CN103667374A - Method for producing D-lactic acid by taking recombined serratia marcescens as bacterium - Google Patents
Method for producing D-lactic acid by taking recombined serratia marcescens as bacterium Download PDFInfo
- Publication number
- CN103667374A CN103667374A CN201210349403.8A CN201210349403A CN103667374A CN 103667374 A CN103667374 A CN 103667374A CN 201210349403 A CN201210349403 A CN 201210349403A CN 103667374 A CN103667374 A CN 103667374A
- Authority
- CN
- China
- Prior art keywords
- serratia marcescens
- restructuring
- acetolactate synthase
- alpha
- synthase gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a method for producing D-lactic acid by taking recombined serratia marcescens as a bacterium. A genetically engineered bacterium which is capable of producing D-lactic acid of high purity is developed by taking serratia marcescens as an initial bacterium for the first time, and the genetically engineered bacterium does not express acetolactic acid synthetase. By adopting the genetically engineered bacterium, D-lactic acid can be efficiently produced, and a product is very low in L-lactic acid. The invention further provides a method for establishing the genetically engineered bacterium, and an optimized method for optimizing D-lactic acid.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of method of restructuring serratia marcescens as bacterial classification production D-ALPHA-Hydroxypropionic acid of take.
Background technology
Lactic acid (Lactic acid, LA), claiming again 2 hydroxy propanoic acid (2-Hydroxy propionic acid), alpha-hydroxypropionic acid, lactic acid, is glucolytic final product under oxygen free condition, by serum lactic dehydrogenase, is acted on pyruvic acid and NADH and is generated.
Lactic acid is one of the world's three large organic acids (other two is acetic acid and pyruvic acid), and its purposes is very extensive.In fields such as food, medicine, makeup, chemical industry, there is utilization.Some derivatives of lactic acid are also used to as lactate and lactic acid salt etc. in the different industry of being everlasting.Optical purity can be regarded as the D-ALPHA-Hydroxypropionic acid of high-optical-purity at more than 97% D-ALPHA-Hydroxypropionic acid, and it is the precursor of a plurality of chiral materials, is an important organic synthesis raw material.In pesticide field, be used to sterilant and the weedicide of synthesizing efficient low toxicity, on medicine and makeup, also with D-ALPHA-Hydroxypropionic acid, synthesize some chiral material, there is good economy and social value.
The suitability for industrialized production history of existing more than 100 year of lactic acid, since German scholar Leichmann in 1886 separation obtains after lactobacillus delbruckii (Ltobacillusdetbruckii), promoted greatly the industrial production of lactic acid by the transformation of chemosynthesis normal direction microbe fermentation method.Lactobacillus delbruckii is the very outstanding milk-acid bacteria of a strain, and it can be converted into lactic acid by attenuate at 50 ℃.In fact the lactic acid kind being obtained by fermentation method is mainly determined by bacterial classification, because of bacterial classification difference, can obtain Pfansteihl, D-ALPHA-Hydroxypropionic acid or raceme lactic acid after fermentation.The morning that the research steps of Pfansteihl starts, what the processing condition of fermentation production of L-lactic acid had been studied at present is fully aware of.Compare with Pfansteihl, D-ALPHA-Hydroxypropionic acid other physico-chemical property except opticity difference does not all have significant difference with Pfansteihl.Therefore, the production of present industrial D-ALPHA-Hydroxypropionic acid is mainly to use for reference the mature technique of Pfansteihl, and its key is to be screening cultivation high purity D-ALPHA-Hydroxypropionic acid production bacterial classification.
Therefore, this area is necessary to cultivate high purity D-ALPHA-Hydroxypropionic acid and produces bacterial classification, to be applied to suitability for industrialized production.
Summary of the invention
The object of the present invention is to provide a kind of method of restructuring serratia marcescens as bacterial classification production D-ALPHA-Hydroxypropionic acid of take.
In a first aspect of the present invention, a kind of method that provides application restructuring serratia marcescens to produce D-ALPHA-Hydroxypropionic acid, comprising:
(1) provide restructuring serratia marcescens, in this bacterial strain, acetolactate synthestase is not expressed (comprising low expression);
(2) cultivate the restructuring serratia marcescens of (1), thereby produce D-ALPHA-Hydroxypropionic acid.
In a preference, in step (1), in the genome of described restructuring serratia marcescens, the acetolactate synthase gene sequence that contains sudden change, it is encoding acetolactate synthase not.
In another preference, described restructuring serratia marcescens is prepared as follows:
(1) provide a target practice plasmid, in described target practice plasmid, contain acetolactate synthase gene 43bp-534 bit sequence;
(2) the target practice plasmid (1) Suo Shu is proceeded in serratia marcescens, by homology, exchange the acetolactate synthase gene inactivation making on serratia marcescens genome;
(3) select to occur the serratia marcescens of homology exchange, obtained restructuring serratia marcescens.
In another preference, described homology switching method is: by α-acetolactate synthase gene total length 1686bp, fragment between this gene 43bp-534bp is cloned on pUTKm, after this plasmid is transferred in serratia marcescens, α-acetolactate synthase gene fragment above can with serratia marcescens genome on the homology of α-acetolactate synthase gene partly exchange, thereby block this gene, can not the activated enzyme of normal expression, thereby serratia marcescens has lost the ability of synthetic 2,3-butanediol.
In another preference, between step (1) and step (2), also comprise step:
The restructuring serratia marcescens of step (1) is tamed to cultivation.
In another preference, described domestication and culture method is as follows: restructuring serratia marcescens is joined in the liquid nutrient medium (being preferably LB substratum) containing 50 ± 10g/L glucose and 50 ± 10g/L Sodium.alpha.-hydroxypropionate, on 6.0 ± 0.5,28 ± 2 ℃ of Initial pHs, 200 ± 50rpm shaking table, cultivate 12 ± 3 hours;
Bacterium liquid through aforementioned cultivation is applied on the solid medium (being preferably LB substratum) containing 50 ± 10g/L glucose and 50 ± 10g/L Sodium.alpha.-hydroxypropionate, at 37 ± 1 ℃, cultivate 24～36 hours (preferably 12～15 hours), select the single bacterium colony that dull and stereotyped upper volume is larger.
In another preference, in step (2), described cultivation restructuring serratia marcescens comprises:
(a) under the condition that is 7.0 ± 0.3 (preferably, 7.0 ± 0.2) in aerobic, 28 ± 2 ℃ of (preferably, 28 ± 1 ℃), pH values, cultivate restructuring serratia marcescens, to cell concentration OD
600value reaches 25-40 (preferably, 28-35);
(b) to add in fermention medium glucose make it final concentration be 100 ± 20g/L (preferably, 100 ± 10g/L), anaerobic, 44 ± 2 ℃ (preferably, 44 ± 1 ℃), pH value is 6.0 ± 0.3 (preferably, 6.0 ± 0.2) under condition, continue to cultivate 36-60 hour (preferably, 42-54 hour).
In another preference, in step (a), at rotating speed 700 ± 200rpm (preferably, 700 ± 100rpm), air flow 200 ± 40vvm (preferably, 200 ± 20vvm) is lower to be cultivated;
In step (b), in the lower cultivation of rotating speed 300 ± 100rpm (preferably, 300 ± 50rpm).
In another preference, in step (a), fermentation culture based component is: glucose 60 ± 10g/L, yeast powder 20 ± 4g/L, NaCl 5 ± 1g/L, KH
2pO
45 ± 1g/L, MgSO
40.5 ± 0.1g/L, MnSO
40.05 ± 0.01g/L.
In another aspect of this invention, provide a kind of restructuring serratia marcescens, in the genome of the restructuring serratia marcescens described in the genome of this bacterial strain, the acetolactate synthase gene sequence that contains sudden change, it is encoding acetolactate synthase not.
In a preference, described restructuring serratia marcescens is prepared as follows:
(1) provide a target practice plasmid, in described target practice plasmid, contain acetolactate synthase gene 43bp-534 bit sequence;
(2) the target practice plasmid (1) Suo Shu is proceeded in serratia marcescens, by homology, exchange the acetolactate synthase gene inactivation making on serratia marcescens genome;
(3) select to occur the serratia marcescens of homology exchange, obtained restructuring serratia marcescens.
Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.
Accompanying drawing explanation
Fig. 1, oxygen are to D-ALPHA-Hydroxypropionic acid output and OD
600the impact of value.
Fig. 2, temperature are to D-ALPHA-Hydroxypropionic acid output and OD
600the impact of value.
Fig. 3, pH value are to D-ALPHA-Hydroxypropionic acid output and OD
600the impact of value.
The vigour of the bacterial strain before Fig. 4, the bacterial strain through taming and domestication.
Embodiment
The present invention is through deep research, take serratia marcescens first as starting strain, develop a kind of genetic engineering bacterium that can production high purity D-ALPHA-Hydroxypropionic acid, the acetolactate synthase gene sequence that contains sudden change in the genome of this genetic engineering bacterium, it is encoding acetolactate synthase not, thereby does not express acetolactate synthestase.Genetic engineering bacterium of the present invention can produce efficiently D-ALPHA-Hydroxypropionic acid, in product, Pfansteihl content is extremely low.The present invention also provides the construction process of this genetic engineering bacterium, and the method for the production D-ALPHA-Hydroxypropionic acid of optimizing.
Term
" serratia marcescens " as used herein, described, claims again Bacterium prodigiosum, belongs to intestinal bacilli section serratia, is Gram-negative facultative Bacteroides nodosus.Serratia marcescens is non-overcritical property microorganism, can utilize several kinds of carbon source, and as chitosan, glucose, sucrose, seminose, cellobiose, citric acid glycerine etc., carbon source spectrum provides favourable condition for its fermentative production so widely.
Unless otherwise indicated, " acetolactate synthestase " described in the present invention refers to " α-acetolactate synthestase ".
Unless otherwise indicated, " genetic engineering bacterium " described in the present invention refers to " restructuring serratia marcescens ".
As used herein, described " homology exchange " refers to the DNA molecular that has homologous region by two, by pairing, chain break be connected, and produces the process of segment exchange (crossing over) again.
As used herein, described " conjugal transfer " is a kind of mode of the transgenosis of bacterium, and when the cell of bacterium is in contact with one another, genetic information is transferred to another cell by a cell.
As used herein, described " not expressing the bacterial strain of acetolactate synthestase " refers to a kind of bacterial strain, it is compared with corresponding wild type strain (not the identical bacterial strain of mutant acetolactate synthase gene), the expression amount of acetolactate synthestase (or enzyme is lived) has reduced more than 90%, more preferably reduced more than 95%, most preferably reduced more than 97%, as reduced by 98%, 99% or 100% (not expressing acetolactate synthestase completely).
Genetic engineering bacterium
The inventor furthers investigate rear discovery, and by by acetolactate synthestase inactivation in serratia marcescens, acetoin capable of blocking and 2,3-butanediol pathways metabolism, make carbon source Main Current to D-ALPHA-Hydroxypropionic acid, thereby can cultivate the bacterial strain of high yield D-ALPHA-Hydroxypropionic acid.
The invention provides a kind of restructuring serratia marcescens of high yield D-ALPHA-Hydroxypropionic acid, described restructuring serratia marcescens is not expressed acetolactate synthestase.More particularly, in the genome of described restructuring serratia marcescens, acetolactate synthase gene inserts inactivation and does not express.
Acetolactate synthestase is a kind of enzyme that acetoin is relevant with 2,3-butanediol pathways metabolism.Acetolactate synthestase GenBank accession number in serratia marcescens is JF519737.The relation that those skilled in the art produce for expression and the D-ALPHA-Hydroxypropionic acid of acetolactate synthestase in serratia marcescens is at present not clear.
It is diversified stoping acetolactate synthestase expression or active method, for example, can suppress its activity by antibody or the part of specific binding acetolactate synthestase; Or utilize small RNA molecular or antisense nucleotide to suppress acetolactate synthestase from transcriptional level and express etc.And the inventor finds, it is most preferred mode that the encoding gene of acetolactate synthestase is suddenlyd change.
The method of suddenling change for the encoding gene of acetolactate synthestase is diversified, as be present in the point mutation on one or more critical sites critical sites or the key structure territory of enzymic activity (performance), or be present in the insertion mutation of one or more positions, or be present in deletion mutantion of one or more positions etc.; In addition, sigma company has released a kind of gene knockout system TargeTron based on two class introns in the recent period
tMgene Knockout System, can be used for carrying out gene knockout.Above-mentioned these modes all can be used for the present invention.As particularly preferred mode of the present invention, the encoding gene of acetolactate synthestase (acetolactate synthase gene) is carried out to insertion mutation.Inventor's discovery, insertion mutation can stop the expression of acetolactate synthase gene the most up hill and dale, makes described genetic engineering bacterium not express acetolactate synthestase.Therefore, the inventor has attempted, after multiple acetolactate synthase gene sudden change mode, preferably adopting the mode of insertion mutation.
It is all available can making the transgenation mode that acetolactate synthase gene is not expressed, for example can be at inner at least one other gene (as acetolactate synthase gene fragment, chloramphenicol resistance gene) that inserts of acetolactate synthase gene, destroy its original coded system, thereby acetolactate synthestase expression amount is declined.As more preferably mode of the present invention, in the genome of described genetic engineering bacterium, the acetolactate synthase gene fragment of 500bp has been inserted in the inside of acetolactate synthase gene sequence.What more preferably, the present invention adopted is the fragment of acetolactate synthase gene 43bp-534bp position.This length had both been suitable for genetic manipulation, and mutation effect is good, and it,, after inserting the inside of acetolactate synthase gene sequence, has fully stoped the expression of acetolactate synthase gene.
The restructuring serratia marcescens strain that the present invention builds is easy to cultivate, and the carbon source that can utilize is extensive, and contamination resistance is strong, and product D-configuration of lactic acid is single, is optical purity, significant for industrial production.
The structure of restructuring serratia marcescens
The present invention also provides a kind of method of preparing described restructuring serratia marcescens, comprise: build in order to insert the target practice plasmid of inactivation acetolactate synthase gene, target practice plasmid is proceeded to acceptor serratia marcescens, there is the genetic engineering bacterium of homology exchange in screening.Preferably, the method comprises: (1) provides a target practice plasmid, in described target practice plasmid, contains acetolactate synthase gene fragment sequence, and it is encoding acetolactate synthase not; (2) the target practice plasmid (1) Suo Shu is proceeded in serratia marcescens, by homology, exchange and make the acetolactate synthase gene sequence of sudden change be incorporated into the genome of serratia marcescens; (3) select to occur the serratia marcescens of homology exchange, obtained restructuring serratia marcescens.
As optimal way of the present invention, for building the plasmid of target practice plasmid, be selected from: pUTKm, pSUP202, pSUP203, pLO1, pPHU281, pSZ21; Preferred, described target practice plasmid is pUTKm.
The method that foreign DNA proceeds to serratia marcescens mainly contains conjugal transfer, conversion or phage transfection, and these modes all can be used for the present invention.The method transforming was just set up by C.S.FORNARI and S.KAPLAN in nineteen eighty-two, the highlyest can reach each survivaling cell 5 * 10
-6transformation efficiency (Fornari CS, Kaplan is of Rhodopseudomonas-Sphaeroides by Plasmid DNA.Journal of Bacteriology 152 (1) S.1982.Genetic-Transformation: 89-97).
Inventor's discovery, the method for conjugal transfer is comparatively effective.Method by conjugal transfer proceeds to target practice plasmid in serratia marcescens.Described plasmid is a kind of suicide plasmid (suicide plasmid), and it has conjugal transfer gene.When building genetically deficient engineering bacteria, need to select suitable suicide plasmid.Copying of suicide plasmid needs a kind of special albumen, and most of bacteriums do not produce this protein, therefore, and when entering host cell, otherwise reproducible not, be eliminated, or be integrated on karyomit(e), copy together with karyomit(e).Utilize this feature of suicide plasmid, the DNA segment of the genetically deficient that genetic engineering technique is built, is cloned into suicide plasmid, utilizes the homology segment at missing gene two ends, the integration site of location suicide plasmid.Utilize homology DNA segment that the principle of restructuring can occur, build accurate genetically deficient bacterial strain.
As optimal way of the present invention, when carrying out conjugal transfer, first target practice plasmid is transformed in the intestinal bacteria with conjugal transfer function, mixed culture is with intestinal bacteria and the serratia marcescens of target practice plasmid, thereby target practice plasmid enters in serratia marcescens by conjugal transfer.Described intestinal bacteria are intestinal bacteria E.coli S17-1 λ pir preferably.
In order to confirm that the genetic engineering bacterium of selected acquisition is the genetic engineering bacterium (being the bacterium that acetolactate synthase gene is inserted into inactivation) that homology exchange has occurred, and also can identify it.The method of identifying includes but not limited to: PCR method, Southern hybridizing method or lactic acid synthetic enzyme enzyme activity determination method.
Produce the method for D-ALPHA-Hydroxypropionic acid
In prior art, conventionally apply serratia marcescens and produce 2,3-butanediol, and D-ALPHA-Hydroxypropionic acid is generally used as a by product in serratia marcescens fermentative production 2,3-butanediol process.And in the present invention, by changing the enzyme in bacterial strain pathways metabolism, realized the high yield of D-ALPHA-Hydroxypropionic acid.
Therefore, the present invention also provides a kind of method of producing D-ALPHA-Hydroxypropionic acid, comprising: (1) provides restructuring serratia marcescens, and in this bacterial strain, acetolactate synthestase is not expressed (comprising low expression); (2) cultivate the restructuring serratia marcescens of (1), thereby produce D-ALPHA-Hydroxypropionic acid.More specifically, method of the present invention utilizes suicide vector that the acetolactate synthase gene on serratia marcescens karyomit(e) is inserted to inactivation, utilizes in this bacterium liquid medium within and ferments, and obtains D-ALPHA-Hydroxypropionic acid.
In order to improve as much as possible the output of D-ALPHA-Hydroxypropionic acid, the method for producing D-ALPHA-Hydroxypropionic acid for application restructuring serratia marcescens of the present invention, the inventor also improves for every fermentation condition.
As optimal way of the present invention, described restructuring serratia marcescens is tamed, making it growth vigor in containing glucose and Lactated substratum significantly increases.Described domestication and culture method is as follows: restructuring serratia marcescens is joined in the liquid nutrient medium (being preferably LB substratum) containing 50 ± 10g/L glucose and 50 ± 10g/L Sodium.alpha.-hydroxypropionate, on 6.0 ± 0.5,28 ± 2 ℃ of Initial pHs, 200 ± 50rpm shaking table, cultivate 12 ± 3 hours; The solid medium (being preferably LB substratum) that bacterium liquid through aforementioned cultivation is applied to containing 50 ± 10g/L glucose and 50 ± 10g/L Sodium.alpha.-hydroxypropionate is upper, cultivates 24～36 hours at 37 ± 1 ℃, selects the single bacterium colony that dull and stereotyped upper volume is larger.Empirical tests, growth vigor and the lactic acid salt tolerance of the thalline obtaining after domestication in dextrose culture-medium all obtained very large lifting.
By experiment of single factor, topmost three have been explored in technological condition for fermentation: oxygen, temperature, the impact of pH value on thalli growth metabolism.Through repeatedly testing relatively, to find: thalline is under aerobic conditions, and temperature is 28 ℃, pH value is that 7.0 o'clock growth phases are to active; Under oxygen free condition, temperature is 44 ℃, and pH value is to be relatively applicable to the productive accumulation of D-ALPHA-Hydroxypropionic acid at 6.0 o'clock.Therefore, the inventor is defined as two-step approach by the regulating strategy of fermentation, i.e. the early stage growth phase of thalline and the productive accumulation stage of later stage D-ALPHA-Hydroxypropionic acid.
As optimal way of the present invention, the culture condition in thalli growth stage is as follows: aerobic, 28 ± 2 ℃ (preferably, 28 ± 1 ℃), pH value is under the condition of 7.0 ± 0.3 (preferably, 7.0 ± 0.2), to cultivate restructuring serratia marcescens, to cell concentration OD
600value reaches 25-40 (preferably, 28-35).As optimal way of the present invention.More preferably, at rotating speed 700 ± 200rpm (preferably, 700 ± 100rpm), air flow 200 ± 40vvm (preferably, 200 ± 20vvm) is lower to be cultivated.
As optimal way of the present invention, the culture condition in the productive accumulation stage of D-ALPHA-Hydroxypropionic acid is as follows: to adding glucose in fermention medium, make it final concentration 100 ± 20g/L (preferably, 100 ± 10g/L), anaerobic, 44 ± 2 ℃ (preferably, 44 ± 1 ℃), pH value is 6.0 ± 0.3 (preferably, 6.0 ± 0.2), under condition, continue to cultivate 36-60 hour (preferably, 42-54 hour).More preferably, in the lower cultivation of rotating speed 300 ± 100rpm (preferably, 300 ± 50rpm).
The optimization of medium component mainly concentrates on the selection of nitrogenous source and carbon source and the initial optimization of each concentration of component of substratum.The optimization experiment scheme of using comprises experiment of single factor, PB experimental design, response surface analysis etc.As the present invention ground optimal way, fermentation culture based component is: glucose 60 ± 10g/L, yeast powder 20 ± 4g/L, NaCl 5 ± 1g/L, KH
2pO
45 ± 1g/L, MgSO
40.5 ± 0.1g/L, MnSO
40.05 ± 0.01g/L.Seed culture medium after optimization and fermention medium have improved the expression amount of D-ALPHA-Hydroxypropionic acid on the basis that reduces original cost.
Major advantage of the present invention is:
(1) use restructuring serratia marcescens fermentation production of D-lactic acid of the present invention, take full advantage of the potentiality of this thalline aspect the environmentally friendly product of fermentative production.Utilize serratia marcescens to also have following characteristics: the strain of restructuring serratia marcescens is easy to cultivate, and the carbon source that can utilize is extensive, and contamination resistance is strong, and product D-configuration of lactic acid is single, is optical purity.
(2) the restructuring serratia marcescens that the present invention builds can be stablized and goes down to posterity and produce D-ALPHA-Hydroxypropionic acid, has the ability of the several kinds of carbon source utilized, and growth rapidly and be not easy to pollute, is very suitable for as industrialization bacterial classification.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, writes molecular cloning experiment guide, Science Press, the condition described in 2002, or the condition of advising according to manufacturer conventionally as J. Pehanorm Brooker etc. according to normal condition.
The structure of embodiment 1, acetolactate synthase gene blocking-up carrier pUTKm-ALS
By the bacterial genomes of Omega company, extract the genomic dna that test kit extracts serratia marcescens MG1 (purchased from Omega).
The serratia marcescens MG1 genomic dna of take is template, the sequence shown in SEQ ID NO:1 and SEQ ID NO:2 of take is PCR primer, the sequence of about 500bp in amplification α-acetolactate synthase gene (being 43-534 position in α-acetolactate synthase gene sequence of GenBank accession number JF519737), is called ALS.
SEQ?ID?NO:1：attggtaccCCGTCAACCCGCAGCCAGAGTA；
SEQ?ID?NO:2：attagtactCCTTCTGTTCGCCGATGCGGAG；
By amplification to α-acetolactate synthase gene partial sequence with restriction enzyme KpnI and ScaI, carry out enzyme and cut, enzyme is cut product and is inserted in the corresponding site of pUTKm carrier (GenBank:AF102233.1), transform intestinal bacteria E.coli S17-1 λ pir, picking recon checking, obtain recombinant plasmid pUTKmALS.
In embodiment 2, serratia marcescens, α-acetolactate synthase gene knocks out
The recombination bacillus coli E.coli S17-1 λ pir and the serratia marcescens MG1 that contain pUTKmALS are carried out to conjugal transfer, make pUTKmALS enter serratia marcescens and its genome carries out homologous recombination, thereby insert inactivating alpha-acetolactate synthase gene, thereby make it can not produce 2,3-butanediol.
Concrete operations are as follows: at 30ml, contain and in the antibiotic LB substratum of kantlex, cultivate donor bacterium E.coli S17-1 λ pir (including pUTKmALS) and recipient bacterium serratia marcescens MG1, incubated overnight; According to 1% inoculum size, above-mentioned donor bacterium and recipient bacterium are transferred in the LB substratum of 50ml and cultivate 2h; Donor bacterium and recipient bacterium mix according to the ratio of volume ratio 3:1, centrifugal and remove supernatant, add the resuspended thalline of fresh LB substratum of 100 μ l; 0.45 μ m filter membrane of sterilizing is laid on the LB flat board of added with antibiotic not, gets 5 μ l suspension bacteria liquid points on filter membrane, be inverted in 37 ℃ and cultivate more than 8 hours; Take out filter membrane, put into the EP pipe shaking culture of the LB liquid nutrient medium that contains 1ml, take out 100 μ l and be coated on the LB solid plate containing 200 μ g/ml kantlex and 100 μ g/ml penbritins, in 37 ℃ of incubators, be inverted and cultivate.What can grow out is the serratia marcescens that homologous recombination occurs.
Afterwards, the serratia marcescens growing is identified.Adopt primer SEQ ID NO:3 and SEQ ID NO:4 amplified fragments, electrophoresis is identified afterwards, and what there was band at 700bp place is mutant strain, and without band is wild mushroom.Through PCR checking, obtain the restructuring serratia marcescens that α-acetolactate synthase gene is inserted into inactivation, this bacterial strain be because can not produce α-acetolactate synthestase, thereby can not generate 2,3-butanediol, then generates a large amount of D-ALPHA-Hydroxypropionic acids.
SEQ?ID?NO:3：AACAGGCAATGACTGGCAATGCG；
SEQ?ID?NO:4：GAAGTAAGTTGGCCGCAGTG。
α-acetolactate synthase gene total length 1686bp, fragment between this gene 43bp-534bp is cloned on pUTKm, after this plasmid is transferred in serratia marcescens, α-acetolactate synthase gene fragment above can with serratia marcescens genome on the homology of α-acetolactate synthase gene partly exchange, thereby block this gene, can not the activated enzyme of normal expression, thus serratia marcescens has lost the ability of synthetic 2,3-butanediol.
For improving the ability of restructuring serratia marcescens bacterial strain tolerance lactic acid, thalline is carried out to acclimation and screening.With LB substratum, for the substratum that sets out, in substratum, add the glucose of 50g/L and the Sodium.alpha.-hydroxypropionate of 50g/L, as screening culture medium screening thalline.By in the bacterial classification access substratum after ordinary method activation, in inoculation forward direction substratum, add kantlex, making its concentration is 100 μ g/mL.Initial pH is 6.0, at 28 ℃, on 200rpm shaking table, cultivates 12h.To make flat board containing the solid screening culture medium of 1.5% (w/w) agar powder again, bacterium liquid is applied to dull and stereotyped upper, cultivate 24～36h at 37 ℃, select the single bacterium colony that dull and stereotyped upper volume is larger to carry out conservation.
Screening through above step obtains comparing through the bacterial strain of domestication and the bacterial strain before domestication.Use fermention medium (glucose 30g/L; Yeast powder 20g/L; KH
2pO
48g/L; NaCl 5g/L; MgSO
40.5g/L; MnSO
40.05g/L), by shake flat experiment, verify contrast.Before inoculating respectively domestication by the inoculum size of 5% (v/v) and the bacterial strain after domestication, under the condition that is 7.0 at aerobic conditions, 28 ℃, pH value, cultivate 12h, mensuration cell concentration OD
600value; And then proceed under the condition that oxygen free condition, 44 ℃, pH value are 6.0 and be cultured to 48h, measure the D-ALPHA-Hydroxypropionic acid content in fermented liquid, result is as Fig. 4.Therefore visible, the growth vigor in containing the substratum of glucose of the bacterial strain after domestication is far superior to the bacterial strain before domestication.This shows to be all improved through growth vigor and the lactic acid salt tolerance of the thalline of domestication.
Condition and the medium optimization of embodiment 5, recombinant bacterium shake flask fermentation D-ALPHA-Hydroxypropionic acid
By experiment of single factor, topmost three have been explored in technological condition for fermentation: oxygen, temperature, the impact of pH value on thalli growth metabolism.
(1) impact of oxygen on thalli growth and lactic acid generation
Utilize initial seed substratum and initial fermention medium in shake flat experiment, to investigate the impact of oxygen on the whole metabolic condition of thalline.By the inoculum size of 5% (v/v), the strain liquid after activation is linked in the 250mL screw-socket triangular flask that the initial fermention medium of 50mL is housed, then at 28 ℃, carries out respectively aerobic cultivation (shaking speed is 200rpm, lower same) and anaerobic cultivation 12h.Measure cell concentration OD600 value, investigate the impact of oxygen on thalli growth.Then under the condition that is applicable to thalli growth, repeat the shake flat experiment of thalli growth just now, after cultivation 12h, under aerobic and oxygen free condition, be cultured to 48h respectively again, investigate the impact of oxygen on lactic acid-producing accumulation.
(2) impact of temperature on thalli growth and lactic acid generation
Utilize initial seed substratum and initial fermention medium in shake flat experiment, to investigate the impact of temperature on the whole metabolic condition of thalline.By the inoculum size of 5% (v/v), the strain liquid after activation is inoculated in the 250mL screw-socket triangular flask that the initial fermention medium of 50mL is housed, the rear aerobic that is placed in respectively at 28 ℃, 37 ℃, 44 ℃ is cultivated 12h, measure cell concentration OD600 value, investigate the impact of temperature on thalli growth.Select after optimum growth temperature, then under optimum growth temperature, repeat the shake flat experiment of thalli growth, after cultivation 12h, be placed in respectively anaerobic at 28 ℃, 37 ℃, 44 ℃, 50 ℃ and be cultured to 48h, investigate the impact of temperature on lactic acid-producing accumulation.
(3) impact of pH value on thalli growth and lactic acid generation
Utilize initial seed substratum and initial fermention medium in shake flat experiment, to investigate the impact of pH value on the whole metabolic condition of thalline.By the inoculum size of 5% (v/v), the strain liquid of activation is inoculated in the 250mL screw-socket triangular flask that the initial fermention medium of 50mL is housed, at 28 ℃, aerobic is cultivated, use NaOH respectively the initial pH value of initial fermention medium to be adjusted to 6.0,7.0,9.3 and cultivate 12h, measure cell concentration OD600 value, investigate the impact of pH value on thalli growth.After selecting the most suitable growth pH value, under the most suitable growth pH value, repeat again the shake flat experiment of thalli growth, cultivate and respectively pH to be controlled to 6.0,7.0,9.3 and be cultured to 48h under oxygen free condition after 12h, investigate the impact that pH value accumulates lactic acid-producing.
(4) result
Result, as Fig. 1-3, finds that thalline is under aerobic conditions, and temperature is 28 ℃, and pH value is that 7.0 o'clock growth phases are to active; Under oxygen free condition, temperature is 44 ℃, and pH value is to be relatively applicable to the productive accumulation of D-ALPHA-Hydroxypropionic acid at 6.0 o'clock.Therefore the regulating strategy of fermentation is defined as to two-step approach, i.e. the early stage growth phase of thalline and the productive accumulation stage of later stage D-ALPHA-Hydroxypropionic acid.
The optimization of medium component mainly concentrates on the selection of nitrogenous source and carbon source and the initial optimization of each concentration of component of substratum.The optimization experiment scheme of using comprises experiment of single factor, PB experimental design, response surface analysis etc.The target of optimizing is mainly to improve cell concentration OD
600these two of the expression amounts of value and lifting D-ALPHA-Hydroxypropionic acid.Seed culture medium after optimization and fermention medium have improved the expression amount of D-ALPHA-Hydroxypropionic acid on the basis that reduces original cost.
Finally determine the optimum growing condition of bacterial classification: pH value 7.0,28 ℃ of temperature, aerobic is cultivated.
Finally determine the optimum condition of fermentation production of D-lactic acid: pH value 6.0,44 ℃ of temperature, anaerobic is cultivated.
Seed culture medium (g/L): glucose 30; Yeast powder 20; KH
2pO
48; NaCl 5; MgSO
40.5; MnSO
40.05.
Fermentation culture based component (g/L): glucose 60, yeast powder 20, NaCl 5, KH
2pO
45, MgSO
40.5, MnSO
40.05.
While doing the fermenting experiment of the restructuring serratia marcescens building above on 3.7L fermentor tank, the liquid amount of fermented liquid is 2L.By 5% inoculum size, inoculation is arrived to fermentation tank culture medium.Under the condition that is 7.0 at aerobic conditions, 28 ℃, pH value, cultivate 9h, because the starting point concentration of thalline is higher, aerobic in the stage fermentor tank rotating speed of agitator be 700rpm, blowing air amount is 200vvm.When fermentation culture is added final concentration to the glucose of 100g/L during to 9h in fermention medium, close gas valve and drain tap, mixing speed is reduced to 300rpm to maintain the even of fermented liquid, and leavening temperature is risen to 44 ℃, pH value is adjusted to 6.0, continues to be cultured to 48h.
After testing, during fermentation culture 9h, cell concentration OD
600value is increased to 33.24, enters the growth phase thalline OD of stationary phase
600value is in 20 left and right.The glucose that adds the 100g/L in fermention medium during 9h to exhausts when fermenting to 48h, and the concentration of D-ALPHA-Hydroxypropionic acid when 48h is 83.5g/L, and because D-ALPHA-Hydroxypropionic acid only produces under oxygen free condition, anaerobic fermentation to rotational rate of lactic acid in the process of 48h is 83.5%.By using Lactic acid Kit to measure, find, in fermented liquid, Pfansteihl content is 0.9g/L, and the optical purity of D-ALPHA-Hydroxypropionic acid is 98.9%.
Fermentation strategies of the present invention has successfully improved the concentration of D-ALPHA-Hydroxypropionic acid, in 48h, the glucose of 100g/L is exhausted simultaneously.
All documents of mentioning in the present invention are all quoted as a reference in this application, just as each piece of document, are quoted as a reference separately.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. apply the method that restructuring serratia marcescens is produced D-ALPHA-Hydroxypropionic acid, it is characterized in that, comprising:
(1) provide restructuring serratia marcescens, in this bacterial strain, acetolactate synthestase is not expressed;
(2) cultivate the restructuring serratia marcescens of (1), thereby produce D-ALPHA-Hydroxypropionic acid.
2. the method for claim 1, is characterized in that, in step (1), and in the genome of described restructuring serratia marcescens, the acetolactate synthase gene sequence that contains sudden change, it is encoding acetolactate synthase not.
3. method as claimed in claim 2, is characterized in that, described restructuring serratia marcescens is prepared as follows:
(1) provide a target practice plasmid, in described target practice plasmid, contain acetolactate synthase gene 43bp-534 bit sequence;
(2) the target practice plasmid (1) Suo Shu is proceeded in serratia marcescens, by homology, exchange the acetolactate synthase gene inactivation making on serratia marcescens genome;
(3) select to occur the serratia marcescens of homology exchange, obtained restructuring serratia marcescens.
4. the method for claim 1, is characterized in that, between step (1) and step (2), also comprises step:
The restructuring serratia marcescens of step (1) is tamed to cultivation.
5. method as claimed in claim 4, it is characterized in that, described domestication and culture method is as follows: restructuring serratia marcescens is joined in the liquid nutrient medium containing 50 ± 10g/L glucose and 50 ± 10g/L Sodium.alpha.-hydroxypropionate, on 6.0 ± 0.5,28 ± 2 ℃ of Initial pHs, 200 ± 50rpm shaking table, cultivate 12 ± 3 hours;
Bacterium liquid through aforementioned cultivation is applied on the solid medium containing 50 ± 10g/L glucose and 50 ± 10g/L Sodium.alpha.-hydroxypropionate, at 37 ± 1 ℃, cultivates 24～36 hours (preferably 12～15 hours), select the single bacterium colony that dull and stereotyped upper volume is larger.
6. the method for claim 1, is characterized in that, in step (2), described cultivation restructuring serratia marcescens comprises:
(a) under the condition that is 7.0 ± 0.3 at aerobic, 28 ± 2 ℃, pH value, cultivate restructuring serratia marcescens, to cell concentration OD
600value reaches 25-40;
(b) to adding glucose in fermention medium, to make it final concentration be 100 ± 20g/L, under the condition that is 6.0 ± 0.3, continues to cultivate 36-60 hour in anaerobic, 44 ± 2 ℃, pH value.
7. method as claimed in claim 6, is characterized in that, in step (a), at rotating speed 700 ± 200rpm, under air flow 200 ± 40vvm, cultivates;
In step (b), under rotating speed 300 ± 100rpm, cultivate.
8. method as claimed in claim 6, is characterized in that, in step (a), fermentation culture based component is: glucose 60 ± 10g/L, yeast powder 20 ± 4g/L, NaCl 5 ± 1g/L, KH
2pO
45 ± 1g/L, MgSO
40.5 ± 0.1g/L, MnSO
40.05 ± 0.01g/L.
Restructuring a serratia marcescens, in the genome of the restructuring serratia marcescens described in the genome of this bacterial strain, the acetolactate synthase gene sequence that contains sudden change, it is encoding acetolactate synthase not.
10. restructuring serratia marcescens as claimed in claim 9, is characterized in that, described restructuring serratia marcescens is prepared as follows:
(1) provide a target practice plasmid, in described target practice plasmid, contain acetolactate synthase gene 43bp-534 bit sequence;
(2) the target practice plasmid (1) Suo Shu is proceeded in serratia marcescens, by homology, exchange the acetolactate synthase gene inactivation making on serratia marcescens genome;
(3) select to occur the serratia marcescens of homology exchange, obtained restructuring serratia marcescens.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210349403.8A CN103667374A (en) | 2012-09-18 | 2012-09-18 | Method for producing D-lactic acid by taking recombined serratia marcescens as bacterium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210349403.8A CN103667374A (en) | 2012-09-18 | 2012-09-18 | Method for producing D-lactic acid by taking recombined serratia marcescens as bacterium |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103667374A true CN103667374A (en) | 2014-03-26 |
Family
ID=50306142
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210349403.8A Pending CN103667374A (en) | 2012-09-18 | 2012-09-18 | Method for producing D-lactic acid by taking recombined serratia marcescens as bacterium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667374A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105820973A (en) * | 2016-03-28 | 2016-08-03 | 蔡剑前 | Serratia marcescens vaccine and preparation method and application thereof |
| CN110904162A (en) * | 2019-12-19 | 2020-03-24 | 河南金丹乳酸科技股份有限公司 | Aeration method for accelerating acid production in lactic acid fermentation |
| CN111484955A (en) * | 2019-01-28 | 2020-08-04 | 智能合成生物中心 | Novel microorganism having minimal genome and method for producing same |
| CN115011536A (en) * | 2022-06-14 | 2022-09-06 | 湖北工业大学 | Engineering bacterium for inducing double anaerobic promoters to produce high-optical-purity D-lactic acid and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942422A (en) * | 2009-07-07 | 2011-01-12 | 华东理工大学 | Genes of D-lactic dehydrogenase from serratia marcescens and research of cloning and expressing recombinant strains and recombinant enzymes |
| WO2012071392A2 (en) * | 2010-11-22 | 2012-05-31 | University Of Florida Research | Engineering of thermotolerant bacillus coagulans for production of d(-)-lactic acid |
| EP2492348A1 (en) * | 2007-03-19 | 2012-08-29 | Sumitomo Chemical Company Limited | Process for producing D-lactic acid from glycerol employing Pseudomonas auricularis, Pseudomonas azotoformans, Pseudomonas chlororaphis, Pseudomonas taetrolens, or Pseuomonas sp. |
-
2012
- 2012-09-18 CN CN201210349403.8A patent/CN103667374A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2492348A1 (en) * | 2007-03-19 | 2012-08-29 | Sumitomo Chemical Company Limited | Process for producing D-lactic acid from glycerol employing Pseudomonas auricularis, Pseudomonas azotoformans, Pseudomonas chlororaphis, Pseudomonas taetrolens, or Pseuomonas sp. |
| CN101942422A (en) * | 2009-07-07 | 2011-01-12 | 华东理工大学 | Genes of D-lactic dehydrogenase from serratia marcescens and research of cloning and expressing recombinant strains and recombinant enzymes |
| WO2012071392A2 (en) * | 2010-11-22 | 2012-05-31 | University Of Florida Research | Engineering of thermotolerant bacillus coagulans for production of d(-)-lactic acid |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105820973A (en) * | 2016-03-28 | 2016-08-03 | 蔡剑前 | Serratia marcescens vaccine and preparation method and application thereof |
| CN105820973B (en) * | 2016-03-28 | 2019-08-13 | 蔡剑前 | A kind of Becterin of Serratia marcescens and the preparation method and application thereof |
| CN111484955A (en) * | 2019-01-28 | 2020-08-04 | 智能合成生物中心 | Novel microorganism having minimal genome and method for producing same |
| CN111484955B (en) * | 2019-01-28 | 2023-12-26 | 韩国科学技术院 | Microorganism having minimal genome and method for producing the same |
| CN110904162A (en) * | 2019-12-19 | 2020-03-24 | 河南金丹乳酸科技股份有限公司 | Aeration method for accelerating acid production in lactic acid fermentation |
| CN110904162B (en) * | 2019-12-19 | 2021-03-23 | 河南金丹乳酸科技股份有限公司 | Aeration method for accelerating acid production in lactic acid fermentation |
| CN115011536A (en) * | 2022-06-14 | 2022-09-06 | 湖北工业大学 | Engineering bacterium for inducing double anaerobic promoters to produce high-optical-purity D-lactic acid and preparation method and application thereof |
| CN115011536B (en) * | 2022-06-14 | 2023-06-23 | 湖北工业大学 | Engineering bacterium for producing high optical purity D-lactic acid by double anaerobic promoters and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cai et al. | Genetic manipulation of butyrate formation pathways in Clostridium butyricum | |
| BRPI0618074A2 (en) | thermophilic organisms for converting lignocellulosic biomass to ethanol | |
| CN102365357A (en) | Method for producting high amount of glycolic acid by fermentation | |
| MX2007013673A (en) | Thermophilic microorganisms with inactivated lactate dehydrogenase gene (ldh) for ethanol production. | |
| CN113073074B (en) | Genetically engineered bacterium for efficiently synthesizing riboflavin and application thereof | |
| WO2022174597A1 (en) | Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof | |
| CN102392056A (en) | Genetically engineered strain and method for producing dihydroxyacetone by using the same | |
| CN103667374A (en) | Method for producing D-lactic acid by taking recombined serratia marcescens as bacterium | |
| CN110229774B (en) | Arginine decarboxylase gene engineering bacterium and high-density fermentation culture method thereof | |
| CN111004815B (en) | Method for improving yield of bacillus subtilis surfactant by mutating degU gene | |
| CN117604044A (en) | Genetically engineered bacterium for producing vanillin, construction method and application thereof | |
| CN102864116B (en) | Gene engineering bacterium for producing succinic acid and construction and application thereof | |
| CN111334459B (en) | Construction method and application of Klebsiella engineering bacteria for improving yield of 1, 3-propylene glycol | |
| CN112280725B (en) | Recombinant escherichia coli for efficiently producing succinic acid and construction method thereof | |
| CN115873773A (en) | Escherichia coli for producing L-lactic acid by efficiently utilizing sucrose and application | |
| CN107446944B (en) | Method for improving carbon source utilization rate and transformation efficiency of erythromycin producing strain so as to improve erythromycin synthesis efficiency | |
| Kasprzycka et al. | Biocatalytic conversion of methane–selected aspects | |
| CN111019875A (en) | Transcription factor SugR coding gene and application thereof in N-acetylglucosamine production | |
| WO2023056700A1 (en) | Genetically engineered bacterial strain producing dl-alanine, construction method therefor and application thereof | |
| WO2023246071A1 (en) | Mrec mutant and use thereof in l-valine fermentative production | |
| CN115125179B (en) | Genetic engineering bacteria for producing rapamycin and application thereof | |
| Wang et al. | Rare earth ion Nd3+ promotes production of cellulose ethanol by Clostridium thermocellum ATCC 27405 | |
| CN101988079A (en) | Method for producing D-lactic acid by fermenting cheap raw material | |
| WO2024124711A1 (en) | Method for constructing l-valine-producing strain, l-valine-producing strain, and use thereof | |
| WO2023056699A1 (en) | Genetically engineered strain capable of producing l-alanine, construction method therefor, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140326 |