a sgRNA transcription unit targeting plasmid of the isocitrate dehydrogenase coding gene and the malate synthase coding gene, transferring the sgRNA transcription unit targeting plasmid into a corynebacterium glutamicum strain in which the acetaldehyde dehydrogenase coding gene is replaced by a dCas9 expression cassette gene through electric transformation, and replacing the lactate dehydrogenase coding gene by the sgRNA transcription unit of the isocitrate dehydrogenase coding gene and the malate synthase coding gene through two times of homologous recombination.

5. The CRISPII-based controlled method for synthesizing glyoxylic acid using C.glutamicum according to claim 4, wherein: the construction of the sgRNA transcription unit targeting plasmid of the isocitrate dehydrogenase coding gene and the malate synthase coding gene comprises the following steps:

b1. amplifying the upper and lower homologous arm segments of the lactate dehydrogenase coding gene by taking the corynebacterium glutamicum genome as a template;

b2. amplifying an sgRNA transcription unit component of an isocitrate dehydrogenase encoding gene and an sgRNA transcription unit component of a malate synthase encoding gene by utilizing fusion PCR, wherein the sgRNA transcription unit component of the isocitrate dehydrogenase encoding gene comprises a promoter psod gene sequence, a 20bp sgRNA gene sequence, a Cas9 protein binding region gene sequence and a terminator rrnB gene sequence, and the sgRNA transcription unit component of the malate synthase encoding gene comprises a promoter ptuf gene sequence, a 20bp sgRNA gene sequence, a Cas9 protein binding region gene sequence and a terminator rrnB gene sequence;

b3. and (3) constructing sgRNA transcription unit targeting plasmids of the isocitrate dehydrogenase coding gene and the malate synthase coding gene by using the upper and lower homologous arm fragments in the step b1 and sgRNA components of the isocitrate dehydrogenase coding gene and the malate synthase coding gene in the step b2 through a Golden Gate cloning method.

6. The CRISPII-based controlled method for synthesizing glyoxylic acid using C.glutamicum according to claim 4, wherein: the isocitrate lyase coding gene of the over-expressed corynebacterium glutamicum comprises the steps of constructing an isocitrate lyase coding gene over-expression plasmid, transferring the isocitrate lyase coding gene over-expression plasmid into a corynebacterium glutamicum strain in which an acetaldehyde dehydrogenase coding gene is replaced by a dCas9 expression cassette gene and an sgRNA transcription unit of the isocitrate dehydrogenase coding gene and an malate synthase coding gene replaces a lactate dehydrogenase coding gene through electric transformation, and over-expressing an isocitrate lyase synthesis gene to obtain the corynebacterium glutamicum engineering strain.

7. The method for synthesizing glyoxylic acid by using corynebacterium glutamicum based on CRISPRi regulation of claim 6, wherein the following steps are included: the construction of the isocitrate lyase coding gene overexpression plasmid comprises the following steps:

c1. amplifying a promoter psod gene segment, an isocitrate lyase coding gene segment and a terminator rrnB gene segment by taking a corynebacterium glutamicum genome as a template, and overlapping;

c2. and carrying out double enzyme digestion on the c1 lapped fragment and the pXMJ19GZ plasmid by utilizing HindIII and BamHI, purifying an obtained enzyme digestion product, connecting the enzyme digestion product and the T4 ligase at 16 ℃ overnight, transforming the enzyme digestion product into E.coli TransT1 competent cells, and carrying out verification screening to obtain an isocitrate lyase coding gene overexpression plasmid.

8. The method for synthesizing glyoxylic acid by using corynebacterium glutamicum based on CRISPRi regulation of claim 6, wherein the following steps are included: the electrically transformed transformation of the dCas9 expression cassette gene targeting plasmid, the sgRNA transcription unit targeting plasmid or the isocitrate lyase coding gene overexpression plasmid into the corynebacterium glutamicum strain comprises the following steps:

d1. inoculating the overnight cultured corynebacterium glutamicum strain into a seed culture medium according to the inoculation amount of 10%, shaking and culturing, centrifuging at 4000r/min at 4 ℃ when OD600 reaches 0.5-0.7, collecting thalli, removing supernatant, adding 10% glycerol, and gently washing twice to obtain corynebacterium glutamicum competent cells;

d2. sucking plasmids and corynebacterium glutamicum competent cells, mixing the cells in a centrifugal tube in a flick mode, transferring the cells into an electric shock cup, standing for 5min, and starting electric shock under the conditions of 2.5kV/m voltage, 250 omega resistance and 25 muF capacitance;

d3. immediately adding a preheated incubation culture medium into the electric shock cup after electric shock is finished, transferring the mixture into a centrifuge tube after heavy suspension and mixing, heating the mixture in a constant temperature heater at 48 ℃ for 6min, and then culturing the mixture at 30 ℃ for 4h at 180 r/min;

d4. centrifuging, removing supernatant, spreading the bacterial liquid on LB solid medium plate containing kanamycin, and culturing at constant temperature of 30 ℃ for 48-72h.

9. The method for synthesizing glyoxylic acid by using corynebacterium glutamicum based on CRISPRi regulation of claim 6, wherein the following steps are included: the dCas9 expression cassette gene replaces an acetaldehyde dehydrogenase coding gene, the isocitrate dehydrogenase coding gene and an sgRNA transcription unit of the malate synthase coding gene replaces a lactate dehydrogenase coding gene, wherein the two homologous recombinations comprise:

e1. after the plasmid is electrically transformed into the corynebacterium glutamicum strain for 48-72 hours, carrying out molecular verification on a single colony growing on a solid culture medium containing kanamycin, and determining that the plasmid is subjected to first homologous recombination and is integrated onto a corynebacterium glutamicum chromosome;

e2. selecting a positive single colony which is determined to generate the first homologous recombination, transferring the positive single colony into an incubation culture medium, culturing for 12 hours at 30 ℃ and 180r/min, enabling the positive single colony to freely grow under the antibiotic-free condition, and generating the second homologous recombination;

e3. the bacterial liquid was diluted and spread on LB solid medium containing 10% sucrose, and cultured overnight at 30 ℃. Correspondingly expanding and culturing the grown transformants on an LB solid culture medium containing 10% of cane sugar and kanamycin one by one;

e4. positive transformants were determined for the strains which underwent the second homologous recombination based on single colonies which grew on the sucrose-containing medium but not on the kanamycin-containing medium, and the obtained positive transformants were verified by PCR of the inoculum.

10. The method for synthesizing glyoxylic acid by using corynebacterium glutamicum based on CRISPRi regulation according to any one of claims 1 to 9, wherein: the culture of the engineering strain for fermenting and synthesizing the glyoxylic acid comprises the steps of inoculating the engineering strain into a seed culture medium, shaking at 30 ℃ and 180r/min for overnight culture, then inoculating into a CD culture medium containing 5% of glucose for shaking culture, and sampling at regular time during culture to determine the growth concentration of thalli.

Images