RU2375451C1 - RECOMBINANT PLASMID DNA, CONTAINING GENES OF BUTANOL SYNTHESIS FROM Clostridium acetobutylicum (VERSIONS), RECOMBINANT STRAIN Lactobacillus brevis - PRODUCER OF N-BUTANOL (VERSIONS) AND METHOD FOR MICROBIOLOGICAL SYNTHESIS OF N-BUTANOL - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention is related to biotechnology, in particular to production of n-butanol by means of carbohydrate-containing raw material fermentation with recombinant bacteria. The following plasmid DNA are constructed: pBCS, containing genes of butanol biosynthesis crt, bed, etfB, etfA and hbd from C.acetobutylicum and pTHL-BCS, containing, apart from earlier mentioned, gene thi from C.acetobutylicum. Plasmids may be replicated both in gram-negative (E.coli) and in gram-positive (L.brevis) bacteria. Recombinant strain-producers of n-butanol are produced on the basis of bacteria Lactobacillus brevis: strain Lactobacillus brevis VKPM V-10044, containing plasmid pBCS; strain Lactobacillus brevis VKPM V-10043, containing plasmid pTHL-BCS, which are able to synthesise butanol and resistant to its concentration of 2.0-2.8 wt % in liquid medium. Method is developed for synthesis of butanol on the basis of recombinant bacteria L.brevis, which combine ability to synthesise butanol with resistance to its concentrations in liquid medium of at least 2.0 wt %, which makes it possible to produce butanol using both glucose and xylose as source of carbon in mediums for cultivation.

EFFECT: invention makes it possible to increase synthesis efficiency.

5 cl, 2 tbl, 8 ex

Description

The group of claimed inventions relates to biotechnology, in particular to the production of n-butanol by fermentation of carbohydrate-containing raw materials by microorganisms, and is a recombinant plasmid DNA, including genes for the synthesis of butanol from Clostridium acetobutylicum (C.acetobutylicum), recombinant bacterial strains of Lactobacillus brevis (L. brevis) containing these plasmids and combining the ability to synthesize n-butanol with resistance to its increased concentrations, as well as the method of microbiological synthesis of n-butanol.

n-Butanol (butanol) is a four-carbon alcohol widely used in various industries. It is used for the manufacture of paints, nitro enamels, plasticizers, butyl acetate, phenol-formaldehyde resins and additives for lubricating oils, is used as a solvent, and is an extractant for fats. Due to its high energy content, low volatility, good miscibility, and high octane, butanol is considered a promising fuel in internal combustion engines.

In industry, butanol is obtained by chemical synthesis from propylene or acetaldehyde, as well as by fermentation of carbohydrate-containing raw materials by bacteria of the genus Clostridium.

The production of butanol and acetone using the anaerobic bacteria Clostridium acetobutylicum, developed by Weizmann in the first half of the 20th century [1], became one of the largest biotechnological processes by the middle of the century. Currently, butanol production by enzymatic means using existing industrial strains of bacteria of the genus Clostridium is economically disadvantageous. One of the main reasons for this is the low productivity of the strains, due to their sensitivity to the final fermentation product - butanol.

The information sources contain information about microorganisms resistant to butanol, which are natural strains obtained either by selection or genetic engineering. These are butanol-resistant strains of clostridia, lactobacilli, enterobacteria [2, 3, 4, 5, 6, 7, 8, 9, 10, 11]. In all these cases, the strains are resistant to the concentration of butanol in the medium, not exceeding 2.5 wt.%. Among them, there are no strains synthesizing butanol due to heterologous expression of genes for the metabolic pathway for the synthesis of butanol from other organisms. In natural Clostridium strains, the level of butanol synthesis does not exceed 1.5 wt.%, After which further synthesis is inhibited by the end product - butanol. Strains whose level of resistance to butanol does not exceed 1.5 wt.%, Are considered sensitive to butanol.

The closest analogue of the claimed strains is a strain of Lactobacillus plantarum PN 0512 [8], which does not synthesize butanol, but is resistant to a concentration of 2 wt.% Butanol in a liquid medium.

Known methods for the microbiological synthesis of butanol using recombinant strains-producers of butanol, obtained on the basis of bacteria Escherichia coli (E. coli.).

Thiolase (thiL) genes, aldehyde-alcohol dehydrogenase (adhe) and bcs-operon (crotonase (crt), butyryl-CoA dehydrogenase (bcd), flavoprotein ETF subunits (etfB and etfA), 3-hydroxybutyryl-CoAb-dehydride )) from C.acetobutylicum were cloned into E. coli using the pKK223-3 expression vector under the control of the constitutive tac promoter (Ptac) [12]. The maximum level of butanol synthesis is 1200 mg / l, achieved by anaerobic 60-hour incubation of pre-grown and concentrated to a density of 20 OE cell biomass in a fermentation medium containing glucose. The limits of resistance to butanol are not investigated in this paper.

In another work [13], genes from C.acetobutylicum essential for the synthesis of butanol were cloned and expressed in E. coli using compatible plasmid vectors pZE12-luc [14] and pACYC184 (New England Biolabs). The pJCL50 plasmid constructed on the basis of the pZE12-luc vector contains the thiolase and alcohol-aldehyde dehydrogenase genes under the control of the IPTG inducible promoter P _L lacO ₁ bacterial replication initiation site for E. coli ColEl and the ampicillin resistance gene. The pJCL60 plasmid constructed on the basis of the pACYC184 vector contains the genes of crotonase, butyryl-CoA dehydrogenase, subunits of the flavoprotein ETF and hydroxybutyryl-CoA dehydrogenase under the control of the IPTG inducible promoter P _L lacO ₁ bacterial site for the initiation of T15 and E. coli tetracycline replication and chloramphenicol. Due to the compatibility of ColEl and p15A, plasmids pJCL50 and pJCL60 coexist in E. coli cells and provide butanol synthesis. Plasmid pJCL60 is the closest analogue of the claimed plasmids, but it is able to replicate only in E. coli.

The closest analogue of the proposed method is a method of microbiological synthesis of butanol using a recombinant strain of E. coli JCL198 transformed with plasmids pJCL50 and pJCL60 (i.e. containing genes for thiolase, alcohol-aldehyde dehydrogenase, crotonase, butyryl-CoA dehydrogenase, and subunits of flavoprotein flavoprotein -CoA-dehydrogenases from C.acetobutylicum, responsible for the synthesis of butanol) and grown under microaerophilic conditions on a medium containing glucose. The level of butanol synthesis in this case does not exceed 20 mg / L. The limit of resistance of E. coli strain JCL198 to butanol is 1.5% [13].

A higher level of butanol synthesis (552 mg / L) was obtained using the recombinant E. coli strain JCL187 transformed with the plasmids pJCL60 and pJCL17 (a derivative of the plasmid pJCL50, in which the thiolase gene from C.acetobutylicum was replaced by the atoQ gene encoding the thiolase in E. coli ) and additionally containing deletions of its own genes, aldehyde-alcohol dehydrogenase (adhE), lactate dehydrogenase (ldhA), reductase fumarate (frdBC), anaerobic repressor pyruvate decarboxylase (fnr) and phosphotransacetylase (pta). Glycerin was used as a substrate for fermentation [13].

The task of the claimed group of inventions is to develop a method for the microbiological synthesis of butanol based on recombinant bacteria, combining the ability to synthesize butanol with resistance to its increased concentrations.

The problem is solved by:

- constructing recombinant plasmid DNA (plasmid) pBCS capable of replicating both in gram-negative (E. coli) and gram-positive (L. brevis) bacteria and containing butanol biosynthesis genes (crt, bcd, et / fB, etfA and hbd) from C.acetobutylicum controlled by their own regulatory elements;

- constructing recombinant plasmid DNA (plasmid) pTHL-BCS, capable of replicating both in gram-negative (E. coli) and gram-positive (L. brevis) bacteria and containing butanol biosynthesis genes (thl, crt, bcd, etfB, etfA and hbd ) from C.acetobutylicum controlled by their own regulatory elements;

- designing a recombinant strain of bacteria L.brevis VKPM 5563 / pBCS capable of synthesizing butanol and resistant to its concentration of 2.0 wt.% in a liquid medium;

- designing a recombinant strain of bacteria L.brevis VKPM 5563 / pTHL-BCS, capable of synthesizing butanol and resistant to its concentration of 2.8 wt.% in a liquid medium;

- development of a method for the microbiological synthesis of butanol based on recombinant bacteria L.brevis, combining the ability to synthesize butanol with a resistance to its concentrations in a liquid medium of at least 2.0 wt.%.

The process of obtaining the claimed strains consists of several stages.

Step 1. Construction of recombinant plasmid DNA pBCS and pTHL-BCS containing genes from C. acetobutylicum responsible for the synthesis of butanol.

The plasmid pBCS is constructed on the basis of the shuttle vector pHYc, which can replicate in a wide range of gram-positive and gram-negative bacteria [15]. The pHYc vector contains the bla gene, which provides resistance of E. coli strains to ampicillin; cmr gene, which provides resistance of lactobacilli to chloramphenicol; replication initiation sites for gram-negative (ori-177) and gram-positive (ori-pAMal) bacteria.

Plasmid pBCS, along with the genes of the pHYc vector, contains a promoter that encodes a region and transcription terminator of the bcs operon from C.acetobutylicum. The coding region of the bcs-operon includes the following genes responsible for the synthesis of butanol: crotonase (crt), butyryl-CoA dehydrogenase (bcd), subunits of flavoprotein ETF (etfB and etfA) and 3-hydroxybutyryl-CoA dehydrogenase (hbd).

Plasmid pTHL-BCS was constructed on the basis of plasmid pBCS and contains, in addition to the previously listed genes, the thiolase (thl) gene from C.acetobutylicum.

Step 2. Transformation with plasmids pBCS or pTHL-BCS of the recipient strain.

The strain VKPM 5563, which belongs to the bacterial species L. brevis, was selected as the recipient strain. Natural representatives of this species do not synthesize butanol, but are able to synthesize another alcohol - ethanol. Unlike other lactobacilli, L.brevis bacteria can utilize not only glucose but also xylose, that is, they have a wider spectrum of fermentable substrates [16].

The transformation process is carried out by electroporation [16]. As a result, recombinant strains of L. brevis VKPM 5563 / pBCS and L.brevis VKPM 5563 / pTHL-BCS capable of synthesizing butanol are obtained.

Stage 3. Adaptation of L.brevis strains to increased concentrations of butanol.

The strains of L. brevis adapt to elevated concentrations of butanol by a series of successive passages with a gradual increase in the concentration of butanol in the medium.

Cells are grown for 2-3 days at 25 ° C on MRS medium of the following composition, wt.%:

peptone one meat extract one yeast extract 0.5 glucose 2 twin 80 0.1 K ₂ HPO ₄ 0.2 Na acetate 0.5 citrate (NH ₄ ) ₂ 0.2 MgSO ₄ × 7H ₂ O 0.02 MnSO ₄ × H ₂ O 0.005 water rest,

additionally containing butanol. The initial concentration of butanol in the medium is 0.4 wt.%. With each subsequent reseeding, the concentration of butanol is increased by 0.4 wt.%.

As a result of the work in accordance with the above steps, two butanol-resistant strains were obtained, each of which contains one of two sets of butanol biosynthesis genes from C.acetobutylicum:

L.brevis VKPM 5563 / pBCS is deposited in the All-Russian collection of industrial microorganisms as Lactobacillus brevis VKPM B-10044;

L.brevis VKPM 5563 / pTHL-BCS is deposited in the All-Russian collection of industrial microorganisms as Lactobacillus brevis VKPM B-10043.

The inventive strains VKPM B-10043 and VKPM B-10044 have common morphological and physiological-biochemical characteristics, but differ genotypically.

Morphological signs.

Cells are straight, rod-shaped, motile, gram-positive, non-spore-forming. When grown for 24-72 hours at a temperature of 25-30 ° C on agar media (MRS, MSS and dairy), the colony is rough, round, matte, curdled white, the edge is uneven.

The composition of the medium MSS, wt.%:

glucose 6 yeast extract 0.5 NH ₄ acetate 0.3 KN ₂ PO ₄ 0.1 MgSO ₄ × 7H ₂ O 0.1 K ₂ HPO ₄ 0.08 cysteine - HCl 0.05 FeSO ₄ × 7H ₂ O 0.005 para-aminobenzoic acid 0.001 water rest

The composition of the dairy medium, wt.%:

sterile skim milk 10 sodium citrate one yeast extract 2 glucose one water rest

Physiological and biochemical characteristics

Both strains grow at a temperature of 20 to 40 ° C (optimum 30 ° C, pH 4.0-6.0). Glucose, fructose, xylose and arabinose are utilized as a carbon source. They grow poorly on maltose and galactose. Do not assimilate sucrose and cellobiosis. Mineral nitrogen in ammonium form, as well as organic nitrogen in the form of peptone, amino acids, are used as a source of nitrogen.

The belonging of the claimed strains to the species L.brevis is confirmed based on the analysis of the nucleotide sequence of 16S rDNA.

The strain L.brevis VKPM B-10044 synthesizes butanol and is resistant to butanol concentrations of 2.0 wt.% In a liquid medium.

The strain L.brevis VKPM B-10043 synthesizes butanol and is resistant to butanol concentrations of 2.8 wt.% In a liquid medium.

Genotypic traits

Both strains are resistant to chloramphenicol and kanamycin.

The strain L.brevis VKPM B-10044 contains on the plasmid pBCS genes for biosynthesis of butanol (crt, bcd, etfB, etfA and hbd) from C.acetobutylicum

Strain L.brevis VKPM B-10043 contains on the plasmid pTHL-BCS genes for biosynthesis of butanol (thl, crt, bcd, etfB, etfA and hbd) from C.acetobutylicum.

The method in General

Inoculum, which is a cell of a recombinant producer strain, is prepared by incubation for 24-48 hours at a temperature of 20-30 ° C on MRS medium containing 10 mg / ml chloramphenicol and 12.5 mg / ml kanamycin. The grown culture is then transferred at a ratio of 1:50 (by volume) to a modified MRS medium containing 4% glucose, 10 mg / ml chloramphenicol and 12.5 mg / ml kanamycin.

The cultivation process is carried out in 50 ml vials for 24-48 hours at a temperature of 20-30 ° C, under microaerophilic conditions, which are achieved by filling the vials to the top of the medium. The amount of synthesized butanol is determined by gas chromatography in samples taken from the culture fluid after removal of the cells by centrifugation at 5000 g. The synthesis level of butanol by the claimed method reaches 300 mg / l, which is 10-15 times higher than that of the closest analogue.

The invention is illustrated by the following figures of graphic images.

Figure 1. Scheme of recombinant plasmid DNA pBCS.

Figure 2. Scheme of recombinant plasmid DNA pTHL-BCS.

The invention is confirmed by the following examples.

Example 1. Cloning of the bacteria genes C.acetobutylicum responsible for the synthesis of butanol

The following enzymes take part in the synthesis of butanol by C.acetobutylicum bacteria:

1. Thiolase catalyzes the conversion of two molecules of acetyl-CoA to acetoacetyl-CoA and CoA.

2. 3-Hydroxybutyryl-CoA dehydrogenase catalyzes the conversion of acetoacetyl-CoA to 3-hydroxybutyryl-CoA using NADH (NADH-nicotinamide adenine dinucleotide, reduced form) as a cofactor.

3. Crotonase catalyzes the conversion of 3-hydroxybutyryl-CoA to crotonyl-CoA with the release of H ₂ O.

4. Butyryl-CoA dehydrogenase, using the ETF electron transport protein consisting of two subunits, catalyzes the conversion of crotonyl-CoA to butyryl-CoA.

5. Butyraldehyde dehydrogenase converts butyryl-CoA to butyraldehyde and CoA, the reaction is NADH-dependent.

6. Butanol dehydrogenase catalyzes the conversion of butyraldehyde to butanol using NADH as a cofactor.

The genes C.acetobutylicum encoding crotonase, butyryl-CoA dehydrogenase, subunits of flavoprotein ETF and 3-hydroxybutyryl-CoA dehydrogenase are organized into a bcs-operon.

Primers for amplification of the thiolase and bcs-operon genes are designed based on the analysis of the complete C.acetobutylicum ATCC 824 genome (Table 1).

Table 1

Primer sequences for amplification of the thiolase and bcs-operon genes from C.acetobutylicum.

Genes Primers Sequence 5 '→ 3' bcs operon: crt, bcd, etfB, etfA, hbd Bcs_for
Bcs_rev ATCCTTCTTTTCTTCTATCATATC
AGCCGAGATTAGTACGGTAATG thl Thl_for
Thl_rev TTTGGAGTATTAAAGGATAGAC
TTAGCCTCATAATCTTTCAAATG

All standard genetic engineering and microbiological manipulations are carried out according to known methods [17, 18,19].

Strain C.acetobutylicum 7 (Applied Biochemistry and Microbiology. 2008. T. 44, No. 1, pp. 49-55) was obtained from the Museum of Moscow State University. The strain is stored and maintained by periodic reseeding in an MSS environment.

The MSS medium with the inoculum of C.acetobutylicum 7 strain inoculated at a ratio of 50: 1 (by volume) was pasteurized in a water bath for 20 min at 80 ° C and incubated anaerobically at 37 ° C for 24 hours. Cells are separated by centrifugation at 5000g. Genomic DNA is isolated from the resulting biomass.

The thiolase and bcs operon genes are amplified using specific primers (Table 1), the genomic DNA of C.acetobutylicum 7 and KOD polymerase of increased accuracy (Novagen). The result is PCR fragments: THL containing the thiolase gene and 99% homologous to the fragment of the complete genome of C.acetobutylicum ATCC 824, located between 3005706 and 3007561 bp and BCS containing the genes of the bcs-operon and 99% homologous to the fragment of the complete genome of C.acetobutylicum ATCC 824, located between 2831629 and 2836638 bp (http://www.ncbi.nlm.nih.gov). The resulting PCR fragments are cloned into a TOPO vector (Invitrogen). The correctness of cloning is confirmed by sequencing of each of the recombinant inserts. Ultimately, recombinant plasmids are obtained: pTOPO-THL containing the thiolase gene, and pTOPO-BCS containing the operon bcs genes. The activity of butanol synthesis enzymes is determined by conventional methods [20, 21, 22]. Levels of specific activity of native enzymes responsible for butanol synthesis in C. acetobutylicum and corresponding enzymes in recombinant E. coli strains confirm gene expression from C.acetobutylicum in E. coli (Table 2).

table 2

The specific activity (U / mg protein, min) of the native enzymes responsible for the synthesis of butanol in C.acetobutylicum, and the corresponding enzymes in recombinant strains

Enzyme Native C.acetobutylicum Enzymes Native E.coli Enzymes Enzymes in Recombinant E. coli Strains thiolase 15,5 - 15,2 3-hydroxybutyryl-CoA-de-
drogenase 10,2 - 10.7 Crotonase 86.8 - 207

Example 2. Construction of recombinant plasmid DNA pBCS

In order to express genes for the synthesis of butanol from C.acetobutylicum bacteria in L. brevis bacteria, the pBCS plasmid (containing the bcs-operon) is constructed on the basis of the pHYc shuttle vector.

The pHYc vector and plasmid pTOPO-BCS (Example 1) are digested with restriction enzymes BamHI and XbaI. A fragment of the pTOPO-BCS plasmid containing the bcs-operon is ligated with a larger XbaI / BamHI fragment of the pHYc vector, the E. coli cells are transformed with the ligase mixture. The result is a recombinant strain of E. coli / pBCS containing the plasmid pBCS. The primary structure of the plasmid pBCS is confirmed by sequencing. Strain E. coli / pBCS does not synthesize butanol, despite the activity of the enzymes bcs-operon.

PBCS recombinant plasmid DNA (SEQ ID NO 1) has a size of 9954 nucleotide pairs (bp) and contains butanol biosynthesis genes (crt, bcd, etfB, etfA and hbd) from C.acetobutylicum regulated by their own promoter (p) and terminator (t); bla gene, which provides E. coli resistance to ampicillin (Ap); cmr gene providing L.brevis resistance to chloramphenicol (Cm); replication initiation sites for gram-negative (ori-177) and gram-positive (ori-pAMa1) bacteria (Fig. 1).

Example 3. Construction of recombinant plasmid DNA pTHL-BCS

In order to express an expanded set of genes for the synthesis of butanol from C.acetobutylicum bacteria in L.brevis bacteria, the plasmid pTHL-BCS containing the bcs-operon and the thiolase gene is constructed on the basis of the pHYc shuttle vector.

Plasmid pTOPO-THL (Example 1) was digested with EcoRI restriction enzyme. The DNA fragment containing the thiolase gene is treated with a Klenov fragment and ligated with the plasmid pBCS previously linearized at the SmaI restriction site. The ligase mixture transform E. coli cells. The result is a recombinant strain of E. coli / pTHL-BCS containing the plasmid pTHL-BCS and synthesizing butanol in an amount of 10 mg / L. The primary structure of plasmid pTHL-BCS is confirmed by sequencing.

Recombinant plasmid DNA pTHL-BCS (SEQ ID NO 2) has a size of 11787 bp and contains genes for butanol biosynthesis (crt, bcd, etfB, etfA and hbd) from C.acetobutylicum, regulated by their own promoter (p) and terminator (t); thiolase gene from C acetobutylicum, regulated by its own promoter (p) and terminator (t); bla gene, which provides E. coli resistance to ampicillin (Ap); cmr gene providing L.brevis resistance to chloramphenicol (Cm); replication initiation sites for gram-negative (ori-177) and gram-positive (ori-pAMal)

bacteria (figure 2).

Example 4. Obtaining the inventive strain of L.brevis VKPM B-10044

The strain L.brevis VKPM 5563 (not synthesizing butanol) was obtained from the All-Russian collection of industrial microorganisms. The sensitivity of strain VKPM 5563 to the action of chloramphenicol in concentrations exceeding 5 mg / L, and resistance to the action of kanamycin in concentrations not exceeding 15 mg / L were established by testing on MRS agar containing the appropriate antibiotics.

In order to obtain a recombinant strain of L.brevis cells, VKPM 5563 was transformed with pBCS plasmid by electroporation. The selection of transformants is carried out on MRS agar containing both chloramphenicol (10 mg / l) and kanamycin (12.5 mg / l). The presence of the plasmid is confirmed by polymerase chain reaction. Then, the recombinant strain L.brevis VKPM 5563 / pBCS is modified by adaptation to increased concentrations of butanol in the medium. The result is the claimed strain of L.brevis VKPM B-10044, capable of synthesizing butanol (examples 6.7) and resistant to a concentration of 2 wt.% Butanol in a liquid medium, which corresponds to the level of resistance to butanol of the closest analogue.

Example 5. Obtaining the inventive strain of L.brevis VKPM B-10043

The strain is obtained as in Example 4, but the plasmid pTHL-BCS is used instead of the plasmid pBCS. As a result of transformation with subsequent modification, the inventive strain L.brevis VKPM B-10043 is obtained, capable of synthesizing butanol (Example 8) and resistant to a concentration of 2.8 wt.% Butanol in a liquid medium, which is 1.4 times higher than the level of resistance to butanol the closest analogue.

Example 6. Synthesis of butanol using strain L.brevis VKPM B-10044 on a medium with glucose

The seed is grown by incubating cells of the L. brevis strain VKPM B-10044 at a temperature of 25 ° C for 48 hours on MRS medium containing 10 mg / ml chloramphenicol and 12.5 mg / ml kanamycin.

The modified MRS medium containing 4% glucose, 10 mg / ml chloramphenicol and 12.5 mg / ml kanamycin is seeded with prepared seed and the fermentation process is carried out under microaerophilic conditions for 48 hours at 25 ° C. The level of butanol synthesis is 300 mg / L.

Example 7. Synthesis of butanol using strain L.brevis VKPM B-10044 on a medium with xylose

The process is conducted, as in example 6, but using a modified MRS medium containing 4% xylose. The level of butanol synthesis is 100 mg / L.

Example 8. The synthesis of butanol using strain L.brevis VKPM B-10043 on a medium with glucose

The process is conducted, as in example 6, but using strain L.brevis VKPM B-10043.

The level of butanol synthesis in MRS medium containing 4% glucose is 200 mg / L.

Thus, the claimed results for the first time demonstrated the possibility of obtaining bacteria Lactobacillus brevis, synthesizing butanol, resistant to its increased concentrations, and in culture media as sources of carbon using both glucose and xylose.

Strains L. brevis / pBCS and L. brevis / pTHL-BCS were obtained by a combination of genetic engineering and adaptation methods. For the synthesis of butanol by L. brevis bacteria, expression of the following set of genes from C.acetobutylicum is sufficient: crt (crotonase), bcd (butyryl-CoA dehydrogenase), etfA, etfB (flavoprotein ETF subunits) and hbd (3-hydroxybutyryl-CoA dehydrogenase) . Probably, in this case, part of the butanol biosynthesis reactions (synthesis of butyraldehyde and butanol) are carried out due to the host cell's own enzymes. The expression of the thiolase gene in the L. brevis / pTHL-BCS strain along with the above genes does not lead to an increase in the level of butanol synthesis.

The level of butanol synthesis in the claimed recombinant strains of lactobacilli significantly exceeds that of the closest analogue under similar cultivation conditions, and their resistance to butanol is comparable with the results experimentally confirmed on lactobacilli and other bacteria.

The ability of the claimed strains to synthesize butanol by fermentation of both glucose and xylose allows the use of plant biomass hydrolysates as cheap non-food raw materials as fermentation substrates.

The inventive recombinant strains producing butanol belong to the species L. brevis, the natural representatives of which are not able to synthesize butanol. The introduction of a new type of bacteria among the butanol producers provides additional opportunities for the development of more efficient ways of its biosynthesis.

Information sources

Claims (5)

1. Recombinant plasmid DNA pBCS, designed for transformation of bacteria Lactobacillus brevis, having a size of 9954 bp, containing the promoter, coding and termination region of the bcs operon from Clostridium acetobutylicum, including genes for butanol biosynthesis: crt, bcd, etfB. and hbd, as well as the bla ampicillin resistance gene, cmr chloramphenicol resistance gene, and ori-177 replication initiation sites for gram-negative and ori-pAMal for gram-positive bacteria, corresponding to the nucleotide sequence of SEQ ID NO I. 2. Recombinant plasmid DNA pTHL-BCS, designed to transform Lactobacillus brevis bacteria, having a size of 11787 bp, containing the promoter, coding, and terminating regions of the bcs operon from Clostridium acetobutylicum, including butanol biosynthesis genes: crt, bcd, etf, etf, etf . and hbd, the promoter, coding, and termination regions of the ml gene from Clostridium acetobutylicum, as well as the bla ampicillin resistance gene, the cmr chloramphenicol resistance gene, and the ori-177 replication initiation sites for gram-negative bacteria and ori-pAMal for gram-positive bacteria corresponding to the nucleotide sequence of SEQ ID NO 2. 3. The recombinant strain of Lactobacillus brevis VKPM B-10044 is an n-butanol producer obtained by the transformation of the plasmid DNA strain Lactobacillus brevis VKPM 5563 according to claim 1. 4. The recombinant strain of Lactobacillus brevis VKPM B-10043 is the producer of n-butanol obtained by transformation of the plasmid DNA strain Lactobacillus brevis VKPM 5563 according to claim 2. 5. The method of microbiological synthesis of n-butanol, involving the cultivation of recombinant bacteria containing genes for the biosynthesis of n-butanol from Clostridium acetobutylicum, under microaerophilic conditions in a nutrient medium including sources of carbon, nitrogen and mineral additives to the maximum accumulation of the target product, characterized in that as producers containing genes for the biosynthesis of n-butanol from Clostridium acetobutylicum, recombinant bacteria Lactobacillus brevis obtained by the transformation of bacteria Lactobacillus brevis plasmid DNA according to claim 1 are used or 2 and combining the ability to synthesize n-butanol with resistance to a concentration of n-butanol in a liquid medium from 2.0 wt.% and above, and glucose and / or xylose are used as carbon in culture media.

Images