CN101988079A - Method for producing D-lactic acid by fermenting cheap raw material - Google Patents

Abstract

The invention provides a production process for efficiently preparing D-lactic acid by fermenting glycerin serving as a raw material by recombinant Escherichia coli, which is characterized in that: at the growth stage of thalli, sufficient oxygen is supplied and the strain produces sufficient thalli quickly through 3 percent glycerin at the temperature of between 30 and 45 DEG C, the pH of 5.0 to 7.5 and the dissolved oxygen concentration of not more than 30 percent; and at the stage of fermenting to produce acid, fermentation is performed at the temperature of between 30 and 45 DEG C and the pH of 5.0 to 7.5 for 36 to 48 hours, 12 to 14 percent of D-lactic acid is produced and the optical purity of the produced D-lactic acid is over 99.9 percent. By the process, polymer grade D-lactic acid can be industrially prepared from industrial waste glycerin serving as the raw material; and the process has great application value.

Description

A kind of method of utilizing the cheap raw material fermentation production of D-lactic acid

Technical field

The present invention adopt microbe fermentation method with industrial waste glycerine as raw material production D-lactic acid, belong to the microbial fermentation engineering technical field.

Background technology

The serious day by day global energy and environmental problem are impelled countries in the world to develop biodiesel technology one after another and are made up the biofuel industry, to slow down the lift velocity that oil is relied on and reduces the atmosphere greenhouse Gas Emission.According to statistics, global biofuel ultimate production was about 6,500,000,000 liters in 2006, and than 3,900,000,000 liters of growths by 67% in 2005, rate of growth was surprising.According to estimating that Global Industry Analysts is done, global biodiesel market will rise to 18,000,000,000 liters in 2010, increase by 177% than 2006.Along with the rapid growth of biofuel demand and turnout in the world wide, its economic viability more and more will depend on effective utilization or large-scale conversion the to its discarded byproduct glycerine (output is calculated by 10% of yield of biodiesel).

Meanwhile, the demand of Biodegradable material such as poly(lactic acid) also constantly increases, and has promoted the demand to monomer whose D-lactic acid or L-lactic acid synchronously.In recent years, the research of zymotechnique of lactic acid and poly(lactic acid) macromolecular material is active, and lactic acid becomes a chemical that has potentiality, and is expected to become the another large leavened prod after citric acid.Yet, the lactic acid of racemize type and low optical purity is restricted in the application in a lot of fields, people constantly seek the production method of single optical purity D-lactic acid or L-lactic acid, and to explore it be raw material with the low-cost resource, the feasibility of producing with high yield, high substrate conversion efficiency, high production intensity, high chemical purity.

Therefore, if can effectively glycerine be produced the D-lactic acid or the L-lactic acid of high-optical-purity and high chemical purity as fermenting raw materials, then both can solve the recycling problem of the glycerine in the processing of biofuel or grease, can save production cost D-lactic acid or L-lactic acid again.For glucose, has the higher ortho states of going back for the substrate synthesizing lactic acid with glycerine.It is the operational path that fermenting raw materials is produced lactic acid with glycerine that Liu Dehua etc. have proposed, and isolate a strain wild strain, can directly utilize unpurified glycerine to produce lactic acid for fermenting raw materials, carry out blowing air batch fermentation research at the 5L mechanical agitating fermentation tank, Lactic Acid from Fermentation Broth concentration 68.53g/L during 72h, lactic acid quality yield 0.81, production intensity 0.95g/ (Lh) (Xu Yun treasure, Deng, process engineering journal, 2008).This seminar at bacterial strain that screening obtains when ferment glycerin obtains lactic acid, acetate, succsinic acid, the final concentration of by products such as alcohol reaches 7.0g/L respectively, 3.7g/L, 1.4g/L (An-AnHong, et al, J Chem Technol Biotechnol, 2009).Same seminar has also used similar result of study application national inventing patent (a kind of method of utilizing glycerine to produce lactic acid, the patent No.: 200810102824.4; Publication number: CN 101255451A).But in this applies for a patent, what the applicant used is wild bacterium, the fermentation capacity of bacterial strain is not carried out genetic improvement, also not studying its lactic acid of producing is L-type or D-type or mixed type, more not to other low molecule that must strict control in lactic fermentation process acetate particularly, the strict control of the formation of succsinic acid or content can not be implemented the industrial application purpose with this.D-lactic acid superior strain with the wide scope genetic modification of strain process among the present invention serves as to produce bacterial strain, in efficient glycerine converting synthesizing lactic acid, reduced the generation of by product significantly, the D-lactic acid of synthetic high-optical-purity and high chemical purity, and set up relevant zymotechnique, with above-mentioned apply for a patent different fully.

Intestinal bacteria are that outstanding lactic acid candidate produces bacterium, particularly can metabolizable glucose rapidly and efficiently generate the lactic acid of high chemical purity and high-optical-purity through the intestinal bacteria of genome useful transformation.The chemical purity (Dong-Eun Chang, et al, Applied and Environmental Microbiology, 1999) that can improve lactic acid as knocking out of pta and ppc.PflB, aceEF, poxB and pps also are proved the chemical purity (Y.Zhu, et al, Applied and Environmental Microbiology, 2007) that can improve lactic acid.

There is tangible glucose effect in intestinal bacteria aspect utilization of carbon source.When other carbon sources and glucose existed simultaneously, bacterial strain preferentially utilized glucose and the utilization of other carbon sources is suppressed, up to glucose consumption totally the time bacterial strain just begin to utilize other carbon sources.Glycerine and glucose during simultaneously as carbon source thalli growth have the second stage employ phenomenon, even do not add glucose, glycerine is during as sole carbon source, also there is tangible lag period of long phenomenon in bacterial strain to the utilization of glycerine.Studies show that glucose phosphotransferase gene (ptsG) plays crucial effects in glucose effect, this gene suddenlys change, the route of synthesis of blocking-up phosphotransferase can effectively be removed restraining effect (the Ranjini Chatterjee that glucose utilizes other carbon source metabolism, et al, Applied and Environmental Microbiology, 2001).The achievement in research of MarkA.Eiteman etc. shows, except glucose phosphotransferase gene (ptsG), glucokinase gene (glk), seminose phosphoric acid shift permease (manZ) and xylose isomerase (xylA) is also having significant effects effect (Mark A.Eiteman aspect the selective use of carbon source, et al, Biotechmology and Bionengineering, 2008).

The metabolism of glycerine needs the participation of oxygen, so the bacterial metabolism enough logical oxygen of process need that utilizes glycerine to grow.The building-up process of lactic acid then needs under anaerobic, because oxygen can make the lactic acid route of synthesis be obstructed the NADH oxidation.NADH provides enough reducing powers as the coenzyme of serum lactic dehydrogenase for lactic acid synthetic.Therefore, the process need that utilizes glycerol fermentation to produce lactic acid is kept suitable oxygen supply concentration, has not only satisfied the needs of bacterial metabolism glycerine growth but also can keep certain reducing power to be used for the synthetic of lactic acid.

The present invention also can be used for metabolism and utilize other organic acids such as industrial by-products High-efficient Production D-lactic acid, L-lactic acid, pyruvic acid, oxysuccinic acid, Succinic Acid, D-L-Ala such as molasses, whey or Mierocrystalline cellulose and hemicellulose hydrolysate after suitably revising.

Summary of the invention

The objective of the invention is: by genetic modification, the retarding effect of removing glucose realizes the tachymetabolism utilization of bacterial strain to glycerine, and set up a kind of D-lactic acid high efficiency preparation method, obtain optical purity and the high D-lactic product of chemical purity, form the succinct easily D-zymotechnique of lactic acid condition of control of a cover simultaneously.

Feature of the present invention is: the bacterial strain that uses among the present invention can utilize glycerine and synthetic D-lactic acid fast.Under ℃ fermentation condition of pH5.0～7.5,30～45, suitable logical oxygen is provided, when D-lactic acid-producing bacterial strain utilizes the glycerine growth, metabolism glycerine synthesizing lactic acid, and form other organic acid and ethanol hardly.The production technique of D-lactic acid of the present invention is characterized as: under ℃ condition of pH5.0～7.5 and 30～45, behind fermentation 30～48h, the D-lactic acid content reaches 12～14%, and the optical purity of D-lactic acid reaches more than 99.9%, and glycerine is higher than 90% to the transformation efficiency of lactic acid.The reorganization bacterium that the present invention relates to, the deleted or expression of the one or more genes in its genome.Involved gene product comprises: glucose phosphotransferase, glucokinase, seminose phosphoric acid shift permease, xylose isomerase, the dependent D-serum lactic dehydrogenase of FAD, pyruvic oxidase, pyruvate formate-lyase, pyruvic oxidase, E.C. 2.7.2.1, ethanol dehydrogenase, malate dehydrogenase (malic acid dehydrogenase) or malate synthase etc.Involved process control parameter comprises: substratum composition, pH, culture temperature, dissolved oxygen or glycerol concentration.

Bacterial classification, gene elmination and expression method, substratum and zymotechnique control method that the present invention uses:

Bacterial classification: the bacterial classification that sets out that the present invention uses is the wild-type e. coli through transgenation or modification.Wild strain is buied from Chinese colleges and universities industrial microorganism resource and information center (http://cicim-cu.jiangnan.edu.cn).Obtaining the higher relatively bacterial strain of lactic acid producing level by the shake flask fermentation experiment screening is starting strain, carries out genomic modification through the genetic modification technology again, finally obtains the D-lactic-acid-producing strain of high yield high-optical-purity and chemical purity.Deleted or the modification of a plurality of key enzyme encoding genes in this bacterial strain in multiple organic acid, alcoholic acid pathways metabolism and glycerine, the glucose metabolisms such as formic acid, acetate, succsinic acid, L-lactic acid, D-lactic acid.This bacterial classification is preserved in Chinese typical culture collection center as patented strain the sixth of the twelve Earthly Branches, and deposit number is: CCTCC NO:M 2010024.

Gene elmination technology: use the synthetic Oligonucleolide primers, with specificity recombination site sequence (dif sequence; BloorEA ﹠amp; Cranenburgh MR, Appl Environ Microbiol, 2006) both sides of introducing selected marker (as the gentamicin resistant gene), form repeatedly used selected marker.Upstream and each 50～200bp of downstream sequence that utilization PCR (polymerase chain reaction,PCR) increases from the bacillus coli gene group and obtains target deletion gene.Repeatedly used selected marker is cloned between the upstream and downstream sequence of target deletion gene, forms goal gene deletion sequence, as dld '-dif-Gm ^R-dif-dld ', i.e. dld ':: difGm.This gene elmination sequence is transformed into intestinal bacteria.On selective medium, select to turn out transformant, upload at non-selective substratum again and be commissioned to train fosterly, filter out the transformant that selected marker disappears.Extract the transformant chromosomal DNA, the goal gene sudden change of transformant is verified with PCR.Thus obtained mutant strain is used further to the starting strain of next goal gene deletion.

Gene cloning and expression: the utilization round pcr clones gene adh E and the NAD of goal gene as the coding ethanol dehydrogenase from the bacillus coli gene group ⁺Dependency D-lactic dehydrogenase enzyme coding gene ldhA, replace the part base sequence of adhE gene to make up sudden change nuclear with the ldhA gene, finish substituting of ldhA gene in the method deletion adhE gene on utilize, and obtain the reorganization bacterium that recombinant bacterial strain obtains high yield D-lactic acid.

Utilize above-mentioned recombination method,, finish the structure of the D-lactic acid reorganization bacterium CCTCC NO:M 2010024 of high yield high-optical-purity and chemical purity according to following steps.

1. the screening of starting strain: wild strain is buied from Chinese colleges and universities industrial microorganism resource and information center (http://cicim-cu.jiangnan.edu.cn).Test at the M9 substratum of adding 50g/L glucose and 10g/L lime carbonate (Sa nurse Brooker J by shake flask fermentation, the Ritchie E F. molecular cloning experiment guide third edition [M] not. Beijing: Science Press, 2002) behind the middle fermentation 70h, measure its lactic acid-producing amount, it is starting strain that screening obtains the higher relatively bacterial strain CICIM BEC2198 of lactic acid producing level.

2. utilize the said gene deleting technique, the goal gene in the starting strain genome that 1. step is obtained is as the gene dld deletion of the dependent D-serum lactic dehydrogenase of coding FAD, and obtain recombinant bacterial strain BEC-1 (BEC2198, dld).

3. utilize the said gene deleting technique, the goal gene in the recombinant bacterial strain genome that 2. step is obtained is as the gene pfl deletion of coding pyruvate formate-lyase, and obtains recombinant bacterial strain BEC-2 (BEC2198, dld, pfl).

4. utilize the said gene deleting technique, goal gene in the recombinant bacterial strain genome that 3. step is obtained is as the gene ack-pta deletion of coding phosphotransacetylase and E.C. 2.7.2.1, and acquisition recombinant bacterial strain BEC-3 (BEC2198, dld, pfl, ack-pta).

5. utilize said gene deletion and genetic modification technology, the goal gene in the recombinant bacterial strain genome that 4. step is obtained is as the gene adh E deletion of coding ethanol dehydrogenase, and uses NAD ⁺Dependency D-lactic dehydrogenase enzyme coding gene ldhA substitutes, and obtains recombinant bacterial strain BEC-4 (BEC2198, dld, pfl, ack-pta, adhE::ldhA).

6. utilize the said gene deleting technique,, and obtain recombinant bacterial strain BEC-5 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG) the gene ptsG deletion of the goal gene in the starting strain as the coding glucose phosphotransferase.

7. utilize the said gene deleting technique,, and obtain recombinant bacterial strain BEC-6 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG, Δ glk) the gene glk deletion of the goal gene in the starting strain as the coding glucokinase.

8. utilize the said gene deleting technique, goal gene in the starting strain is shifted the gene manZ deletion of permease as coding seminose phosphoric acid, and acquisition recombinant bacterial strain BEC-7 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG, Δ glk, Δ manZ).

9. utilize the said gene deleting technique, with the gene xylA deletion of the goal gene in the starting strain as the coding xylose isomerase, and acquisition recombinant bacterial strain BEC-8 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG, Δ glk, Δ manZ, Δ xylA).

Substratum: the substratum that the present invention uses (being called for short the MG substratum) consists of: add glucose or glycerine and be carbon source, form (g/L): Na by five kinds of inorganic salt and trace element ₂HPO ₄6, KH ₂PO ₄3, NH ₄Cl 1, and NaCl 0.5, and the every liter of substratum in sterilization back adds the aseptic lmol/L MgSO of 1mL ₄The micro-mother liquor (prescription see Table 1) aseptic with 1mL, it is 5g/L that glycerine initially adds concentration.

The micro-mother liquor prescription of table 1

The fermentative production of D-lactic acid:

10. with step 5., 6., 7., 8., the recombinant bacterial strain that 9. obtained and wild strain BEC2198 carry out the lactic fermentation test respectively in the 7L automatic fermenter.Timing sampling in the fermenting process, analysis of cells density, glycerine consumption, lactic acid yield, the main intermediate product of metabolism and other organic acid analysis etc.

Dissolved oxygen control method: the intestinal bacteria that relate among the present invention are facultative anaerobe, and suitable logical oxygen condition hypothallus utilizes the glycerine growth, and simultaneously quick synthesizing lactic acid.Fermenting process adopts incomplete oxygen supply strategy, has both guaranteed the thalli growth demand, can realize a large amount of synthetic of lactic acid again, lacks by products such as generating or do not generate various organic acids simultaneously.In early stage in thalli growth stage, control is melted oxygen and is not less than 30%, when rotating speed reaches 500r/min, removes and melts the related of oxygen and rotating speed, and melting oxygen can be reduced to 1.0～2.0 gradually, fixed rotating speed 500r/min and ventilation 5L/min.

The glycerine feeding method: the intestinal bacteria that relate among the present invention can metabolism glycerine synthesizing lactic acid, accumulates lactic acid simultaneously.Its synthetic formic acid, succsinic acid acetate and alcoholic acid pathways metabolism are effectively blocked.Fermenting process adopts intermittent injecting glycerine in batches, thereby has realized the efficient production of D-lactic acid.The initial glycerol concentration 3% of thalli growth is monitored oxyty in the fermenting process, (glycerine exhausts) adds glycerine to final concentration 5% when oxyty rises rapidly, adds glycerine to final concentration 5% four times in the whole fermentation process.

Sample analysis: after the fermented sample sulfuric acid acidation is handled, the centrifuging and taking supernatant, through 10% trichloroacetic acid precipitation, recentrifuge, supernatant liquor is used for high pressure liquid phase analysis behind 0.45 μ m filtering with microporous membrane.High-pressure liquid phase adopts Shodex SUGARSH1011,50 ℃ of column temperatures, and ultraviolet detection, wavelength are 210nm.Moving phase is 0.01mol/L H ₂SO ₄, flow velocity 0.7ml/L, post is pressed 44Bar.High-pressure liquid phase adopts Shodex SUGAR SH1011,50 ℃ of column temperatures, and differential detects.Moving phase is 0.01mol/L H ₂SO ₄, flow velocity 0.7ml/L, post is pressed 44Bar.

Outstanding substantive distinguishing features of the present invention and marked improvement are mainly reflected in:

1, the reorganization bacterium that makes up among the present invention can prepare the D-lactic acid of high-optical-purity and high chemical purity.At pH5.0-7.5, condition bottom fermentation 30～48h of 30～45 ℃ produces the D-lactate level and reaches 12～14%, and the optical purity of D-lactic acid reaches more than 99.9%, and glycerine is higher than 90% to the transformation efficiency of lactic acid, forms other organic acid or ethanol hardly.

2, the reorganization bacterium metabolism that makes up among the present invention utilizes the performance of glycerine to significantly improve, and can be D-lactic acid with transformation of glycerol fast, and metabolic rate improves more than 25%, and this reorganization bacterium is significantly improved to the tolerance of glycerine, and increase rate is up to 30%.

3, the zymotechnique of foundation of the present invention is simple to operate, is easy to realize fermenting process whole process using Ca (OH) ₂Regulate pH, pilot process only need be according to the variation intermittent injecting glycerine of dissolved oxygen, and whole process is kept constant ventilation intensity.And, in fermented liquid, there be not the synthetic of by product such as heteroacid substantially, ensured the processing of follow-up polymerization-grade D-lactic acid.

Accompanying drawing is described

Fig. 1 recombinant plasmid pUC-dif _Ec-Gm ^R

Fig. 2 recombinant plasmid pUC-adhE ':: ldhA-dif-Gm ^R

Embodiment

Embodiment 1---the fermentation screening of wild D-lactic acid-producing bacterial strain

Original strain is made up of two portions. and wherein 871 strains are genus bacillus; 1329 strains are enterobacteria, and dull and stereotyped the cultivation adopted the LB substratum. the strain fermentation lactic acid producing all adopts MG substratum (M9 culture medium supplemented 5% glucose is as carbon source).

Screening is carried out in two steps. because the more primary dcreening operation process of original strain quantity is multiple batches of finishing, so adopt the test tube cultured method at first equally, the D-lactic acid generation bacterial strain that primary dcreening operation is obtained carries out with batch screening. select the higher bacterial strain of lactic acid producing level then, adopt shake flask fermentation, further screen superior strain.

Shake flask fermentation comprises seed culture and fermentation and acid.

Seed culture 250ml triangular flask seed culture medium liquid amount 20ml, 37 ℃ of shaking tables of 100rpm are cultivated 20h and are promptly got seed liquor.

Fermentation and acid 250ml triangular flask fermention medium liquid amount 40ml, 37 ℃ leave standstill cultivation 42h. behind 37 ℃ of shaking tables cultivations of 100rpm 12h

Obtain thermophilic D-lactic acid high yield bacterium by the lactic acid production screening of analyzing bacterial strain.

By range estimation bacterium liquid opacity with measure the method that bacterium liquid OD600 value combines and judge the thalli growth situation, adopt 4 grades of record symbols (, ± ,+, ++) write down bacterium liquid opacity.

The output of the total lactic acid of high-pressure liquid phase chromatogram therapy determining.

Garbled data sees the following form:

The fermentation screening of the wild D-lactic acid-producing of table 2 bacterial strain

Wherein, the BEC2198 acid yield is higher relatively, is used for follow-up genetic engineering modified as starting strain.

Embodiment 2---can use the preparation of the genetic marker of gene elmination and gene integration repeatedly

EcDif-Gm1：

5 '-GATGCCCGGGAGGCCTGGTGCGCATAATGTATATTATGTTAAATAGAGGCGGTTTG CGTATTGGGCGCAT-3 ' (SEQ ID № in the sequence table: 1)

EcDif-Gm2:5 '-GATGCCCGGGATTTAACATAATATACATTATGCGCACCAAGCCGATCTCGGCTTGA ACGAATTGT-3 ' (SEQ ID № in the sequence table: 2)

With the synthetic Oligonucleolide primers be primer, with pBR-MCS5 (Kovach ME et al, Gene 166,175-176 (1995)) DNA is a template, utilization PCR therefrom increases and obtains the gentamicin resistant gene, with this PCR product with the SmaI enzyme cut rear clone go into pUC18 (Yanisch-Perron C et al, Gene 33,103-119 (1985)) SmaI site obtains recombinant plasmid pUC-dif _Ec-Gm ^R(see figure 1).Dif wherein _Ec-Gm ^R(SEQ ID № in the sequence table: 3) can cut recombinant plasmid pUC-dif with the SmaI enzyme _Ec-Gm ^RThe blended rubber way of recycling prepares.

Embodiment 3---the encoding gene of the dependent D-serum lactic dehydrogenase of deletion FAD

Synthetic Oligonucleolide primers P1:

5 '-ATA GGATCCAGTACGTCTTGATACCTTCGAAGCGG-3 ' (SEQ ID № in the sequence table: 4)

Synthetic Oligonucleolide primers P2:

5 '-CATCA GGATCCGGATTCATGCTGTTGGTCGGATC-3 ' (SEQ ID № in the sequence table: 5)

With synthetic Oligonucleolide primers P1 and P2 is primer, with intestinal bacteria BEC2198 chromosomal DNA is template, utilization PCR from genome, increase acquisition FAD dependent D-serum lactic dehydrogenase portion gene (dld ', SEQ ID №: 6), this PCR product cloning is gone in the BamHI site of pUC18, obtain recombinant plasmid pUC-dld.With the EcoRV enzyme cut the fragment of removing 438bp wherein and with embodiment one in dif _Ec-Gm ^RConnect, obtain recombinant plasmid pUC-dld ':: dif-Gm ^R, cut this recombinant plasmid with the BamHI enzyme, obtain the gene elmination sequence of the dependent D-serum lactic dehydrogenase of FAD, dld '-dif-Gm ^R-dif-dld ', that is: dld ':: Gm ^R _DifThis gene elmination sequence is transformed into intestinal bacteria BEC2198.On selective medium, select to turn out transformant.On non-selective substratum, go down to posterity again, filter out the transformant that selected marker disappears.Extract the transformant chromosomal DNA, with the sudden change of PCR checking goal gene, obtain transformant BEC-1 (BEC2198, dld) and be used for the starting strain of follow-up study.

Embodiment 4---the encoding gene of deletion pyruvate formate-lyase

Synthetic Oligonucleolide primers P3:

5 '-ATA GAATTCCCGCGAACTGGATCCGATGA-3 ' (SEQ ID № in the sequence table: 7)

Synthetic Oligonucleolide primers P4:

5 '-CCA GAATTCTTCAGACTTCGGACCAACCTGCA-3 ' (SEQ ID № in the sequence table: 8)

With synthetic Oligonucleolide primers P3 and P4 is primer, with intestinal bacteria BEC2198 chromosomal DNA is template, utilization PCR from genome, increase acquisition pyruvate formate-lyase gene (pfl ', SEQ ID № in the sequence table: 9), this PCR product cloning is gone in the EcoRI site of pUC18, obtain recombinant plasmid pUC-pfl.With the PstI enzyme cut the fragment of removing 582bp wherein and with T4DNA Polymerase with the sticky end smoothing, again with embodiment-in dif _Ec-Gm ^RConnect, obtain recombinant plasmid pUC-pfl ':: Gm ^R _Dif, cut this recombinant plasmid with the EcoRI enzyme, obtain the gene elmination sequence of pyruvate formate-lyase, pfl '-dif-Gm ^R-dif-pfl ', that is: pfl ':: Gm ^R _DifWith this gene elmination sequence be transformed into intestinal bacteria BEC-1 (BEC2198, dld).On selective medium, select to turn out transformant.On non-selective substratum, go down to posterity again, filter out the transformant that selected marker disappears.Extract the transformant chromosomal DNA,, obtain transformant BEC-2 (BEC2198, dld, pfl) and be used for the starting strain of follow-up study with the sudden change of PCR checking goal gene.

Embodiment 5---the encoding gene of deletion phosphotransacetylase and E.C. 2.7.2.1

Synthetic Oligonucleolide primers P5:

5 '-TGAACATCATCACCTGCCACCTG-3 ' (SEQ ID № in the sequence table: 10)

Synthetic Oligonucleolide primers P6:

5 '-CAGCGCAAAGCTGCGGATG-3 ' (SEQ ID № in the sequence table: 11)

With synthetic Oligonucleolide primers P5 and P6 is primer, with intestinal bacteria BEC2198 chromosomal DNA is template, utilization PCR from genome, increase acquisition phosphotransacetylase and E.C. 2.7.2.1 (ack-pta ', SEQ ID № in the sequence table: 12), this PCR product cloning is gone in the SmaI site of pUC18, obtain recombinant plasmid pUC-ack-pta '.With the EcoRV enzyme cut the fragment of removing 2633bp wherein and with embodiment one in dif _Ec-Gm ^RConnect, obtain recombinant plasmid pUC-ack-pta ':: Gm ^R _Dif,, obtain the gene elmination sequence of pyruvate formate-lyase, ack '-dif-Gm with EcoRI, this recombinant plasmid of PstI double digestion ^R-dif-pta ', that is: ack-pta ':: Gm ^R _DifThis gene elmination sequence is transformed into intestinal bacteria BEC-2 (BEC2198, dld, pfl).On selective medium, select to turn out transformant.On non-selective substratum, go down to posterity again, filter out the transformant that selected marker disappears.Extract the transformant chromosomal DNA,, obtain transformant BEC-3 (BEC2198, dld, pfl, ack-pta) and be used for the starting strain of follow-up study with the sudden change of PCR checking goal gene.

Embodiment 5---and serum lactic dehydrogenase is replaced alcohol dehydrogenase gene

Synthetic Oligonucleolide primers P7:

5 '-GAT CTGCAGATCTGATCGGCTGGATCGATCAAC-3 ' (SEQ ID № in the sequence table: 13)

Synthetic Oligonucleolide primers P8:

5 '-GAT CTGCAGGAACCAGGTTGGCGTCGACAAT-3 ' (SEQ ID № in the sequence table: 14)

With synthetic Oligonucleolide primers P7 and P8 is primer, with intestinal bacteria BEC2198 chromosomal DNA is template, utilization PCR from genome, increase acquisition ethanol dehydrogenase portion gene (adhE ', SEQ ID № in the sequence table: 15), this PCR product cloning is gone in the PstI site of pUC18, obtain recombinant plasmid pUC-adhE '.

Synthetic Oligonucleolide primers P9:

5 '-TAA GGATCCTTATGAAACTCGCCGTTTATAGCACA-3 ' (SEQ ID № in the sequence table: 16)

Synthetic Oligonucleolide primers P10:

5 '-CTT GAATTCGCTGCCGGAAATCATCATTTTTT-3 ' (SEQ ID № in the sequence table: 17)

With synthetic Oligonucleolide primers P9 and P10 is primer, clones the dependent D-lactic dehydrogenase of NAD enzyme coding gene (ldhA, SEQ ID № in the sequence table: 18) from bacterial strain BEC2198 genome.Recombinant plasmid pUC-adhE ' cuts the fragment of removing 1047bp wherein and is cloned into the ldhA gene fragment with the EcoRV enzyme, obtains recombinant plasmid pUC-adhE ':: ldhA.

Cut recombinant plasmid pUC-adhE ' with the SmaI enzyme:: ldhA, and with embodiment one in dif _Ec-Gm ^RConnect, obtain recombinant plasmid pUC-adhE ':: ldhA-dif-Gm ^R(see figure 2) is cut this recombinant plasmid with the PstI enzyme, obtains the gene order that serum lactic dehydrogenase is replaced ethanol dehydrogenase, adhE '-ldhA-dif-Gm ^R-dif-adhE ', that is: adhE ':: ldhA-Gm ^R _DifThis gene elmination sequence is transformed into intestinal bacteria BEC-3 (BEC2198, dld, pfl, ack-pta).On selective medium, select to turn out transformant.On non-selective substratum, go down to posterity again, filter out the transformant that selected marker disappears.Extract the transformant chromosomal DNA,, obtain transformant BEC-4 (BEC2198, dld, pfl, ack-pta, adhE::ldhA) and be used for the starting strain of follow-up study with the sudden change of PCR checking goal gene.

Embodiment 6---the encoding gene of deletion glucose phosphotransferase

Synthetic Oligonucleolide primers P11:

5 '-CCG GAATTCCAATCCATCCGTTGAATGAG-3 ' (SEQ ID № in the sequence table: 19)

Synthetic Oligonucleolide primers P12:

5 '-CCG GAATTCCTGTCATGCCAGAGTTGACGGTC-3 ' (SEQ ID № in the sequence table: 20)

With synthetic Oligonucleolide primers P11 and P12 is primer, with intestinal bacteria BEC2198 chromosomal DNA is template, utilization PCR from genome, increase acquisition glucose phosphotransferase gene (ptsG ', SEQ ID № in the sequence table: 21), this PCR product cloning is gone in the EcoRI site of pUC18, obtain recombinant plasmid pUC-ptsG '.With the EcoRV enzyme cut the fragment of removing 700bp wherein and with embodiment one in dif _Ec-Gm ^RConnect, obtain the gene elmination sequence of glucose phosphotransferase, ptsG '-dif-Gm ^R-dif-ptsG ', that is: ptsG ':: Gm ^R _DifThis gene elmination sequence is transformed into intestinal bacteria BEC-4 (BEC2198, dld, pfl, ack-pta, adhE::ldhA).On selective medium, select to turn out transformant.On non-selective substratum, go down to posterity again, filter out the transformant that selected marker disappears.Extract the transformant chromosomal DNA,, obtain transformant BEC-5 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG) and be used for the starting strain of follow-up study with the sudden change of PCR checking goal gene.

Embodiment 7---the encoding gene of deletion glucokinase enzyme

Synthetic Oligonucleolide primers P13:

5 '-CCG GAATTCGATCGATATTTACAGGGAGC-3 ' (SEQ ID № in the sequence table: 22)

Synthetic Oligonucleolide primers P14:

5 '-CCG GAATTCAGTGATAGTTGACGAG-3 ' (SEQ ID № in the sequence table: 23)

With synthetic Oligonucleolide primers P13 and P14 is primer, is template with intestinal bacteria BEC2198 chromosomal DNA, utilization PCR from genome, increase acquisition glucose phosphotransferase gene (glk ', SEQ ID № in the sequence table: 24)

This PCR product cloning is gone in the EcoRI site of pUC18, obtain recombinant plasmid pUC-glk '.With the EcoRV enzyme cut the fragment of removing 687bp wherein and with embodiment one in dif _Ec-Gm ^RConnect, obtain the gene elmination sequence of glucose phosphotransferase, glk '-dif-Gm ^R-dif-glk ', that is: glk ':: Gm ^R _DifThis gene elmination sequence is transformed into intestinal bacteria BEC-5 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG).On selective medium, select to turn out transformant.On non-selective substratum, go down to posterity again, filter out the transformant that selected marker disappears.Extract the transformant chromosomal DNA,, obtain transformant BEC-6 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG, Δ glk) and be used for the starting strain of follow-up study with the sudden change of PCR checking goal gene.

Embodiment 8---and deletion seminose phosphoric acid shifts the encoding gene of permease

Synthetic Oligonucleolide primers P15:

5 '-CCG GAATTCAGGTGAGCGAAATGGTTGA-3 ' (SEQ ID № in the sequence table: 25)

Synthetic Oligonucleolide primers P16:

5 '-CCG GAATTCCAACAGTCTTACAGTCC-3 ' (SEQ ID № in the sequence table: 26)

With synthetic Oligonucleolide primers P15 and P16 is primer, with intestinal bacteria BEC2198 chromosomal DNA is template, utilization PCR from genome, increase acquisition glucose phosphotransferase gene (manZ ', SEQ ID № in the sequence table: 27), this PCR product cloning is gone in the EcoRI site of pUC18, obtain recombinant plasmid pUC-manZ '.With the EcoRV enzyme cut the fragment of removing 561bp wherein and with embodiment one in dif _Ec-Gm ^RConnect, obtain the gene elmination sequence of glucose phosphotransferase, manZ '-dif-Gm ^R-dif-manZ ', that is: manZ ':: Gm ^R _DifThis gene elmination sequence is transformed into intestinal bacteria BEC-6 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG, Δ glk).On selective medium, select to turn out transformant.On non-selective substratum, go down to posterity again, filter out the transformant that selected marker disappears.Extract the transformant chromosomal DNA,, obtain transformant BEC-7 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG, Δ glk, Δ manZ) and be used for the starting strain of follow-up study with the sudden change of PCR checking goal gene.

Embodiment 9---the encoding gene of deletion xylose isomerase

Synthetic Oligonucleolide primers P17:

5 ' CCG GAATTCCCTGATTATGGAGTTCAATATGCAAGCC-3 ' (SEQ ID № in the sequence table: 28)

Synthetic Oligonucleolide primers P18:

5 '-CCG GAATTCGACTGCACAGTTAGCCGTTATTTGTCGA-3 ' (SEQ ID № in the sequence table: 29)

With synthetic Oligonucleolide primers P17 and P18 is primer, is template with intestinal bacteria BEC2198 chromosomal DNA, the utilization PCR from genome, increase the acquisition xylose isomerase gene (xylA ', SEQ ID № in the sequence table: 26)

This PCR product cloning is gone in the EcoRI site of pUC18, obtain recombinant plasmid pUC-xylA '.With the EcoRV enzyme cut the fragment of removing 1299bp wherein and with embodiment one in dif _Ec-Gm ^RConnect, obtain the gene elmination sequence of xylose isomerase, xylA '-dif-Gm ^R-dif-xylA ', that is: xylA ':: Gm ^R _DifThis gene elmination sequence is transformed into intestinal bacteria BEC-7 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG, Δ glk, Δ manZ).On selective medium, select to turn out transformant.On non-selective substratum, go down to posterity again, filter out the transformant that selected marker disappears.Extract the transformant chromosomal DNA, with the sudden change of PCR checking goal gene, obtain transformant BEC-8 (BEC2198, dld, pfl, ack-pta, adhE::ldhA, Δ ptsG, Δ glk, Δ manZ, Δ xylA) (CCTCC M 2010024) and be used for the starting strain of follow-up study.

Embodiment 10---and 7L fermentation cylinder for fermentation glycerine is produced D-lactic acid

Adopt under the condition of 32～40 ℃ of LB substratum, shaking speed 200r/min is cultured to the logarithmic phase middle and later periods, obtains first order seed; 5% inoculum size is forwarded to MG substratum (g/L): Na ₂HPO ₄6, KH ₂PO ₄3, NH ₄Cl 1, and NaCl 0.5, and the every liter of substratum in sterilization back adds the aseptic 1mol/L MgSO of 0.5～2mL ₄, it is 5g/L that glycerine initially adds concentration.Under 30～42 ℃ the condition, shaking speed 200～230r/min is cultured to the logarithmic phase middle and later periods, obtains secondary seed, is used for the fermentor tank inoculation.

Adopt the MG substratum as fermention medium, 7L fermentor tank liquid amount 3L, 1～5% inoculum size.The initial glycerol concentration 2～5% of thalli growth, culture temperature is 30～42 ℃, the control dissolved oxygen is not less than 30%, Ca (OH) ₂Keeping pH is 6.5～7.4; When rotating speed reaches 400～500r/min, stop the related of dissolved oxygen and rotating speed, dissolved oxygen can be reduced to 1.0～2.0 gradually, fixed rotating speed 400～500r/min and ventilation 4～6L/min, add glycerine to final concentration 4～6%, monitor oxyty in the fermenting process, when oxyty rises rapidly (glycerine exhausts), add glycerine once more to final concentration 4～6%.Timing sampling is used for high pressure liquid phase analysis in the fermenting process.

The wild D-lactic-acid-producing strain BEC2198 that screening obtains can produce lactic acid by the metabolism glycerol fermentation, fermentation 36h, and the D-lactic acid production can reach 99.1g/L.Fermenting process association acetate, succsinic acid, formic acid, the by product of pyruvic acid and alcohol, the about 12.5g/L of total by-product concentration.The D-lactic acid optical purity that fermentation obtains is 98.90%.It tolerates the about 160g/L of maximum concentration of glycerine simultaneously.Because by product is more, D-output is relatively low, and institute's D-lactic acid optical purity of producing is hanged down the direct industrial applications that has limited this bacterial strain.This bacterial strain is carried out knocking out of by product route of synthesis key gene, blocking-up by product synthetic, and block it and utilize D-lactic acid to change into the approach of pyruvic acid, not only having improved the output of D-lactic acid, its optical purity has also obtained effective raising.

Reorganization bacterium BEC-4 through genetic modification promptly is based on the aimed strain that above-mentioned thinking obtains, this bacterial strain utilizes glycerol fermentation 36h acid yield to improve 103g/L, produce the acid molar ratio wild strain and improve nearly 4%, the D-lactic acid optical purity that generates is also brought up to more than 99.9%, because reduced the generation of by product, its tolerance to glycerine has also improved 165g/L.

Improve bacterial strain and can effectively improve the product strength of acid the tolerance performance of glycerine.Glucose, seminose, wood sugars etc. all are easier to be utilized by thalline than glycerine as carbon source.By to the knocking out of this three kinds of sugar metabolism key genes, block its pathways metabolism, can effectively improve the utilization ratio of bacterial strain to glycerine.Not only can improve the product strength of acid, bacterial strain has also obtained bigger raising to the tolerance of glycerine.

PtsG gene and glk gene utilize in glucose metabolism and play a part key in the process.PtsG knocks out back glucose metabolism approach and partly is blocked, and produces acid based on the reorganization bacterium BEC-5 of this acquisition and reaches 109.2g/L, and the more original bacterium of acid yield is improved more than 10%, and this reorganization bacterium tolerance glycerol concentration also is increased to 170g/L, and more original bacterium raising is more than 6%.After knocking out the glk gene simultaneously, the reorganization bacterium BEC-6 of acquisition, the glucose metabolism approach is blocked fully, produces the acid amount and is 114g/L, and more original bacterium increase rate is about 15%, and glycerine tolerance concentration has also improved more than 15%.

After the encoding gene of seminose phosphoric acid transfer permease knocks out, the reorganization bacterium BEC-7 that obtains, the ability of its tolerance glycerine is greatly improved, tolerance glycerine maximum concentration is 200g/L, the more original bacterium of increase rate is high by 25%, the output of D-lactic acid is also near 120g/L, and more original bacterium has been improved more than 20%.

XylA is the encoding gene of xylose isomerase, after knocking out this gene, the xylose metabolism approach is blocked fully, and the reorganization bacterium BEC-8 that obtains can tolerate the glycerol concentration that is up to 210g/L, the more original bacterium of glycerine tolerance performance is improved more than 30%, acid yield is increased to 124g/L, and more original bacterium is improved more than 25%.When this reorganization bacterium generates D-lactic acid only association be not higher than the by product of 0.5g/L, the optical purity of the D-lactic acid that produces is the good metabolism glycerol fermentation production D-lactic acid-producing bacterial strain of a strain up to 99.95%, has high industrial utilization value.

Relevant fermentation data see Table 3-5.

The reorganization bacterium of table 3 process genetic modification is to the tolerance of glycerine and the raising of D-lactic acid production

*: with reference to the MIC value tolerance intensity investigation method (J.E.Purvis, L.P.Yomano, L.O.Ingram, Applied and Environmental Microbiology, 2005) of definition such as J.E.Purvis

Table 4 produces by product generation situation in the D-lactic acid process through the reorganization bacterium ferment glycerin of genetic modification

Table 5 is through the repeated experiments of the optimum reorganization bacterium BEC-8 ferment glycerin product D-lactic acid of genetic modification

*: control strain is the reorganization bacterium BEC2198 through genetic modification

Sequence table

<210>SEQ?ID?NO：1

<211>70

<212>DNA

＜213〉artificial sequence

gatgcccggg?aggcctggtg?cgcataatgt?atattatgtt?aaatagaggc?ggtttgcgta?ttgggcgcat?70

<210>SEQ?ID?NO：2

<211>65

<212>DNA

＜213〉artificial sequence

gatgcccggg?atttaacata?atatacatta?tgcgcaccaa?gccgatctcg?gcttgaacga?attgt?65

<210>SEQ?ID?NO：3

<211>1033

<212>DNA

<213>dif _Ec-Gm ^R

1 GGGAGGCCTG?GTGCGCATAA?TGTATATTAT?GTTAAATAGA?GGCGGTTTGC?GTATTGGGCG

61 CATGCATAAA?AACTGTTGTA?ATTCATTAAG?CATTCTGCCG?ACATGGAAGC?CATCACAAAC

121?GGCATGATGA?ACCTGAATCG?CCAGCGGCAT?CAGCACCTTG?TCGCCTTGCG?TATAATATTT

181?GCCCATGGAC?GCACACCGTG?GAAACGGATG?AAGGCACGAA?CCCAGTTGAC?ATAAGCCTGT

241?TCGGTTCGTA?AACTGTAATG?CAAGTAGCGT?ATGCGCTCAC?GCAACTGGTC?CAGAACCTTG

301?ACCGAACGCA?GCGGTGGTAA?CGGCGCAGTG?GCGGTTTTCA?TGGCTTGTTA?TGACTGTTTT

361?TTTGTACAGT?CTATGCCTCG?GGCATCCAAG?CAGCAAGCGC?GTTACGCCGT?GGGTCGATGT

421?TTGATGTTAT?GGAGCAGCAA?CGATGTTACG?CAGCAGCAAC?GATGTTACGC?AGCAGGGCAG

481?TCGCCCTAAA?ACAAAGTTAG?GTGGCTCAAG?TATGGGCATC?ATTCGCACAT?GTAGGCTCGG

541?CCCTGACCAA?GTCAAATCCA?TGCGGGCTGC?TCTTGATCTT?TTCGGTCGTG?AGTTCGGAGA

601?CGTAGCCACC?TACTCCCAAC?ATCAGCCGGA?CTCCGATTAC?CTCGGGAACT?TGCTCCGTAG

661?TAAGACATTC?ATCGCGCTTG?CTGCCTTCGA?CCAAGAAGCG?GTTGTTGGCG?CTCTCGCGGC

721?TTACGTTCTG?CCCAGGTTTG?AGCAGCCGCG?TAGTGAGATC?TATATCTATG?ATCTCGCAGT

781?CTCCGGCGAG?CACCGGAGGC?AGGGCATTGC?CACCGCGCTC?ATCAATCTCC?TCAAGCATGA

841?GGCCAACGCG?CTTGGTGCTT?ATGTGATCTA?CGTGCAAGCA?GATTACGGTG?ACGATCCCGC

901?AGTGGCTCTC?TATACAAAGT?TGGGCATACG?GGAAGAAGTG?ATGCACTTTG?ATATCGACCC

961?AAGTACCGCC?ACCTAACAAT?TCGTTCAAGC?CGAGATCGGC?TTGGTGCGCA?TAATGTATAT

1021TATGTTAAAT?CCC

<210>SEQ?ID?NO：4

<211>35

<212>DNA

＜213〉artificial sequence

ataggatcca?gtacgtcttg?ataccttcga?agcgg?35

<210>SEQ?ID?NO：5

<211>34

<212>DNA

＜213〉artificial sequence

catcaggatc?cggattcatg?ctgttggtcg?gatc?34

<210>SEQ?ID?NO：6

<211>876

<212>DNA

<213>dld’

1 AGTACGTCTT?GATACCTTCG?AAGCGGAAAA?AAATCAGCAG?GTGTTTTATA?TCGGCACCAA

61 CCAGCCGGAA?GTGCTGACCG?AAATCCGCCG?TCATATTCTG?GCTAACTTCG?AAAATCTGCC

121?GGTTGCCGGG?GAATATATGC?ACCGGGATAT?CTACGATATT?GCGGAAAAAT?ACGGCAAAGA

181?CACCTTCCTG?ATGATTGATA?AGTTAGGCAC?CGACAAGATG?CCGTTCTTCT?TTAATCTCAA

241?GGGACGCACC?GATGCGATGC?TGGAGAAAGT?GAAATTCTTC?CGTCCGCATT?TTACTGACCG

301?TGCGATGCAA?AAATTCGGTC?ACCTGTTCCC?CAGCCATTTA?CCGCCGCGCA?TGAAAAACTG

361?GCGCGATAAA?TACGAGCATC?ATCTGCTGTT?AAAAATGGCG?GGCGATGGCG?TGGGCGAAGC

421?CAAATCGTGG?CTGGTGGATT?ATTTCAAACA?GGCCGAAGGC?GATTTCTTTG?TCTGTACGCC

481?GGAGGAAGGC?AGCAAAGCGT?TTTTACACCG?TTTCGCCGCT?GCGGGCGCAG?CAATTCGTTA

541?TCAGGCGGTG?CATTCCGATG?AAGTCGAAGA?CATTCTGGCG?TTGGATATCG?CTCTGCGGCG

601?TAACGACACC?GAGTGGTATG?AGCATTTACC?GCCGGAGATC?GACAGCCAGC?TGGTGCACAA

661?GCTCTATTAC?GGCCATTTTA?TGTGCTATGT?CTTCCATCAG?GATTACATAG?TGAAAAAAGG

721?CGTGGATGTG?CATGCGTTAA?AAGAACAGAT?GCTGGAACTG?CTACAGCAGC?GCGGCGCGCA

781?GTACCCTGCC?GAGCATAACG?TCGGTCATTT?GTATAAAGCA?CCGGAGACGT?TGCAGAAGTT

841?CTATCGCGAG?AACGATCCGA?CCAACAGCAT?GAATCC<210>SEQ?ID?NO：7

<211>29

<212>DNA

＜213〉artificial sequence

atagaattcc?cgcgaactgg?atccgatga?29

<210>SEQ?ID?NO：8

<211>32

<212>DNA

＜213〉artificial sequence

ccagaattct?tcagacttcg?gaccaacctg?ca?32

<210>SEQ?ID?NO：9

<211>1012

<212>DNA

<213>pfl’

1 CCGCGAACTG?GATCCGATGA?TCAAAAAAAT?CTTCACTGAA?TACCGTAAAA?CTCACAACCA

61?GGGCGTGTTC?GACGTTTACA?CTCCGGACAT?CCTGCGTTGC?CGTAAATCTG?GTGTTCTGAC

121CGGTCTGCCA?GATGCATATG?GCCGTGGCCG?TATCATCGGT?GACTACCGTC?GCGTTGCGCT

181GTACGGTATC?GACTACCTGA?TGAAAGACAA?ACTGGCACAG?TTCACTTCTC?TGCAGGCTGA

241TCTGGAAAAC?GGCGTAAACC?TGGAACAGAC?TATCCGTCTG?CGCGAAGAAA?TCGCTGAACA

301GCACCGCGCT?CTGGGTCAGA?TGAAAGAAAT?GGCTGCGAAA?TACGGCTACG?ACATCTCTGG

361TCCGGCTACC?AACGCTCAGG?AAGCTATCCA?GTGGACTTAC?TTCGGCTACC?TGGCTGCTGT

421TAAGTCTCAG?AACGGTGCTG?CAATGTCCTT?CGGTCGTACC?TCCACCTTCC?TGGATGTGTA

481CATCGAACGT?GACCTGAAAG?CTGGCAAGAT?CACCGAACAA?GAAGCGCAGG?AAATGGTTGA

541CCACCTGGTC?ATGAAACTGC?GTATGGTTCG?CTTCCTGCGT?ACTCCGGAAT?ACGATGAACT

601GTTCTCTGGC?GACCCGATCT?GGGCAACCGA?ATCTATCGGT?GGTATGGGCC?TCGACGGTCG

661TACCCTGGTT?ACCAAAAACA?GCTTCCGTTT?CCTGAACACC?CTGTACACCA?TGGGTCCGTC

721TCCGGAACCG?AACATGACCA?TTCTGTGGTC?TGAAAAACTG?CCGCTGAACT?TCAAGAAATT

781CGCCGCTAAA?GTGTCCATCG?ACACCTCTTC?TCTGCAGTAT?GAGAACGATG?ACCTGATGCG

841TCCGGACTTC?AACAACGATG?ACTACGCTAT?TGCTTGCTGC?GTAAGCCCGA?TGATCGTTGG

901TAAACAAATG?CAGTTCTTCG?GTGCGCGTGC?AAACCTGGCG?AAAACCATGC?TGTACGCAAT

961CAACGGCGGC?GTTGACGAAA?AACTGAAAAT?GCAGGTTGGT?CCGAAGTCTG?AA

<210>SEQ?ID?NO：10

<211>23

<212>DNA

＜213〉artificial sequence

tgaacatcat?cacctgccac?ctg?23

<210>SEQ?ID?NO：11

<211>19

<212>DNA

＜213〉artificial sequence

cagcgcaaag?ctgcggatg?19

<210>SEQ?ID?NO：12

<211>2839

<212>DNA

<213>ack-pta’

1 TGAACATCAT?CACCTGCCAC?CTGGGCAACG?GTGGTTCCGT?TTCTGCTATC?CGCAACGGTA

61?AATGCGTTGA?CACCTCTATG?GGCCTGACCC?CGCTGGAAGG?TCTGGTCATG?GGTACCCGTT

121CTGGTGATAT?CGATCCGGCG?ATCATCTTCC?ACCTGCACGA?CACCCTGGGC?ATGAGCGTTG

181ACGCAATCAA?CAAACTGCTG?ACCAAAGAGT?CTGGCCTGCT?GGGTCTGACC?GAAGTGACCA

241GCGACTGCCG?CTATGTTGAA?GACAACTACG?CGACGAAAGA?AGACGCGAAG?CGCGCAATGG

301ACGTTTACTG?CCACCGCCTG?GCGAAATACA?TCGGTGCCTA?CACTGCGCTG?ATGGATGGTC

361GTCTGGACGC?TGTTGTATTC?ACTGGTGGTA?TCGGTGAAAA?TGCCGCAATG?GTTCGTGAAC

421TGTCTCTGGG?CAAACTGGGC?GTGCTGGGCT?TTGAAGTTGA?TCATGAACGC?AACCTGGCTG

481CACGTTTCGG?CAAATCTGGT?TTCATCAACA?AAGAAGGTAC?CCGTCCTGCG?GTGGTTATCC

541CAACCAACGA?AGAACTGGTT?ATCGCGCAAG?ACGCGAGCCG?CCTGACTGCC?TGATTTCACA

601CCGCCAGCTC?AGCTGGCGGT?GCTGTTTTGT?AACCCGCCAA?ATCGGCGGTA?ACGAAAGAGG

661ATAAACCGTG?TCCCGTATTA?TTATGCTGAT?CCCTACCGGA?ACCAGCGTCG?GTCTGACCAG

721CGTCAGCCTT?GGCGTGATCC?GTGCAATGGA?ACGCAAAGGC?GTTCGTCTGA?GCGTTTTCAA

781ACCTATCGCT?CAGCCGCGTA?CCGGTGGCGA?TGCGCCCGAT?CAGACTACGA?CTATCGTGCG

841TGCGAACTCT?TCCACCACGA?CGGCCGCTGA?ACCGCTGAAA?ATGAGCTACG?TTGAAGGTCT

901GCTTTCCAGC?AATCAGAAAG?ATGTGCTGAT?GGAAGAGATC?GTCGCAAACT?ACCACGCTAA

961CACCAAAGAC?GCTGAAGTCG?TTCTGGTTGA?AGGTCTGGTC?CCGACACGTA?AGCACCAGTT

1021TGCCCAGTCT?CTGAACTACG?AAATCGCTAA?AACGCTGAAT?GCGGAAATCG?TCTTCGTTAT

1081GTCTCAGGGC?ACTGACACCC?CGGAACAGCT?GAAAGAGCGT?ATCGAACTGA?CCCGCAACAG

1141CTTCGGCGGT?GCCAAAAACA?CCAACATCAC?CGGCGTTATC?GTTAACAAAC?TGAACGCACC

1201GGTTGATGAA?CAGGGTCGTA?CTCGCCCGGA?TCTGTCCGAG?ATTTTCGACG?ACTCTTCCAA

1261AGCTAAAGTA?AACAATGTTG?ATCCGGCGAA?GCTGCAAGAA?TCCAGCCCGC?TGCCGGTTCT

1321CGGCGCTGTG?CCGTGGAGCT?TTGACCTGAT?CGCGACTCGT?GCGATCGATA?TGGCTCGCCA

1381CCTGAATGCG?ACCATCATCA?ACGAAGGCGA?CATCAATACT?CGCCGCGTTA?AATCCGTCAC

1441TTTCTGCGCA?CGCAGCATTC?CGCACATGCT?GGAGCACTTC?CGTGCCGGTT?CTCTGCTGGT

1501GACTTCCGCA?GACCGTCCTG?ACGTGCTGGT?GGCCGCTTGC?CTGGCAGCCA?TGAACGGCGT

1561AGAAATCGGT?GCCCTGCTGC?TGACTGGCGG?TTACGAAATG?GACGCGCGCA?TTTCTAAACT

1621GTGCGAACGT?GCTTTCGCTA?CCGGCCTGCC?GGTATTTATG?GTGAACACCA?ACACCTGGCA

1681GACCTCTCTG?AGCCTGCAGA?GCTTCAACCT?GGAAGTTCCG?GTTGACGATC?ACGAACGTAT

1741CGAGAAAGTT?CAGGAATACG?TTGCTAACTA?CATCAACGCT?GACTGGATCG?AATCTCTGAC

1801TGCCACTTCT?GAGCGCAGCC?GTCGTCTGTC?TCCGCCTGCG?TTCCGTTATC?AGCTGACTGA

1861ACTTGCGCGC?AAAGCGGGCA?AACGTATCGT?ACTGCCGGAA?GGTGACGAAC?CGCGTACCGT

1921TAAAGCAGCC?GCTATCTGTG?CTGAACGTGG?TATCGCAACT?TGCGTACTGC?TGGGTAATCC

1981GGCAGAGATC?AACCGTGTTG?CAGCGTCTCA?GGGTGTAGAA?CTGGGTGCAG?GGATTGAAAT

2041CGTTGATCCA?GAAGTGGTTC?GCGAAAGCTA?TGTTGGTCGT?CTGGTCGAAC?TGCGTAAGAA

2101CAAAGGCATG?ACCGAAACCG?TTGCCCGCGA?ACAGCTGGAA?GACAACGTGG?TGCTCGGTAC

2161GCTGATGCTG?GAACAGGATG?AAGTTGATGG?TCTGGTTTCC?GGTGCTGTTC?ACACTACCGC

2221AAACACCATC?CGTCCGCCGC?TGCAGCTGAT?CAAAACTGCA?CCGGGCAGCT?CCCTGGTATC

2281TTCCGTGTTC?TTCATGCTGC?TGCCGGAACA?GGTTTACGTT?TACGGTGACT?GTGCGATCAA

2341CCCGGATCCG?ACCGCTGAAC?AGCTGGCAGA?AATCGCGATT?CAGTCCGCTG?ATTCCGCTGC

2401GGCCTTCGGT?ATCGAACCGC?GCGTTGCTAT?GCTCTCCTAC?TCCACCGGTA?CTTCTGGTGC

2461GGTAGCGACG?TAGAAAAAGT?TCGCGAAGCA?ACTCGTCTGG?CGCAGGAAAA?ACGTCCTGAC

2521CTGATGATCG?ACGGTCCGCT?GCAGTACGAC?GCTGCGGTAA?TGGCTGACGT?TGCGAAATCC

2581AAAGCGCCGA?ACTCTCCGGT?TGCAGGTCGC?GCTACCGTGT?TCATCTTCCC?GGATCTGAAC

2641ACCGGTAACA?CCACCTACAA?AGCGGTACAG?CGTTCTGCCG?ACCTGATCTC?CATCGGGCCG

2701ATGCTGCAGG?GTATGCGCAA?GCCGGTTAAC?GACCTGTCCC?GTGGCGCACT?GGTTGACGAT

2761ATCGTCTACA?CCATCGCGCT?GACTGCGATT?CAGTCTGCAC?AGCAGCAGTA?ATCTCGTCAT

2821CATCCGCAGC?TTTGCGCTG

<210>SEQ?ID?NO：13

<211>33

<212>DNA

＜213〉artificial sequence

gatctgcaga?tctgatcggc?tggatcgatc?aac?33

<210>SEQ?ID?NO：14

<211>31

<212>DNA

＜213〉artificial sequence

gatctgcagg?aaccaggttg?gcgtcgacaa?t?31

<210>SEQ?ID?NO：15

<211>1425

<212>DNA

<213>adhE’

1 ATCTGATCGG?CTGGATCGAT?CAACCTTCTG?TTGAACTGTC?TAACGCACTG?ATGCACCACC

61 CAGACATCAA?CCTGATCCTC?GCGACTGGTG?GTCCGGGCAT?GGTTAAAGCC?GCATACAGCT

121?CCGGTAAACC?AGCTATCGGT?GTAGGCGCGG?GCAACACTCC?AGTTGTTATC?GATGAAACTG

181?CTGATATCAA?ACGTGCAGTT?GCATCTGTAC?TGATGTCCAA?AACCTTCGAC?AACGGCGTAA

241?TCTGTGCTTC?TGAACAGTCT?GTTGTTGTTG?TTGACTCTGT?TTATGACGCT?GTACGTGAAC

301?GTTTTGCAAC?CCACGGCGGC?TATCTGTTGC?AGGGTAAAGA?GCTGAAAGCT?GTTCAGGATG

361?TTATCCTGAA?AAACGGTGCG?CTGAACGCGG?CTATCGTTGG?TCAGCCAGCC?TATAAAATTG

421?CTGAACTGGC?AGGCTTCTCT?GTACCAGAAA?ACACCAAGAT?TCTGATCGGT?GAAGTGACCG

481?TTGTTGATGA?AAGCGAACCG?TTCGCACATG?AAAAACTGTC?CCCGACTCTG?GCAATGTACC

541?GCGCTAAAGA?TTTCGAAGAC?GCGGTAGAAA?AAGCAGAGAA?ACTGGTTGCT?ATGGGCGGTA

601?TCGGTCATAC?CTCTTGCCTG?TACACTGACC?AGGATAACCA?ACCGGCTCGC?GTTTCTTACT

661?TCGGTCAGAA?AATGAAAACG?GCGCGTATCC?TGATTAACAC?CCCAGCGTCT?CAGGGTGGTA

721?TCGGTGACCT?GTATAACTTC?AAACTCGCAC?CTTCCCTGAC?TCTGGGTTGT?GGTTCTTGGG

781?GTGGTAACTC?CATCTCTGAA?AACGTTGGTC?CGAAACACCT?GATCAACAAG?AAAACCGTTG

841?CTAAGCGAGC?TGAAAACATG?TTGTGGCACA?AACTTCCGAA?ATCTATCTAC?TTCCGCCGTG

901?GCTCCCTGCC?AATCGCGCTG?GATGAAGTGA?TTACTGATGG?CCACAAACGT?GCGCTCATCG

961?TGACTGACCG?CTTCCTGTTC?AACAATGGTT?ATGCTGATCA?GATCACTTCC?GTACTGAAAG

1021CAGCAGGCGT?TGAAACTGAA?GTCTTCTTCG?AAGTAGAAGC?GGACCCGACC?CTGAGCATCG

1081TTCGTAAAGG?TGCAGAACTG?GCAAACTCCT?TCAAACCAGA?CGTGATTATC?GCGCTGGGTG

1141GTGGTTCCCC?GATGGACGCC?GCGAAGATCA?TGTGGGTTAT?GTACGAACAT?CCGGAAACTC

1201ACTTCGAAGA?GCTGGCGCTG?CGCTTTATGG?ATATCCGTAA?ACGTATCTAC?AAGTTCCCGA

1261AAATGGGCGT?GAAAGCGAAA?ATGATCGCTG?TCACCACCAC?TTCTGGTACA?GGTTCTGAAG

1321TCACTCCGTT?TGCGGTTGTA?ACTGACGACG?CTACTGGTCA?GAAATATCCG?CTGGCAGACT

1381ATGCGCTGAC?TCCGGATATG?GCGATTGTCG?ACGCCAACCT?GGTTA

<210>SEQ?ID?NO：16

<211>35

<212>DNA

＜213〉artificial sequence

taaggatcct?tatgaaactc?gccgtttata?gcaca?35

<210>SEQ?ID?NO：17

<211>32

<212>DNA

＜213〉artificial sequence

cttgaattcg?ctgccggaaa?tcatcatttt?tt?32

<210>SEQ?ID?NO：18

<211>1298

<212>DNA

<213>ldhA

1 CTTATGAAAC?TCGCCGTTTA?TAGCACAAAA?CAGTACGACA?AGAAGTACCT?GCAACAGGTG

61 AACGAGTCCT?TTGGCTTTGA?GCTGGAATTT?TTTGACTTTC?TGCTGACGGA?AAAAACCGCT

121?AAAACTGCCA?ATGGCTGCGA?AGCGGTATGT?ATTTTCGTAA?ACGATGACGG?CAGCCGCCCG

181?GTGCTGGAAG?AGCTGAAAAA?GCACGGCGTT?AAATATATCG?CCCTGCGCTG?TGCCGGTTTC

241?AATAACGTCG?ACCTTGACGC?GGCAAAAGAA?CTGGGGCTGA?AAGTAGTCCG?TGTTCCAGCC

301?TATGATCCAG?AGGCCGTTGC?TGAACACGCC?ATCGGTATGA?TGATGACGCT?GAACCGCCGT

361?ATTCACCGCG?CGTATCAGCG?TACCCGTGAT?GCTAACTTCT?CTCTGGAAGG?TCTGACCGGC

421?TTTACTATGT?ATGGCAAAAC?GGCAGGCGTT?ATCGGTACCG?GTAAAATCGG?TGTGGCGATG

481?CTGCGCATTC?TGAAAGGTTT?TGGTATGCGT?CTGCTGGCGT?TCGATCCGTA?TCCAAGTGCA

541?GCGGCGCTGG?AACTCGGTGT?GGAGTATGTC?GATCTGCCAA?CCCTGTTCTC?TGAATCAGAC

601?GTTATCTCTC?TGCACTGCCC?GCTGACACCG?GAAAACTATC?ATCTGTTGAA?CGAAGCCGCC

661?TTCGAACAGA?TGAAAAATGG?CGTGATGATC?GTCAATACCA?GTCGCGGTGC?ATTGATTGAT

721?TCTCAGGCAG?CAATTGAAGC?GCTGAAAAAT?CAGAAAATTG?GTTCGTTGGG?TATGGACGTG

781?TATGAGAACG?AACGCGATCT?ATTCTTTGAA?GATAAATCCA?ACGACGTGAT?CCAGGATGAC

841?GTATTCCGTC?GCCTGTCTGC?CTGCCACAAC?GTGCTGTTTA?CCGGGCACCA?GGCATTCCTG

901?ACAGCAGAAG?CTCTGACCAG?TATTTCTCAG?ACTACGCTGC?AAAACTTAAG?CAATCTGGAA

961?AAAGGCGAAA?CCTGCCCGAA?CGAACTGGTT?TAATCTTGCC?GCTCCCCTGC?ATTCCAGGGG

1021AGCTGATTCA?GATAATCCCC?AATGACCTTT?CATCCTCTAT?TCTTAAAATA?GTCCTGAGTC

1081AGAAACTGTA?ATTGAGAACC?ACAATGAAGA?AAGTAGCCGC?GTTTGTTGCG?CTAAGCCTGC

1141TGATGGCGGG?ATGTGTAAGT?AATGACAAAA?TTGCTGTTAC?GCCAGAACAG?CTACAGCATC

1201ATCGCTTTGT?GCTGGAAAGC?GTAAACGGTA?AGCCCGTGAC?CAGCGATAAA?AATCCGCCAG

1261AAATCAGCTT?TGGTGAAAAA?ATGATGATTT?CCGGCAGC

<210>SEQ?ID?NO：19

<211>29

<212>DNA

＜213〉artificial sequence

ccggaattcc?aatccatccg?ttgaatgag?29

<210>SEQ?ID?NO：20

<211>32

<212>DNA

＜213〉artificial sequence

ccggaattcc?tgtcatgcca?gagttgacgg?tc?32

<210>SEQ?ID?NO：21

<211>2071

<212>DNA

<213>ptsG’

1 CAATCCATCC?GTTGAATGAG?TTTTTTTAAA?GCTCGTAATT?AATGGCTAAA?ACGAGTAAAG

61 TTCACCGCCG?AAAATTGGGC?GGTGAATAAC?CACGTTTGAA?ATATTGTGAC?ATATGTTTTG

121?TCAAAATGTG?CAACTTCTCC?AATGATCTGA?AGTTGAAACG?TGATAGCCGT?CAAACAAATT

181?GGCACTGAAT?TATTTTACTC?TGTGTAATAA?ATAAAGGGCG?CTTAGATGCC?CTGTACACGG

241?CGAGGCTCTC?CCCCCTTGCC?ACGCGTGAGA?ACGTAAAAAA?AGCACCCATA?CTCAGGAGCA

301?CTCTCAATTA?TGTTTAAGAA?TGCATTTGCT?AACCTGCAAA?AGGTCGGTAA?ATCGCTGATG

361?CTGCCGGTAT?CCGTACTGCC?TATCGCAGGT?ATTCTGCTGG?GCGTCGGTTC?CGCGAATTTC

421?AGCTGGCTGC?CCGCCGTTGT?ATCGCATGTT?ATGGCAGAAG?CAGGCGGTTC?CGTCTTTGCA

481?AACATGCCAC?TGATTTTTGC?GATCGGTGTC?GCCCTCGGCT?TTACCAATAA?CGATGGCGTA

541?TCCGCGCTGG?CCGCAGTTGT?TGCCTATGGC?ATCATGGTTA?AAACCATGGC?CGTGGTTGCG

601?CCACTGGTAC?TGCATTTACC?TGCTGAAGAA?ATCGCCTCTA?AACACCTGGC?GGATACTGGC

661?GTACTCGGAG?GGATTATCTC?CGGTGCGATC?GCAGCGTACA?TGTTTAACCG?TTTCTACCGT

721?ATTAAGCTGC?CTGAGTATCT?TGGCTTCTTT?GCCGGTAAAC?GCTTTGTGCC?GATCATTTCT

781?GGCCTGGCTG?CCATCTTTAC?TGGCGTTGTG?CTGTCCTTCA?TTTGGCCGCC?GATTGGTTCT

841?GCAATCCAGA?CCTTCTCTCA?GTGGGCTGCT?TACCAGAACC?CGGTAGTTGC?GTTTGGCATT

901?TACGGTTTCA?TCGAACGTTG?CCTGGTACCG?TTTGGTCTGC?ACCACATCTG?GAACGTACCT

961?TTCCAGATGC?AGATTGGTGA?ATACACCAAC?GCAGCAGGTC?AGGTTTTCCA?CGGCGACATT

1021CCGCGTTATA?TGGCGGGTGA?CCCGACTGCG?GGTAAACTGT?CTGGTGGCTT?CCTGTTCAAA

1081ATGTACGGTC?TGCCAGCTGC?CGCAATTGCT?ATCTGGCACT?CTGCTAAACC?AGAAAACCGC

1141GCGAAAGTGG?GCGGTATTAT?GATCTCCGCG?GCGCTGACCT?CGTTCCTGAC?CGGTATCACC

1201GAGCCGATCG?AGTTCTCCTT?CATGTTCGTT?GCGCCGATCC?TGTACATCAT?CCACGCGATT

1261CTGGCAGGCC?TGGCATTCCC?AATCTGTATT?CTTCTGGGGA?TGCGTGACGG?TACGTCGTTC

1321TCGCACGGTC?TGATCGACTT?CATCGTTCTG?TCTGGTAACA?GCAGCAAACT?GTGGCTGTTC

1381CCGATCGTCG?GTATCGGTTA?TGCGATTGTT?TACTACACCA?TCTTCCGCGT?GCTGATTAAA

1441GCACTGGATC?TGAAAACGCC?GGGTCGTGAA?GACGCGACTG?AAGATGCAAA?AGCGACAGGT

1501ACCAGCGAAA?TGGCACCGGC?TCTGGTTGCT?GCATTTGGTG?GTAAAGAAAA?CATTACTAAC

1561CTCGACGCAT?GTATTACCCG?TCTGCGCGTC?AGCGTTGCTG?ATGTGTCTAA?AGTGGATCAG

1621GCCGGCCTGA?AGAAACTGGG?CGCAGCGGGC?GTAGTGGTTG?CTGGTTCTGG?TGTTCAGGCG

1681ATTTTCGGTA?CTAAATCCGA?TAACCTGAAA?ACCGAGATGG?ATGAGTACAT?CCGTAACCAC

1741TAATCCGTAA?GACGTTGGGG?AGACTAAGGC?AGCCAGATGG?CTGCCTTTTT?TACAGGTGTT

1801ATTCAGAATT?GATACGTGCC?GGTAATGCTG?AAATTACGCG?GTGTGCCGTA?GACGATAGAA

1861CCTTCCACGT?TGGTATCGTA?GGTTTTGTCG?AACAGGTTAT?TGACGTTCCC?CTGTAACGAG

1921AAGTTTTTCG?TCACCTGGTA?GCGGGTGAAG?AGATCCACCA?GCGCGTAGCT?ACCTTGCTCG

1981GCGCGGAAGG?TGCCATACGG?CGTCACGGTG?TCGGTATACA?CGCGATTTTG?CCAGTTAACA

2041CCACCGCCGA?CCGTCAACTC?TGGCATGACA?G

<210>SEQ?ID?NO：22

<211>29

<212>DNA

＜213〉artificial sequence

ccggaattcg?atcgatattt?acagggagc?29

<210>SEQ?ID?NO：23

<211>25

<212>DNA

＜213〉artificial sequence

ccggaattca?gtgatagttg?acgag?25

<210>SEQ?ID?NO：24

<211>1272

<212>DNA

<213>glk’

1 GATCGATATT?TACAGGGAGC?CTGCCTTTCC?GGCGTTGTTG?TTATGCCCCC?AGGTATTTAC

61 AGTGTGAGAA?AGAATTATTT?TGACTTTAGC?GGAGCAGTTG?AAGAATGACA?AAGTATGCAT

121?TAGTCGGTGA?TGTGGGCGGC?ACCAACGCAC?GTCTTGCTCT?GTGTGATATT?GCCAGTGGTG

181?AAATCTCGCA?GGCTAAGACC?TATTCAGGGC?TTGATTACCC?CAGCCTCGAA?GCGGTCATTC

241?GCGTTTATCT?TGAAGAACAT?AAGGTCGAGG?TGAAAGACGG?CTGTATTGCC?ATCGCTTGCC

301?CAATTACCGG?TGACTGGGTG?GCGATGACCA?ACCATACCTG?GGCGTTCTCA?ATTGCCGAAA

361?TGAAAAAGAA?TCTCGGTTTT?AGCCATCTGG?AAATTATTAA?CGATTTTACC?GCTGTATCGA

421?TGGCGATCCC?GATGCTGAAA?AAAGAGCATC?TGATTCAGTT?TGGTGGCGCA?GAACCGGTCG

481?AAGGTAAGCC?TATTGCGGTT?TACGGTGCCG?GAACGGGGCT?TGGGGTTGCG?CATCTGGTCC

541?ATGTCGATAA?GCGTTGGGTA?AGCTTGCCAG?GCGAAGGCGG?TCACGTTGAT?TTTGCGCCGA

601?ATAGTGAAGA?AGAGGCCATT?ATCCTCGAAA?TATTGCGTGC?GGAAATTGGT?CATGTTTCGG

661?CGGAGCGCGT?GCTTTCTGGC?CCTGGGCTGG?TGAATTTGTA?TCGCGCAATT?GTGAAAGCTG

721?ACAACCGCCT?GCCAGAAAAT?CTCAAGCCAA?AAGATATTAC?CGAACGCGCG?CTGGCTGACA

781?GCTGCACCGA?TTGCCGCCGC?GCATTGTCGC?TGTTTTGCGT?CATTATGGGC?CGTTTTGGCG

841?GCAATCTGGC?GCTCAATCTC?GGGACATTTG?GCGGCGTGTT?TATTGCGGGC?GGTATCGTGC

901?CGCGCTTCCT?TGAGTTCTTC?AAAGCCTCCG?GTTTCCGTGC?CGCATTTGAA?GATAAAGGGC

961?GCTTTAAAGA?ATATGTCCAT?GATATTCCGG?TGTATCTCAT?CGTCCATGAC?AATCCGGGCC

1021TTCTCGGTTC?CGGTGCACAT?TTACGCCAGA?CCTTAGGTCA?CATTCTGTAA?ATCCTTCCTT

1081TTATATCGGG?AGGTAACTCT?CCCGATAATC?TTTTAAATCA?TACAGTTTAT?TCAATTTTTC

1141TTTGTGTCCC?CTCACAAGGT?CGACCTGCGT?CACACTTCCG?TACAGCGGGA?TTAATTCTCC

1201AGTAAATGCA?TTATTTGTCT?GGTAACGGCG?ATTTGTTTTG?CACGTTCATA?ATTTCACTCG

1261TCAACTATCA?CT

<210>SEQ?ID?NO：25

<211>28

<212>DNA

＜213〉artificial sequence

ccggaattca?ggtgagcgaa?atggttga?28

<210>SEQ?ID?NO：26

<211>26

<212>DNA

＜213〉artificial sequence

ccggaattcc?aacagtctta?cagtcc?26

<210>SEQ?ID?NO：27

<211>871

<212>DNA

<213>manZ’

1 AGGTGAGCGA?AATGGTTGAT?ACAACTCAAA?CTACCACCGA?GAAAAAACTC?ACTCAAAGTG

61 ATATTCGTGG?CGTCTTCCTG?CGTTCTAACC?TCTTCCAGGG?TTCATGGAAC?TTCGAACGTA

121?TGCAGGCACT?GGGTTTCTGC?TTCTCTATGG?TACCGGCAAT?TCGTCGCCTC?TACCCTGAGA

181?ACAACGAAGC?TCGTAAACAA?GCTATTCGCC?GTCACCTGGA?GTTCTTTAAC?ACCCAGCCGT

241?TCGTGGCTGC?GCCGATTCTC?GGCGTAACCC?TGGCGCTGGA?AGAACAGCGT?GCTAATGGCG

301?CAGAGATCGA?CGACGGTGCT?ATCAACGGTA?TCAAAGTCGG?TTTGATGGGG?CCACTGGCTG

361?GTGTAGGCGA?CCCGATCTTC?TGGGGAACCG?TACGTCCGGT?ATTTGCAGCA?CTGGGTGCCG

421?GTATCGCGAT?GAGCGGCAGC?CTGTTAGGTC?CGCTGCTGTT?CTTCATCCTG?TTTAACCTGG

481?TGCGTCTGGC?AACCCGTTAC?TACGGCGTAG?CGTATGGTTA?CTCCAAAGGT?ATCGATATCG

541?TTAAAGATAT?GGGTGGTGGC?TTCCTGCAAA?AACTGACGGA?AGGGGCGTCT?ATCCTCGGCC

601?TGTTTGTCAT?GGGGGCATTG?GTTAACAAGT?GGACACATGT?CAACATCCCG?CTGGTTGTCT

661?CTCGCATTAC?TGACCAGACG?GGCAAAGAAC?ACGTTACTAC?TGTCCAGACT?ATTCTGGACC

721?AGTTAATGCC?AGGCCTGGTA?CCACTGCTGC?TGACCTTTGC?TTGTATGTGG?CTACTGCGCA

781?AAAAAGTTAA?CCCGCTGTGG?ATCATCGTTG?GCTTCTTCGT?CATCGGTATC?GCTGGTTACG

841?CTTGCGGCCT?GCTGGGACTG?TAAGACTGTT?G

<210>SEQ?ID?NO：28

<211>37

<212>DNA

＜213〉artificial sequence

ccggaattcc?ctgattatgg?agttcaatat?gcaagcc?37

<210>SEQ?ID?NO：29

<211>37

<212>DNA

＜213〉artificial sequence

ccggaattcg?actgcacagt?tagccgttat?ttgtcga?37

<210>SEQ?ID?NO：30

<211>1614

<212>DNA

<213>xylA’

1 CCTGATTATG?GAGTTCAATA?TGCAAGCCTA?TTTTGACCAG?CTCGATCGCG?TTCGTTATGA

61 AGGCTCAAAA?TCCTCAAACC?CGTTAGCATT?CCGTCACTAC?AATCCCGACG?AACTGGTGTT

121?GGGTAAGCGT?ATGGAAGAGC?ACTTGCGTTT?TGCCGCCTGC?TACTGGCACA?CCTTCTGCTG

181?GAACGGGGCG?GATATGTTTG?GTGTGGGGGC?GTTTAATCGT?CCGTGGCAGC?AGCCTGGTGA

241?GGCACTGGCG?TTGGCGAAGC?GTAAAGCAGA?TGTCGCATTT?GAGTTTTTCC?ACAAGTTACA

301?TGTGCCATTT?TATTGCTTCC?ACGATGTGGA?TGTTTCCCCT?GAGGGCGCGT?CGTTAAAAGA

361?GTACATCAAT?AATTTTGCGC?AAATGGTTGA?TGTCCTGGCA?GGCAAGCAAG?AAGAGAGCGG

421?CGTGAAGCTG?CTGTGGGGAA?CGGCCAACTG?CTTTACAAAC?CCTCGCTACG?GCGCGGGTGC

481?GGCGACGAAC?CCAGATCCTG?AAGTCTTCAG?CTGGGCGGCA?ACGCAAGTTG?TTACAGCGAT

541?GGAAGCAACC?CATAAATTGG?GCGGTGAAAA?CTATGTCCTG?TGGGGCGGTC?GTGAAGGTTA

601?CGAAACGCTG?TTAAATACCG?ACTTGCGTCA?GGAGCGTGAA?CAACTGGGCC?GCTTTATGCA

661?GATGGTGGTT?GAGCATAAAC?ATAAAATCGG?TTTCCAGGGC?ACGTTGCTTA?TCGAACCGAA

721?ACCGCAAGAA?CCGACCAAAC?ATCAATATGA?TTACGATGCC?GCGACGGTCT?ATGGCTTCCT

781?GAAACAGTTT?GGTCTGGAAA?AAGAGATTAA?ACTGAACATT?GAAGCTAACC?ACGCGACGCT

841?GGCAGGTCAC?TCTTTCCATC?ATGAAATAGC?CACCGCCATT?GCGCTTGGCC?TGTTCGGTTC

901?TGTCGACGCC?AACCGTGGCG?ATGCGCAACT?GGGCTGGGAC?ACCGACCAGT?TCCCGAACAG

961?TGTGGAAGAG?AATGCGCTGG?TGATGTATGA?AATTCTCAAA?GCAGGCGGTT?TCACCACCGG

1021TGGTCTGAAC?TTCGATGCCA?AAGTACGTCG?TCAAAGTACT?GATAAATATG?ATCTGTTTTA

1081CGGTCATATC?GGCGCGATGG?ATACGATGGC?ACTGGCGCTG?AAAATTGCAG?CGCGCATGAT

1141TGAAGATGGC?GAGCTGGATA?AACGCATCGC?GCAGCGTTAT?TCCGGCTGGA?ATAGCGAATT

1201GGGCCAGCAA?ATCCTGAAAG?GCCAAATGTC?ACTGGCAGAT?TTAGCCAAAT?ATGCTCAGGA

1261ACATCATTTG?TCTCCGGTGC?ATCAGAGTGG?TCGCCAGGAA?CAACTGGAAA?ATCTGGTAAA

1321CCATTATCTG?TTCGACAAAT?AACGGCTAAC?TGTGCAGTCC?GTTGGCCCGG?TTATCGGTAG

1381CGATACCGGG?CATTTTTTTA?AGGAACGATC?GATATGTATA?TCGGGATAGA?TCTTGGCACC

1441TCGGGCGTAA?AAGTTATTTT?GCTCAACGAG?CAGGGTGAGG?TGGTTGCTGC?GCAAACGGAA

1501AAGCTGACCG?TTTCGCGCCC?GCATCCACTC?TGGTCGGAAC?AAGACCCGGA?ACAGTGGTGG

1561CAGGCAACTG?ATCGCGCAAT?GAAAGCTCTG?GGCGATCAGC?ATTCTCTGCA?GGAC

Claims (10)

1. the production technique that novel fermentation is produced D-lactic acid is characterized in that utilizing recombination bacillus coli metabolism industrial waste glycerine, and fermentation 36～48h produces D-lactic acid.

2. the production technique of D-lactic acid according to claim 1 is characterized in that thalli growth stage bacterial classification utilizes glycerine to grow fast more completely, forms thalline, but does not form various by-product organic acids; Fermentation and acid stage thalline keeps greater activity, utilizes glycerine to synthesize D-lactic acid fast, may form other organic acid of trace.

3. the production technique of D-lactic acid according to claim 1 is characterized in that temperature in the production process, pH, dissolved oxygen, residual glycerol concentration processing parameter can be regulated and control.

4. the production technique of D-lactic acid according to claim 1, it is characterized in that the also available sucrose of this technology, lactose, wood sugar, cellobiose and other several kinds of carbon source are raw material, the synthetic L-lactic acid of fermentation, pyruvic acid, oxysuccinic acid, Succinic Acid, D-L-Ala and other organic acid.

5. the production technique of D-lactic acid according to claim 1 is characterized in that thalline utilizes glycerine to grow fast in the 6～10h at fermentation initial stage, and culture temperature is controlled at 30 ℃～45 ℃, pH keeps 5.0～7.0, fully oxygen supply, oxyty is not less than 30%, and initial glycerol concentration is 3%.

6. the production technique of D-lactic acid according to claim 1 is characterized in that mixing speed is controlled at 500r/min in the fermentation and acid stage, and air flow is 5L/min, and oxyty is not higher than 2%, and the fermentation and acid stage is repeatedly added glycerine to concentration 5% in batches.

7. the production technique of D-lactic acid according to claim 1 is characterized in that the Ca (OH) of whole process using 25% in the fermentative production ₂Regulate pH.

8. the recombination method of the employed bacterial strain of claim 1 is characterized in that this method is mainly used in intestinal bacteria, can be applied to genus bacillus bacterioid, enterobacteriaceae lactobacteriaceae, yeast in addition.

9. the employed reorganization of claim 1 bacterium is characterized in that the optical purity that the reorganization bacterium that makes up produces D-lactic acid reaches more than 99.9%, forms other organic acid or ethanol hardly, and fermentation level reaches 12%～14%.

10. reorganization bacterium according to claim 9, it is characterized in that the tolerance raising 30% of this reorganization bacterium to glycerine, can be D-lactic acid with transformation of glycerol fast, utilizes the performance of glycerine to significantly improve, glycerine is higher than 90% to the transformation efficiency of lactic acid, and metabolic rate improves more than 25%.

Images