CN114015634B - Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof - Google Patents
Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof Download PDFInfo
- Publication number
- CN114015634B CN114015634B CN202111299764.1A CN202111299764A CN114015634B CN 114015634 B CN114015634 B CN 114015634B CN 202111299764 A CN202111299764 A CN 202111299764A CN 114015634 B CN114015634 B CN 114015634B
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- plasmid
- succinic acid
- gene
- ompr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/44—Polycarboxylic acids
- C12P7/46—Dicarboxylic acids having four or less carbon atoms, e.g. fumaric acid, maleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
- C12Y102/01002—Formate dehydrogenase (1.2.1.2)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the technical field of bioengineering, in particular to recombinant escherichia coli for high yield of succinic acid and a construction method and application thereof. Among them, the recombinant Escherichia coli highly producing succinic acid is a gene fdhF encoding formate dehydrogenase in Escherichia coli by replacing formate dehydrogenase gene fdh1 derived from Candida, and up-regulates the outer membrane protein regulator OmpR resistant to acid stress and osmotic stress. The invention adopts CRISPR-cas9 gene editing technology to replace the coding formate dehydrogenase gene fdhF in the host bacteria FMME-N-5 with the formate dehydrogenase gene fdh1 of candida, and utilizes RBS sequence and promoter strategy to up-regulate the key outer membrane protein regulator OmpR which is resistant to acid stress and osmotic stress, and the obtained recombinant escherichia coli has no resistance, is resistant to osmotic pressure and can efficiently produce succinic acid.
Description
Technical Field
The invention relates to the technical field of bioengineering, in particular to recombinant escherichia coli with high succinic acid yield and a construction method and application thereof.
Background
Succinic acid, also known as succinic acid, is an important C4 platform compound. Succinic acid is widely used as a starting material for synthesizing general-purpose chemicals in the fields of food, chemistry, medicine, and the like. The traditional production method of succinic acid is a chemical synthesis method, mainly comprises a paraffin oxidation method, a methyl chloroacetate cyaniding hydrolysis method, a vanadium pentoxide catalytic hydrogenation method and the like, but the defects of the chemical synthesis method are increasingly shown due to the problems of reduction of petroleum resources, increasingly serious environmental pollution and the like. The succinic acid is produced by a fermentation method, so that the dependence on non-renewable strategic resource, namely petroleum, can be avoided, renewable resources are utilized, carbon dioxide is fixed, the greenhouse effect is reduced, and a good development prospect is shown.
Currently, most studied succinic acid-producing strains include: actinobacillus succinogenes, anaerobiospirillum succinogenes and Escherichia coli. Actinobacillus succinogenes is usually obtained by targeted engineering after screening from nature, and can tolerate succinate with high concentration. Guettler M et al, which uses glucose as carbon source to ferment for 48h to produce succinic acid by using Actinobacillus succinogenes FZ53 as mutant strainThe maximum yield of 110g/L is achieved. However, there have been few studies on a succinic acid-producing actinobacillus species, and further studies on their physiological properties, fermentation performance and genetic background are required. A wide variety of fermentation substrates can be utilized by anaerobiospirillum succinogenes, such as glucose, lactose, glycerol, and the like. The research result of Samuelov et al shows that under the optimal condition, the succinic acid yield of the anaerobiospirillum succinogenes can reach 1.2mol/1.0mol glucose, and the maximum yield is 65.0g/L, but the strain fermentation needs strict anaerobic environment, and the method is difficult to realize in industrial application. Escherichia coli is used as a model strain, the genetic background is clear, the operation is easy, and various molecular biology techniques can be adopted to modify the strain, so that the fermentation of succinic acid by adopting the Escherichia coli becomes a hotspot, and the research has made a lot of progress. Li Jiaojiao and so on, using Escherichia coli YL104H, according to the ratio of glucose and xylose 1:2, carrying out two-stage fermentation for 65H, wherein the final concentration of succinic acid is 61.66g/L, and the production intensity is 0.95g/L/H; vemuri and the like perform two-stage fermentation for 76h by using recombinant Escherichia coli AFP111, the final concentration of succinic acid can reach 99.2g/L, the yield reaches 1.1g/g glucose, and the production intensity reaches 1.3g/L/h; zhang Xueli and the like construct and obtain recombinant Escherichia coli HX024 by using genetic engineering and an adaptive evolution strategy, and the recombinant Escherichia coli HX024 is fermented for 96 hours by adopting a one-step anaerobic method, so that the final succinic acid yield reaches 95.9g/L, and the yield reaches 1g/g glucose; zhu Liwen et al, optimized for expression of ppc and pck genes in combination, enhanced CO 2 Fixing the path, fermenting the recombinant Escherichia coli AFP111 strain for 96h, wherein the succinic acid yield reaches 90.7g/L; zhang Jianguo and the like knock out a byproduct acetic acid coding gene by optimizing a glucose absorption metabolic pathway, and fermenting for 65 hours, wherein the final succinic acid yield reaches 98.92g/L; tang Wenxiu et al, by plasmid overexpression from Actinobacillus succinogenes phosphoenolpyruvate carboxykinase pck and Bacillus schoenopterium phosphite dehydrogenase ptxD, fermented for 96h, the succinic acid yield reached 137g/L.
Although the research of fermenting succinic acid by using escherichia coli has made a lot of progress, the production efficiency of the current escherichia coli fermentation is low, byproducts such as lactic acid, formic acid, acetic acid, ethanol and the like are usually contained in fermentation liquor, and the problems of unbalanced metabolism of cofactors in the fermentation process, intolerance of high-concentration product concentration and substrate glucose concentration, high-concentration osmotic pressure and excessively fast glucose absorption and utilization rate, low product yield and production strength, easy loss of strain plasmids and the like are caused. In order to obtain high-performance production strains, methods combining traditional breeding means, various omics analysis and molecular biological modification are generally required.
Disclosure of Invention
In order to solve the technical problems, the invention aims to provide a recombinant escherichia coli with high succinic acid yield and a construction method and application thereof, the invention adopts CRISPR-cas9 gene editing technology to replace a formate dehydrogenase gene fdhF coded in host bacteria FMME-N-5 with a formate dehydrogenase gene fdh1 of candida, and utilizes RBS sequence and promoter strategy to up-regulate a key outer membrane protein regulator OmpR with acid stress resistance and osmotic pressure stress resistance, so that the obtained recombinant escherichia coli has no resistance, is osmotic pressure resistant and can efficiently produce succinic acid.
The first object of the present invention is to provide a recombinant Escherichia coli highly producing succinic acid by replacing a gene fdhF encoding formate dehydrogenase in Escherichia coli with a formate dehydrogenase gene fdh1 derived from Candida, and up-regulating the outer membrane protein regulator OmpR resistant to acid stress and osmotic stress.
In the present invention, formate dehydrogenase (fdh 1) of Candida can catalyze oxidation of formate to carbon dioxide more effectively than formate dehydrogenase (fdhF) of Escherichia coli. Consuming one molecule of NAD at a time + Generating a molecule of NADH. The up-regulation of outer membrane protein regulator gene OmpR enhances the acid and osmotic pressure resistance of Escherichia coli.
Further, the nucleotide sequence of the gene fdhF encoding formate dehydrogenase in Escherichia coli includes the sequence shown in SEQ ID NO. 1; the nucleotide sequence of the gene fdh1 for encoding formate dehydrogenase derived from Candida includes the sequence shown in SEQ ID NO. 2; the nucleotide sequence encoding the outer membrane protein regulator gene OmpR comprises a sequence shown in SEQ ID NO. 3.
Further, the upregulation of the outer membrane protein regulator OmpR resistant to acid stress and osmotic stress was performed by the nucleotide sequence J23101-RBS8-OmpR, and the nucleotide sequence encoding J23101-RBS8-OmpR included the sequence shown in SEQ ID NO. 4.
Further, candida includes Candida boidinii.
Further, escherichia coli is escherichia coli e.
Furthermore, the host of the recombinant Escherichia coli is Escherichia coli FMME-N-5 which is preserved in China center for type culture Collection in 27.8.2020, with the preservation address of Wuhan university in Wuhan, china and the preservation number of CCTCCNO: M2020454.
Further, escherichia coli FMME-N-5 was E.coli. Coli. DELTA. FocA-pflB-. DELTA.ldhA-DELTA.pta-ackA.
The second purpose of the invention is to provide a construction method of the recombinant Escherichia coli for high yield of succinic acid, which comprises the following steps:
(1) Preparing Escherichia coli competence containing pCas-lac plasmid;
(2) Respectively constructing corresponding pTargetF-N20 plasmid and DonorDNA according to the gene fdh1 to be replaced and the J23101-RBS 8-OmpR;
(3) Transforming pTargetF-N20 plasmid and Donor DNA constructed according to the gene fdh1 to be replaced or pTargetF-N20 plasmid and Donor DNA constructed according to J23101-RBS8-OmpR into Escherichia coli competence containing pCas-lac plasmid by an electrotransformation method;
(4) Inducing the sgRNA on the plasmid pCas-lac to transcribe and eliminate the pTargetF-20N plasmid and screening out the strain with successfully modified gene;
(5) Transforming the pTargetF-N20 plasmid and the DonORDNA which are not transformed in the step (3) into the strain obtained in the step (4) according to the methods of the steps (3) to (4), and screening the strain with successfully modified genes;
(6) Eliminating pCas-lac plasmid to obtain the recombinant Escherichia coli with high succinic acid yield.
In the invention, the formate dehydrogenase fdhF and the outer membrane protein regulator OmpR are operated by a CRISPR-cas9 gene editing technology, and an RBS sequence and a promoter are adopted to optimize and express the outer membrane protein regulator OmpR.
Further, in the step (1), the Escherichia coli is Escherichia coli FMME-N-5, which is preserved in China center for type culture Collection in 27 months at 8 of 2020, with the preservation address of Wuhan, wuhan university and the preservation number of CCTCC NO: M2020454.
Further, in the step (1), when Escherichia coli competence containing pCas-lac plasmid is prepared, the plasmid pCas-lac is transformed into the cells to obtain recipient bacteria containing pCas-lac plasmid.
Further, in step (2), when the pTargetF-N20 plasmid was constructed, an appropriate N20 nucleotide sequence was found on the website (https:// www.benchling.com /) according to the gene fdh1, J23101-RBS8-OmpR to be replaced, and whole plasmid PCR was performed.
Further, in the step (3), in constructing the DonORDNA, homology arms were designed based on the gene fdh1, J23101-RBS8-OmpR to be inserted, and finally, further homologous recombination was performed to integrate them.
Further, in the step (3), pTargetF-N20 plasmid and Donor DNA constructed according to the gene fdh1 to be replaced are transformed into E.coli competence containing pCas-lac plasmid by electrotransformation; the step (5) includes a step of transforming the pTargetF-N20 plasmid constructed according to J23101-RBS8-OmpR and DonORDNA into E.coli competence containing pCas-lac plasmid by electrotransformation.
Further, in step (4), induction is performed with IPTG.
Further, in the steps (4) to (5), engineering bacteria are obtained by screening spectinomycin and kanamycin resistant plates;
the method of steps (3) - (5) can realize cyclic genome editing.
Further, in step (6), the strain constructed in step (5) was cultured overnight at 37 ℃ without adding any antibiotic to eliminate the pCas-lac plasmid.
Further, in step (6), the resultant succinic acid-producing recombinant E.coli was E.coli FMME-N-5 (Δ focA-pflB- Δ ldhA- Δ pta-ackA) - Δ fdhF-fdh1-J23101-RBS8-OmpR.
The third purpose of the invention is to disclose the application of the high-yield succinic acid recombinant Escherichia coli in succinic acid production.
Further, the above application comprises the steps of:
carrying out aerobic-anaerobic two-stage fermentation in a fermentation medium by adopting the recombinant escherichia coli with high succinic acid yield to obtain fermentation liquor containing succinic acid;
the aerobic-anaerobic two-stage fermentation is that the aerobic stage is changed into the anaerobic stage 0.5 to 1 hour after the glucose in the fermentation medium is exhausted (the pH value is increased); in the anaerobic stage, the glucose concentration is controlled to be 5-15g/L.
Further, when glucose in the fermentation medium was consumed, the OD of the cells was observed 600 ＝52-60。
Further, the fermentation medium comprises: 30-50g/L glucose, 15-25g/L corn steep liquor, (NH) 4 ) 2 SO 4 2-4g/L，K 2 HPO 4 1.2-2.0g/L，KH 2 PO 4 0.5-1.0g/L，MgSO 4 ·7H 2 O 0.2-0.5g/L，NaCl 1-2g/L。
Further, the aerobic stage is converted into the anaerobic stage by introducing CO 2 Gas or by adding 10-20g/L bicarbonate.
Furthermore, during aerobic-anaerobic two-stage fermentation, the inoculation amount of the recombinant escherichia coli for high-yield succinic acid is 6-12% in percentage by volume; the fermentation temperature is 35-38 ℃.
Further, the fermentation time of the aerobic-anaerobic two-stage fermentation is 50-96h.
Further, in the anaerobic stage, a pH neutralizer is added, the pH neutralizer comprising Na 2 CO 3 、K 2 CO 3 、NaOH、KOH、CaCO 3 And basic magnesium carbonate.
By means of the scheme, the invention at least has the following advantages:
the invention adopts CRISPR-cas9 gene editing technology to replace the gene fdhF for coding formate dehydrogenase in escherichia coli with the gene fdh1 for candida formate dehydrogenase, thereby providing more reducing power while not influencing the growth speed of bacteria and being beneficial to the accumulation of succinic acid; and the RBS sequence and the promoter strategy are adopted to optimize and express the outer membrane protein regulator OmpR, so that the acid resistance and the hyperosmolarity resistance of the strain are effectively improved.
The recombinant escherichia coli with the high succinic acid yield of the engineering strain is fermented for 96 hours on a 3.6L fermentation tank by adopting a two-stage fermentation strategy, the succinic acid yield reaches 145g/L, the succinic acid yield reaches 1.03g/g glucose in an anaerobic stage, the production intensity is 1.51g/L/h, byproducts of lactic acid and formic acid are not accumulated, acetic acid is 1-2g/L, the strain does not contain plasmids, the risk of plasmid loss does not exist, antibiotics are not added during fermentation, and the recombinant escherichia coli has the potential of being applied to industrial production.
The foregoing description is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood and to implement them in accordance with the contents of the description, the following description is made with reference to the preferred embodiments of the present invention and the accompanying detailed drawings.
Drawings
FIG. 1 is a structural diagram of the pTargetF-fdhF recombinant plasmid in example 2;
FIG. 2 is a structural diagram of the pTargetF-OmpR recombinant plasmid in example 3;
FIG. 3 shows the fed-batch fermentation of 96h succinic acid concentration changes in E.coli FMME-N-5 (Δ focA-pflB- Δ ldhA- Δ pta-ackA), E.coli FMME-N-5 (Δ focA-pflB- Δ ldhA- Δ pta-ackA) - Δ fdhF-fdh1, E.coli FMME-N-5 (Δ focA-pfB- Δ ldhA- Δ pta-ackA) - Δ fdhF-fdh1-J23101-RBS 8-pR fermenter;
FIG. 4 shows the results of batch fermentation in feed fermentor of RBS8-Om 96h for constructing engineering strains E.coli FMME-N-5 (. DELTA.focA-pflB-. DELTA.ldhA-. DELTA.pta-ackA), E.coli FMME-N-5 (. DELTA.focA-pflB-. DELTA.ldhA-DELTA.pta-ackA) - Δ fdhF-fdh1, and E.coli MME-N-5 (. DELTA.focA-pflB-. DELTA.ldhA-DELTA.pta-ackA) - Δ fdhF-fdh 1-J23101.
Detailed Description
The following examples are given to further illustrate embodiments of the present invention. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
In the following embodiments of the present invention, the test method includes:
1. measurement of cell concentration: taking a proper amount of fermentation liquor, neutralizing with 2mol/L hydrochloric acid, and expressing the thallus density by using an absorbance value detected by a spectrophotometer under the wavelength of 600 nm.
2. Determination of glucose: pretreatment of fermentation liquor: taking the fermentation liquor, centrifuging for 7min at 12000r/min, and taking the supernatant. Diluting to proper times, and detecting the glucose concentration of the fermentation liquor by using an M-100 biosensor analyzer.
3. Determination of organic acids: high performance liquid chromatography: pretreatment of fermentation liquor: taking the fermentation liquor, centrifuging for 7min at 12000r/min, and taking the supernatant. After diluted by a proper multiple, the yields of succinic acid, lactic acid, formic acid and acetic acid are detected by a High Performance Liquid Chromatograph (HPLC). The instrument is a Waters e2695 reversed-phase high performance liquid chromatograph, and a chromatographic column adopts Bio-Rad HPX 87H; the mobile phase is 5mmoL/L H 2 SO 4 (ii) a The flow rate was set to 0.6mL/min; the detector is an ultraviolet detector, the detection wavelength is 210nm, and the column temperature is 52 ℃.
Example 1E. construction of coli FMME-N-5 (. DELTA.focA-pflB-. DELTA.ldhA-. DELTA.pta-ackA) CRISPR-Cas9 System
The escherichia coli CRISPR-Cas9 system consists of two basic plasmids pCas-lac and pTargetF, wherein the plasmid pCas-lac is an escherichia coli episomal plasmid and contains an L-arabinose inducible expression Red recombinase element, a coding gene Cas9 of a Cas9 protein, a temperature-sensitive element, sgRNA used for inducing elimination of the plasmid pTargetF, a kanamycin resistance gene KanR and the like. The series containing the pCas-lac derivative plasmids all need to be cultured in an environment of 30 ℃ to ensure that the plasmids can be normally replicated without loss. The plasmid pTargetF is an escherichia coli episomal plasmid containing the spectinomycin resistance gene aadA and the promoter pJ23119 for transcription of sgRNA.
Designing a primer to amplify according to the sequence of the target editing site to obtain a sequence (N20) containing 20 bases matched with the target site, and cloning the sequence into a pTargetF vector to obtain a knockout plasmid; secondly, transforming the plasmid pCas-lac into a host cell, inducing expression of a lambda-Red recombination system, preparing a competent cell, transforming the knock-out plasmids pTargetF and DonORDNA into the competent cell for gene editing and recombination, performing coating culture to obtain a transformant, and sequencing to verify the genome recombination condition; then, a plasmid repair system on the pCas-lac plasmid in the strain is induced to work to cut the pTargetF knockout plasmid, and one round of gene modification is completed. The sequential operation of the above works can modify a plurality of gene loci of the host genome to realize the deletion or insertion of genes; finally, the culture was carried out at 37 ℃ to eliminate the pCas-lac plasmid.
(1) Transformation of Escherichia coli with the basic plasmid pCas-lac
Coli FMME-N-5 (. DELTA.focA-pflB-. DELTA.ldhA-. DELTA.pta-ackA) was made competent, and plasmid pCas-lac was transformed intracellularly to obtain recipient bacterium E.coli FMME-N-5 (. DELTA.focA-pflB-. DELTA.ldhA-. DELTA.pta-ackA)/pCas-lac containing plasmid pCas-lac.
(2) Electrotransferase competent preparation of recipient bacteria
a. Escherichia coli containing pCas-lac plasmid was inoculated into liquid LB medium (containing kanamycin to a final concentration of 50. Mu.g/mL), and cultured at 30 ℃ at 250rpm/min to the logarithmic phase growth phase.
b. Inoculating 1% of the culture medium into a 500mL Erlenmeyer flask containing 100mLLB (containing kanamycin to a final concentration of 50. Mu.g/mL), and culturing at 30 deg.C and 200rpm/min to OD 600 When the concentration is 0.2-0.3, adding L-arabinose inducer with final concentration of 10mmol/L to induce lambda-Red recombinase on pCas-lac to fully express, OD 600 The culture was stopped at 0.5-0.7 h (1-1.5 h).
c. The culture broth was transferred to a 50mL sterile centrifuge tube in a clean bench and placed on ice for 10min.
d. And centrifuging the bacterial liquid in the centrifugal tube for 10min at 4 ℃ at 4000 r/min.
e. Discarding the supernatant, adding a small amount of precooled 10% glycerol to gently resuspend the thalli, continuously adding 10% glycerol to two thirds of the volume of a centrifugal tube, and centrifuging for 10min at 4 ℃ at 4000 r/min; the operation is repeated once more.
f. The cells were suspended in 1mL of precooled 10% glycerol, 80. Mu.L of competent cells per tube were dispensed into 1.5mL centrifuge tubes, and the tubes were kept on ice for further use.
(3) Transformation of pTargetF plasmid and DonORDNA
a. Adding DNA to be transformed into competent cells, mixing well, and standing on ice for 30min;
b. transferring the mixture into a precooled 2mm electric rotating cup, and placing on ice for electric rotation;
c. turning on the electric rotating instrument, and setting parameters to be 2.5kV;
d. the electric rotor was removed from the ice, and the surface was blotted with a paper towel and placed in a sample cell for electric shock. Immediately adding normal temperature LB culture medium to suspend cells after electric shock, reviving for 2h at 30 ℃, coating 50 mug/mL kanamycin and 50 mug/mL spectinomycin LB plate, and culturing overnight at 30 ℃;
e. and selecting the clone grown from the plate, and carrying out colony PCR verification by using a verification primer to obtain a correct gene editing strain.
(4) Elimination of pTargetF-20N plasmid
a. Inoculating the correctly-verified gene editing clone to a 5mLLB culture medium (containing 50 mu g/mL of kanamycin at the final concentration), adding IPTG (isopropyl-beta-thiogalactoside) at the final concentration of 0.5mM to induce the transcription of sgRNA on a plasmid pCas-lac, culturing at 30 ℃ for 12-16 hours, and diluting and coating a kanamycin LB plate with the final concentration of 50 mu g/mL;
b. the isolated single colonies were screened by replica on a plate containing kanamycin to a final concentration of 50. Mu.g/mL, spectinomycin to a final concentration of 50. Mu.g/mL and kanamycin double antibody in this order, and the plate was incubated at 30 ℃. Selecting a single colony which does not grow on a spectinomycin and kanamycin double-antibody plate but grows on the kanamycin plate for propagation and conservation of the strain, wherein the single colony is a new strain which eliminates Target plasmid but keeps pCAS-lac plasmid;
c. and transforming other constructed gene knockout plasmids into the strain, screening to obtain a gene deletion strain, and then eliminating the knockout plasmids, thereby realizing circular genome editing.
(5) Elimination of the base plasmid
After genome editing is completed, the genome editing strain containing only pCas-lac plasmid is inoculated to LB culture medium, cultured overnight at 37 ℃ without adding any antibiotic, diluted, spread on LB plate, and cultured at 37 ℃. The isolated single colonies were screened by replica screening sequentially on LB plates (37 ℃ C.) containing no antibiotics, LB plates (30 ℃ C.) containing kanamycin to a final concentration of 50. Mu.g/mL. And selecting a single colony which does not grow on the kanamycin LB plate but grows on the LB plate correspondingly, wherein the single colony is a strain for eliminating the basic plasmid pCas-lac, and finally obtaining the gene editing strain without any plasmid.
Example 2: construction of coli FMME-N-5 (. DELTA.focA-pflB-. DELTA.ldhA-. DELTA.pta-ackA) -. DELTA.fdhF-fdh 1 Strain
(1) Primers were designed based on the upstream and downstream sequences of the E.coli fdhF gene. Finding a formate dehydrogenase fdhF sequence according to an escherichia coli genome sequence published on NCBI, selecting a cleavage site N20 (agatccgctacaaactgacg) on an fdhF gene, designing a reverse amplification primer of pTargetF whole plasmid PCR to obtain a pTargetF-fdhF knockout plasmid, wherein the primers are shown in figure 1 as follows:
sgRNA-U1：agatccgctacaaactgacggttttagagctagaaatagcaagtt
sgRNA-D1：cgtcagtttgtagcggatctactagtattatacctaggactgagc。
(2) And (3) amplifying the upstream homology arm and the downstream homology arm replaced by the fdh1 and the homology arm of the fdh1 by adopting a PCR method, wherein the primers are as follows:
primers for replacing upstream homology arms by amplifying fdh1
F-U1：cgttacaaccagtcagtactgaacg
F-D1：gactaaaacgatcttcatcggtctcgctccagttaatcaaat；
Primers for replacing upstream homology arms by amplifying fdh1
S-U1：cacgataagaaataataccgtcctttctacagcctcct
S-D1：gttctccagatcttccgaggcg；
Fdh1 upstream and downstream primers for amplification
M-U1：ttaactggagcgagaccgatgaagatcgttttagtcttatatgatg
M-D1：gtagaaaggacggtattatttcttatcgtgtttaccgtaagc。
Connecting the three into a gene fragment, namely DonorDNA1, performing PCR amplification, then co-transforming pTargetF-fdhF knockout plasmid and the gene fragment into an FMME-N-5 strain containing pCAS-lac plasmid, completing gene knockout and replacement by using a CRISPR-Cas9 technology, and screening to obtain an engineering bacterium E.coli FMME-N-5 (delta focA-pflB-delta ldhA-delta pta-ackA) -delta fdhF-fdh1 successfully replacing the fdh1 gene.
Example 3: RBS optimized expression of outer membrane protein regulator OmpR
(1) Primers were designed based on the sequences upstream and downstream of the OmpR gene of the E.coli outer membrane protein regulator. According to an E.coli genome sequence published on NCBI, an outer membrane protein regulator OmpR sequence is found, a cleavage site N20 (actgctggcccgtatccgtg) is selected from the gene, a reverse amplification primer of pTargetF whole plasmid PCR is designed, and a pTargetF-OmpR knockout plasmid is obtained, as shown in FIG. 2, wherein the primers are as follows:
sgRNA-U2：actgctggcccgtatccgtggttttagagctagaaatagcaagtt
SGRNA-D2：cacggatacgggccagcagtactagtattatacctaggactgagc。
(2) OmpR is synthesized by adopting a gene synthesis method, RBS8 and a gene sequence J23101-RBS8-OmpR which is continuous with an artificial promoter J23101 are synthesized, and the gene sequence is shown as SEQ ID NO. 4.
(3) Amplifying an upstream homology arm and a downstream homology arm of a gene sequence J23101-RBS8-OmpR and the homology arm of the gene sequence by adopting a PCR method,
the primers are as follows:
upstream homology arm primer for amplifying J23101-RBS8-OmpR
F-U2：atgcgcgggccatcg
F-D2：gactgagctagctgtaaagcatattaaacagcagcttaagtatacaatttattcggc；
Downstream homology arm primer for amplifying J23101-RBS8-OmpR
S-U2：gacggctctaaagcatgaggcgattgcgcttctcgc
S-D2：ctgttccgctatacgctggcgattatg；
Upstream and downstream primers for amplification of J23101-RBS8-OmpR
M-U2：agctgctgtttaatatgctttacagctagctcagtcctaggta
M-D2：gcgagaagcgcaatcgcctcatgctttagagccgtcc。
Connecting the three into a gene fragment by using a one-step homologous recombination technology, carrying out PCR amplification, then co-transforming pTargetF-OmpR plasmid and the gene fragment into the E.coli FMME-N-5 (delta focA-pflB-delta ldhA-delta pta-ackA) -delta fdhF-fdh1 strain containing the pCAS-lac plasmid obtained in the example 2, completing gene knockout and replacement by using a CRISPR-Cas9 technology, and screening to obtain the engineering bacterium E.coli FMME-N-5 (delta focA-pflB-delta ldhA-delta pta-ack A) -delta dhF-fdh1-J23101-RBS8-OmpR nucleotide sequence.
Example 4: recombinant strain E.coli FMME-N-5 (Δ focA-pflB- Δ ldhA- Δ pta-ackA) - Δ fdhF-fdh1-J23101-RBS8-OmpR fermenter fed-batch fermentation
The composition of the fermentation medium on the fermenter was as follows: 35g/L glucose, 20g/L corn steep liquor, (NH) 4 ) 2 SO 4 3g/L，K 2 HPO 4 1.4g/L，KH 2 PO 4 0.6g/L，MgSO 4 ·7H 2 O0.5 g/L, naCl 2g/L; the feed medium consisted of: glucose was 800g/L.
The E.coli FMME-N-5 (Δ focA-pflB- Δ ldhA- Δ pta-ackA) - Δ fdhF-fdh1-J23101-RBS8-OmpR recombinant strain constructed in example 3 was picked up and subjected to two-stage fermentation in a 3.6L fermentor. The recombinant strain is inoculated in 25mL (or 50mL shake flask) of LB culture medium as a primary seed solution in a single clone and cultured for 8.5h at 37 ℃ and 200 rpm. Inoculating 200 μ L of the first-order seed liquid into 50mL (or 500mL shake flask) of LB culture medium; culturing at 37 deg.C and 200rpm for 7.5h to obtain secondary seed solution. The initial liquid loading of the fermentation tank is 2L, the seed inoculation amount is 10%, and the fermentation conditions in the aerobic stage are as follows: the culture temperature is 38 ℃, the ventilation volume is 1vvm, the initial stirring speed is 600r/min, the pH of ammonia water is controlled to be 7.0, the dissolved oxygen is controlled to be more than or equal to 15% in the whole aerobic stage, and when the thallus concentration grows to OD 600 When the yield is 55-60, switching to an anaerobic fermentation stage; an anaerobic stage: stopping aeration, stirring at 200r/min, adding 800g/L glucose, and controlling the sugar concentration of the fermentation liquid<5g/L, controlling the pH value to be about 6.5 by using basic magnesium carbonate in an anaerobic stage, wherein the total fermentation period of aerobic-anaerobic two-stage fermentation is 96h.
In addition, in order to control the host bacteria, example 2 construction of the strain according to the above method for succinic acid fermentation, test the fermentation results, the results are shown in figure 3-4. In FIGS. 3-4, the accession number 1 represents the strain E.coli FMME-N-5 (Δ focA-pflB- Δ ldhA- Δ pta-ackA), the accession number 2 represents the strain E.coli FMME-N-5 (Δ focA-pflB- Δ ldhA- Δ pta-ackA) - Δ fdhF-fdh1, and the accession number 3 represents the strain E.coli FMME-N-5 (Δ focA-pflB- Δ ldhA- Δ pta-ackA) - Δ fdhF-fdh1-J23101-RBS8-OmpR. According to the succinic acid yield measurement, the results are shown in FIG. 4, the fermentation time is 96h, the yield of succinic acid produced by the recombinant strain E.coli FMME-N-5 (delta focA-pflB-delta ldhA-delta pta-ackA) -delta fdhF-fdh1-J23101-RBS8-OmpR reaches 145g/L, the yield of succinic acid reaches 1.03g/g glucose and the production intensity is 1.51g/L/h in the anaerobic stage, lactic acid and formic acid are not accumulated as byproducts, and acetic acid is 1-2g/L.
The above results indicate that the present technology employs genetic engineering technology to replace the formate dehydrogenase gene fdhF in E.coli with the Candida boidinii formate dehydrogenase gene fdh1, and employs RBS sequence and promoter strategy to optimize expression of outer membrane protein regulator OmpR; can effectively improve the output of the succinic acid.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, it should be noted that, for those skilled in the art, many modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.
Claims (6)
1. A high-yield succinic acid recombinant Escherichia coli is characterized in that: the recombinant escherichia coli replaces a gene fdhF of formate dehydrogenase in the coded escherichia coli with a formate dehydrogenase gene fdh1 from candida and up-regulates an outer membrane protein regulator OmpR resistant to acid stress and osmotic stress;
the nucleotide sequence of the gene fdhF for coding the formate dehydrogenase in the escherichia coli is shown as SEQ ID NO. 1; the nucleotide sequence of the formate dehydrogenase gene fdh1 from the candida is shown as a sequence in SEQ ID NO. 2; the nucleotide sequence of the outer membrane protein regulator OmpR for encoding the acid stress resistance and osmotic stress resistance is a sequence shown in SEQ ID NO.3, the up-regulation of the outer membrane protein regulator OmpR for acid stress resistance and osmotic stress resistance is carried out by a J23101-RBS8-OmpR nucleotide sequence, and the nucleotide sequence of the J23101-RBS8-OmpR is a sequence shown in SEQ ID NO. 4;
the host of the recombinant Escherichia coli is Escherichia coli FMME-N-5, and is preserved in China center for type culture collection in 27 months and 8 months in 2020, wherein the preservation address is Wuhan university in Wuhan, china, and the preservation number is M2020454.
2. The method for constructing recombinant Escherichia coli with high succinic acid yield according to claim 1, comprising the steps of:
(1) Preparing Escherichia coli competence containing pCas-lac plasmid; the Escherichia coli is Escherichia coli FMME-N-5, is preserved in China center for type culture Collection in 27 months at 8 of 2020, the preservation address is Wuhan university in Wuhan, china, and the preservation number is CCTCCNO M2020454;
(2) Respectively constructing corresponding pTargetF-N20 plasmid and DonorDNA according to the gene fdh1 to be replaced and the J23101-RBS 8-OmpR;
(3) Transforming pTargetF-N20 plasmid and Donor DNA constructed according to the gene fdh1 to be replaced or pTargetF-N20 plasmid and Donor DNA constructed according to J23101-RBS8-OmpR into Escherichia coli competence containing pCas-lac plasmid by an electrotransformation method;
(4) Inducing the sgRNA on the pCas-lac plasmid to transcribe and eliminate the pTargetF-N20 plasmid and screening out a strain with successfully modified genes;
(5) Transforming the pTargetF-N20 plasmid and the DonORDNA which are not transformed in the step (3) into the strain obtained in the step (4) according to the methods of the steps (3) to (4), and screening the strain with successfully modified genes;
(6) Eliminating pCas-lac plasmid to obtain the recombinant Escherichia coli with high succinic acid yield.
3. The construction method according to claim 2, wherein: in the step (3), pTargetF-N20 plasmid and DonORDNA constructed according to the gene fdh1 to be replaced are transformed into Escherichia coli competence containing pCas-lac plasmid by an electrotransformation method; the step (5) includes a step of transforming the pTargetF-N20 plasmid constructed according to J23101-RBS8-OmpR and DonORDNA into E.coli competence containing pCas-lac plasmid by electrotransformation.
4. The construction method according to claim 2, wherein: in step (6), the strain constructed in step (5) was cultured overnight at 37 ℃ without adding any antibiotic to eliminate the pCas-lac plasmid.
5. Use of the succinic acid-producing recombinant Escherichia coli according to claim 1 for producing succinic acid.
6. Use according to claim 5, characterized in that it comprises the following steps:
carrying out aerobic-anaerobic two-stage fermentation in a fermentation culture medium by adopting the recombinant escherichia coli with high succinic acid yield to obtain fermentation liquor containing succinic acid;
the aerobic-anaerobic two-stage fermentation is that the aerobic stage is converted into the anaerobic stage 0.5 to 1 hour after the glucose in the fermentation culture medium is exhausted; in the anaerobic stage, the glucose concentration is controlled to be 5-15g/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111299764.1A CN114015634B (en) | 2021-11-04 | 2021-11-04 | Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111299764.1A CN114015634B (en) | 2021-11-04 | 2021-11-04 | Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114015634A CN114015634A (en) | 2022-02-08 |
| CN114015634B true CN114015634B (en) | 2022-12-02 |
Family
ID=80061018
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111299764.1A Active CN114015634B (en) | 2021-11-04 | 2021-11-04 | Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114015634B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112239738A (en) * | 2020-10-29 | 2021-01-19 | 江南大学 | Escherichia coli capable of producing succinic acid and application thereof |
| CN112280725A (en) * | 2020-10-29 | 2021-01-29 | 江南大学 | Recombinant escherichia coli for efficiently producing succinic acid and construction method thereof |
-
2021
- 2021-11-04 CN CN202111299764.1A patent/CN114015634B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112239738A (en) * | 2020-10-29 | 2021-01-19 | 江南大学 | Escherichia coli capable of producing succinic acid and application thereof |
| CN112280725A (en) * | 2020-10-29 | 2021-01-29 | 江南大学 | Recombinant escherichia coli for efficiently producing succinic acid and construction method thereof |
Non-Patent Citations (1)
| Title |
|---|
| Engineering the metabolism of Escherichia coli W3110for the conversion of sugar to redox-neutral and oxidized products:Homoace-tate production;Causey T B等;《PNAS》;20031231;第100卷(第3期);第825-832页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114015634A (en) | 2022-02-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210171988A1 (en) | Biological Production of Multi-Carbon Compounds from Methane | |
| Zhang et al. | Production of L-alanine by metabolically engineered Escherichia coli | |
| Dexter et al. | Metabolic engineering of cyanobacteria for ethanol production | |
| CN1097632C (en) | A mutant E. coli strain with increased succinic acid production | |
| JP5907865B2 (en) | Zymomonas with improved arabinose utilization capacity | |
| Liao et al. | The significance of proline on lignocellulose-derived inhibitors tolerance in Clostridium acetobutylicum ATCC 824 | |
| US9944957B2 (en) | Recombinant Escherichia coli for producing D-lactate and use thereof | |
| CN105492613B (en) | Methods for producing n-propanol and propionic acid using metabolically engineered propionibacteria | |
| TW201437367A (en) | Yeast strain for lactic acid production by using pentose and hexose | |
| CN101748069A (en) | recombinant blue-green algae | |
| CN112375723B (en) | Engineering bacteria for producing maleic acid and construction method and application thereof | |
| CN111154705B (en) | Bacillus thermoglucosidasius engineering bacterium and construction method and application thereof | |
| CN106978379A (en) | A kind of Escherichia coli for producing isobutanol and ethanol and preparation method thereof | |
| CN114015634B (en) | Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof | |
| CN112280725B (en) | Recombinant escherichia coli for efficiently producing succinic acid and construction method thereof | |
| JP4927297B2 (en) | Method for producing ethanol using recombinant coryneform bacteria | |
| CN115806922A (en) | Genetically engineered strain of zymomonas mobilis and application thereof | |
| MX2009008453A (en) | Strains of escherichia coli modified by metabolic engineering to produce chemical compounds from hydrolyzed lignocellulose, pentoses, hexoses and other carbon sources. | |
| CN114214219A (en) | Genetic engineering bacterium produced by using formate-assisted free fatty acid | |
| RU2375451C1 (en) | RECOMBINANT PLASMID DNA, CONTAINING GENES OF BUTANOL SYNTHESIS FROM Clostridium acetobutylicum (VERSIONS), RECOMBINANT STRAIN Lactobacillus brevis - PRODUCER OF N-BUTANOL (VERSIONS) AND METHOD FOR MICROBIOLOGICAL SYNTHESIS OF N-BUTANOL | |
| CN115125180B (en) | Recombinant zymomonas mobilis for producing acetoin by double ways and construction method and application thereof | |
| CN114874961B (en) | Recombinant zymomonas mobilis for synthesizing acetoin by using acetaldehyde, and construction method and application thereof | |
| CN113234653B (en) | Mutant strain for improving content of ethanol produced by fermentation of synthesis gas and application of mutant strain | |
| WO2023246071A1 (en) | Mrec mutant and use thereof in l-valine fermentative production | |
| CN101988079A (en) | Method for producing D-lactic acid by fermenting cheap raw material |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |