CN111334459B

CN111334459B - Construction method and application of Klebsiella engineering bacteria for improving yield of 1, 3-propylene glycol

Info

Publication number: CN111334459B
Application number: CN202010169645.3A
Authority: CN
Inventors: 魏东; 郝健; 史吉平
Original assignee: Shanghai Advanced Research Institute of CAS
Current assignee: Shanghai Advanced Research Institute of CAS
Priority date: 2020-03-12
Filing date: 2020-03-12
Publication date: 2022-11-25
Anticipated expiration: 2040-03-12
Also published as: CN116064352A; CN111334459A

Abstract

The invention belongs to the technical field of environmental microbiology, and particularly relates to a construction method and application of an engineering bacterium for improving the yield of 1, 3-propanediol synthesized by Klebsiella. The invention uses biotechnology to inactivate the activities of enzymes such as Klebsiella diol dehydratase, lactate dehydrogenase, alcohol dehydrogenase and the like. When the constructed engineering bacteria are used for fermenting the 1, 3-propylene glycol, the yield and the conversion rate of the 1, 3-propylene glycol are improved, and the generation amount of by-products, namely lactic acid and ethanol is reduced. The engineering bacteria constructed by the method provided by the invention have stable genetic property, good 1, 3-propylene glycol synthesis performance and reduced byproduct yield, and is a construction method of Klebsiella engineering bacteria with relatively high application value.

Description

Construction method and application of Klebsiella engineering bacteria for increasing yield of 1, 3-propylene glycol

Technical Field

The invention relates to the technical field of environmental microbiology, in particular to a construction method and application of Klebsiella engineering bacteria for improving the yield of 1, 3-propylene glycol.

Background

1, 3-propanediol is an important bulk chemical and has wide application in the industries of cosmetics, food, lubricants, medicines and the like, and is especially used as a monomer to polymerize with terephthalic acid to form polytrimethylene terephthalate (PTT). PTT has good performance, and is widely applied in the clothing industry, the carpet industry and the engineering thermoplastic industry, thereby driving the market demand of 1, 3-propylene glycol.

The technology for synthesizing 1, 3-propanediol by biological method mainly focuses on two directions, wherein one is glucose as a substrate, and the other is glycerol as a substrate. Among the series of microorganisms for synthesizing 1, 3-propanediol by metabolizing glycerol, klebsiella (including Klebsiella pneumoniae and Klebsiella oxytoca) is a facultative anaerobic strain, and has the advantages of simple fermentation operation, high 1, 3-propanediol synthesis amount and conversion rate, and the like, so the Klebsiella is a strain which has the greatest prospect in industrial production of 1, 3-propanediol.

The pathway for synthesizing 1, 3-propanediol by glycerol metabolism of Klebsiella comprises an oxidation branch and a reduction branch. In the oxidation branch, glycerol is catalyzed by glycerol dehydrogenase and dihydroxyacetone kinase to generate dihydroxyacetone phosphate, and then the dihydroxyacetone phosphate enters a glycolysis pathway to generate byproducts such as ethanol, lactic acid, succinic acid, acetic acid, 2, 3-butanediol and the like. The formation of by-products reduces the conversion of the substrate and at the same time is detrimental to the subsequent process of 1, 3-propanediol product extraction. In the reduction branch, glycerol is synthesized into 3-hydroxypropionaldehyde under the action of glycerol dehydratase (DhaB), and then the 1, 3-propanediol is catalyzed by 1, 3-propanediol oxidoreductase to generate 1, 3-propanediol.

Disclosure of Invention

In view of the above disadvantages of the prior art, the present invention aims to provide a Klebsiella engineering bacterium with improved 1, 3-propanediol yield, and a construction method and applications thereof, which are used to solve the problems in the prior art.

In order to achieve the above objects and other related objects, a first aspect of the present invention provides an engineered Klebsiella bacterium in which a gene related to a diol dehydratase is deleted.

Preferably, the diol dehydratase related gene is selected from a diol dehydratase gene and/or a diol dehydratase activator gene.

More preferably, the diol dehydratase gene is selected from one or more of pduC, pduD and pduE; the diol dehydratase activator gene is selected from one or more genes of pduG and pduH.

Preferably, the lactate dehydrogenase gene and/or the ethanol dehydrogenase gene in the Klebsiella engineering bacteria are/is also knocked out.

More preferably, the lactate dehydrogenase gene is the ldhA gene.

More preferably, the alcohol dehydrogenase gene is an adhE gene.

The yield and the conversion rate of 1, 3-propylene glycol are respectively improved by 25.8 percent and 10.3 percent compared with the unmodified Klebsiella by fermenting the Klebsiella engineering bacteria K.p delta pdu delta ldh delta adh for 30 hours; compared with the unmodified Klebsiella, the yield and the conversion rate of 1, 3-propylene glycol after the K.o.DELTA.pdu.DELTA.ldh.adh fermentation for 30 hours are respectively improved by 22.11 percent and 7.97 percent.

The second aspect of the present invention provides a method for constructing klebsiella engineering bacteria, which comprises the following steps: knocking out relevant genes of the diol dehydratase.

Preferably, the diol dehydratase-associated gene knockout is selected from a diol dehydratase gene and/or a diol dehydratase activator gene.

Preferably, the method further comprises knocking out a lactate dehydrogenase gene and/or an alcohol dehydrogenase gene.

The third aspect of the invention provides an application of Klebsiella in the fermentation production of 1, 3-propylene glycol.

The method for producing 1, 3-propylene glycol by using the Klebsiella engineering bacteria comprises the following steps:

1) Inoculating the Klebsiella strain into a seed culture medium for amplification culture;

2) Inoculating the Klebsiella engineering bacteria in the step 1) into a fermentation medium for fermentation.

Further, the fermentation culture medium is a glycerol-containing fermentation culture medium,

further, the initial concentration of glycerol in the fermentation medium is 20-50g/L.

Furthermore, the concentration of the glycerol is controlled to be 10-30g/L in the fermentation process.

Furthermore, the pH value is controlled to be 6.5-7.5 in the fermentation process.

Further, the fermentation temperature is controlled at 30-40 ℃.

Further, stirring is carried out during the fermentation process, and the stirring speed is controlled to be 100-300rpm.

Furthermore, the fermentation tank is aerated during the fermentation process, and the aeration quantity is controlled to be 1-4L/min.

Furthermore, the introduced gas is air.

As mentioned above, the construction method and the application of the Klebsiella engineering bacteria for improving the yield of the 1, 3-propylene glycol have the following beneficial effects: the constructed engineering bacteria have stable genetic property, the yield and the conversion rate of the synthesized 1, 3-propylene glycol are obviously improved, and the generation amount of by-products, namely lactic acid and ethanol is reduced, so that the engineering bacteria have a better application prospect. The construction method of the Klebsiella engineering bacteria provided by the invention has application value.

Drawings

FIG. 1 shows verification of the knockout diol dehydratase encoding gene for primers pdu test-s and pdu test-a in example 1 of the present invention.

FIG. 2 shows the verification of the gene encoding the knocked-out diol dehydratase activator by the primers pduGH test-s and pduGH test-a in example 2 of the present invention.

FIG. 3 shows verification of the knock-out lactate dehydrogenase-encoding gene by primers ldh test-s and ldh test-a in example 3 of the present invention.

FIG. 4 shows verification of knock-out of the alcohol dehydrogenase-encoding gene by the primers adh test-s and adh test-a in example 4 of the present invention.

Detailed Description

The invention provides a Klebsiella engineering bacterium, which is a Klebsiella engineering bacterium with a relevant gene of diol dehydratase knocked out.

The Klebsiella engineering bacteria are Klebsiella engineering bacteria with the relevant gene of the diol dehydratase in wild Klebsiella pneumoniae or wild Klebsiella acidogenic bacteria knocked out.

The wild type klebsiella pneumoniae may be selected from: klebsiella pneumoniae CGMCC 1.6366.

The wild-type klebsiella oxytoca may be selected from: acid producing bacterium Klebsiella M5a1.

Further, the diol dehydratase related gene is selected from a diol dehydratase gene and/or a diol dehydratase activator gene.

Further, the diol dehydratase gene is selected from one or more of pduC, pduD and pduE;

further, the diol dehydratase gene may be knocked out by selecting the following ways:

1) Knocking out pduC;

2) Knocking out pduD;

3) Knocking out pduE;

4) Knocking out pduC and pduD;

5) Knocking out pduC and pduE;

6) Knocking out pduD and pduE;

7) Knocking out pduC, pduD and pduE.

Further, the gene of the diol dehydratase activator is selected from one or more of pduG and pduH;

further, when the diol dehydratase-associated gene is knocked out, the following manner may be selected:

1) Knocking out pduC, pduD, pduE, pduG and pduH;

2) Knocking out pduG and pduH;

3) Knocking out any gene of pduC, pduD and pduE and any gene of pduG and pduH;

4) Knocking out any two genes of pduC, pduD and pduE and any gene of pduG and pduH;

5) Knocking out any two genes of pduC, pduD and pduE and pduG and pduH;

6) Three genes of pduC, pduD and pduE and any gene of pduG and pduH are knocked out.

Further, the diol dehydratase is an enzyme for catalyzing glycerol dehydration to generate 3-hydroxypropionaldehyde, and is jointly coded by three genes, wherein the gene names are respectively as follows: pduC, pduD, pduE.

The gene reading frames of pduC, pduD and pduE can be searched by the existing database (such as NCBI) and can also be obtained by sequencing.

For example, in Klebsiella pneumoniae CGMCC 1.6366, the gene reading frame of pduC is shown as SEQ ID NO.1, the gene reading frame of pduD is shown as SEQ ID NO.2, and the gene reading frame of pduE is shown as SEQ ID NO.3 through sequencing.

Further, the diol dehydratase activating factor is an enzyme for activating the activity of the diol dehydratase, and is jointly coded by two genes, wherein the gene names are respectively as follows: pduG, pduH.

The gene reading frame of pduG and pduH can be searched by the existing database (such as NCBI) and can also be obtained by sequencing.

For example, in Klebsiella pneumoniae CGMCC 1.6366, the gene reading frame of pduG is shown as SEQ ID NO.4 and the gene reading frame of pduH is shown as SEQ ID NO.5 through sequencing.

Furthermore, in the Klebsiella engineering bacteria, the lactate dehydrogenase gene and/or the ethanol dehydrogenase gene are/is also knocked out. After the lactate dehydrogenase gene and/or the ethanol dehydrogenase gene are further knocked out, the yield of the 1, 3-propanediol of the Klebsiella engineering bacteria is further improved.

Further, the lactate dehydrogenase is an enzyme that catalyzes the reduction of pyruvate to lactate, and its gene name ldhA.

The gene reading frame of ldhA can be queried by existing databases (such as NCBI) and can also be obtained by sequencing.

For example, the sequencing proves that the gene reading frame of the lactate dehydrogenase gene in Klebsiella pneumoniae CGMCC 1.6366 is shown as SEQ ID NO. 6.

Further, the alcohol dehydrogenase is an enzyme catalyzing acetaldehyde to produce alcohol, and its gene name is adhE.

The gene reading frame of the adhE can be queried through an existing database (such as NCBI) and can also be obtained through sequencing.

For example, the sequencing shows that the gene reading frame of the alcohol dehydrogenase gene in Klebsiella pneumoniae CGMCC 1.6366 is shown as SEQ ID NO. 7.

The yield and the conversion rate of 1, 3-propylene glycol are respectively improved by at least 13.825.8 percent and 5.3710.3 percent compared with the original Klebsiella without modification by the Klebsiella engineering bacteria K.p delta pdu delta ldh delta adh fermentation for 30 hours. (ii) a The yield and the conversion rate of 1, 3-propylene glycol are respectively improved by 22.11 percent and 7.97 percent compared with the unmodified Klebsiella by fermenting the Klebsiella engineering bacteria K.o delta pdu delta ldh delta adh for 30 hours;

the yield and the conversion rate of the Klebsiella engineering bacteria 1, 3-propylene glycol are detected according to the following methods:

1) The constructed Klebsiella strain and the initial strain are respectively inoculated into a 250mL Erlenmeyer flask filled with 50mL of seed culture medium, the inoculation amount is 1 percent of the volume of the seed culture medium, and the Klebsiella strain and the initial strain are cultured on a shaker at 37 ℃ and 200rpm for 12 hours.

2) Inoculating 50mL of the Klebsiella engineering bacteria obtained in the step 1) into a fermentation tank containing 3L of fermentation medium, continuously fermenting at 37 ℃ with air flow of 2L/min and rotation speed of 200rpm to synthesize 1, 3-propanediol, and adjusting pH to 6.8 with 30% NaOH solution during fermentation.

3) Collecting a certain amount of fermentation liquid at intervals during fermentation, and performing high performance liquid chromatography (using Aminex HPX-87H chromatographic column from Bio-Rad, RID-20A type differential detector from Shimadzu corporation, japan, and H-005 mol/L mobile phase ₂ SO ₄ Flow rate of 0.8mL/min, column oven temperature of 65 ℃, sample injection volume of 20 mu L generally) to determine the consumption of substrate glycerol in the fermentation broth, and feeding glycerol aqueous solution with concentration of 75% (g/g) when the glycerol in the fermentation tank is completely consumed. After 30h of fermentation, the consumption of the substrate glycerol and the production of the product 1, 3-propanediol are detected by high performance liquid chromatography.

4) The conversion rate was calculated according to the formula (1), and the conversion rate and the improvement rate of the production of 1, 3-propanediol were calculated according to the formula (2).

Conversion (%) =30h concentration of 1, 3-propanediol in fermentation broth (g/L) × volume of fermentation broth (L)/[ concentration of fermentation medium starting glycerol (g/L) × volume of medium (L) + concentration of feed (g/L) × volume of feed consumed (L) — concentration of residual glycerol in fermentation broth of 30h (g/L) × volume of fermentation broth (L) ]

100％①

The improvement rate (%) = [ c (engineering) -c (original) ]/c (original) × 100% (2)

Wherein c (engineering) refers to the conversion or concentration (g/L) of 1, 3-propanediol produced by Klebsiella engineering bacteria, and c (original) refers to the conversion or concentration of 1, 3-propanediol produced by the original Klebsiella, i.e., the non-engineered strain.

Further, the method further comprises knocking out a lactate dehydrogenase gene and/or an alcohol dehydrogenase gene.

Still further, the method further comprises one or more of:

1) The diol dehydratase gene is selected from one or more genes of pduC, pduD and pduE;

2) The diol dehydratase activating factor gene is selected from one or more genes of pduG and pduH;

3) The lactate dehydrogenase gene is an ldhA gene;

4) The lactate dehydrogenase gene is an adhE gene;

5) Knocking out genes by adopting a homologous recombination method;

the third aspect of the invention provides an application of Klebsiella engineering bacteria in the fermentation production of 1, 3-propanediol.

1) Inoculating the Klebsiella engineering bacteria into a seed culture medium for culture.

2) Inoculating the Klebsiella engineering bacteria of the step 1) into a fermentation culture medium for culture.

Further, in the step 1), the Klebsiella engineering bacteria are inoculated according to 0.5% -2% of the volume of the seed culture medium.

Further, in the step 1), the culture condition of the Klebsiella engineering bacteria is 30-40 ℃ and the culture is carried out for 10-20h at 100-300rpm.

Further, the seed culture medium comprises the following components: 10g/L of peptone, 5g/L of yeast extract and 5g/L of sodium chloride.

Further, inoculating all the Klebsiella engineering bacteria in the step 1) into a fermentation tank containing a fermentation medium for culturing.

Further, the amount of fermentation medium is 50% to 80% of the fermenter capacity.

Further, the fermentation medium is a glycerol-containing fermentation medium. The components of the fermentation medium are 0.69g/L of dipotassium hydrogen phosphate, 0.25g/L of monopotassium phosphate, 1.5g/L of yeast powder, 4.0g/L of ammonium sulfate and 0.2g/L of magnesium sulfate.

Further, the fermentation temperature is controlled at 30-40 ℃.

Furthermore, the introduced gas is air.

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any number between the two endpoints are optional unless otherwise specified in the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Example 1: construction of Klebsiella engineering bacteria inactivated by diol dehydratase

The operation principle of the gene coding for the partial knockout of the diol dehydratase and the plasmid, strain and other materials used are described in (Wei et al. Red recombinant enzyme induced gene replacement in Klebsiella pneumoniae Journal of Industrial Microbiology & Biotechnology 2012), and the specific steps are as follows:

1) Construction of homologous recombination fragments for knocking out diol dehydratase encoding genes

According to the gene sequence of Klebsiella pneumoniae CGMCC 1.6366 coding diol dehydratase, the upstream and downstream primers are designed as follows:

an upstream primer pdu-s1: CAACGTGGAAGTCGTGGCGTATAGCT (SEQ ID NO. 8)

The downstream primer is pdu-a1: GCGTTGAGGGTGGAATACGGTGGC (SEQ ID NO. 9)

By using designed primers of pdu-s1 and pdu-a1 and using genome DNA of Klebsiella pneumoniae CGMCC 1.6366 as a template, a partial gene (containing pduC, pduD and pduE) for coding diol dehydratase is obtained by PCR amplification, and is connected to a pMD-19T simple plasmid (commercial product, takara Bio-engineering Co., ltd.) by a TA cloning method, and the obtained recombinant plasmid is named pMD19T-pdu and is sequenced and verified by Shanghai Biotech limited.

The successfully constructed plasmid pMD19T-pdu was transformed into strain DH 5. Alpha. -pIJ790 (obtained from NTCC type culture Collection) to obtain a two-plasmid carrying strain DH 5. Alpha. -pIJ790-pMD19T-pdu.

Based on the gene sequence of plasmid pIJ778 (obtained from the NTCC type culture Collection) carrying the streptomycin resistance gene cassette, the upstream and downstream primers were designed:

the upstream primer is pdu-FRT-s1:

CAGGCGCACGTCACCAACGTCAAAGATAACCCGGTACAGATTCCGGGGATCCGTCGACC(SEQ ID NO.10)

the downstream primer is pdu-FRT-a1:

AATCGTCGCCTTTGAGTTTTTTACGCTCGACGTACAGCGTTGTAGGCTGGAGCTGCTTC(SEQ ID NO.11)

PCR amplification is carried out by using designed primers pdu-FRT-s1 and pdu-FRT-a1 and plasmid pIJ778 as a template to obtain a fragment of the streptomycin resistance gene cassette.

Competent cells of the strain DH 5. Alpha. -pIJ790-pMD19T-pdu were prepared, then the competent cells of DH 5. Alpha. -pIJ790-pMD19T-pdu were transformed with a fragment of the streptomycin resistance gene cassette obtained by PCR and recovered by cleaning, recovered at 37 ℃ for 1 hour, and then centrifuged to coat a streptomycin resistant plate (streptomycin used concentration 50 mg/L) to select a positive strain carrying pMD 19T-. Delta.pdu 778. After growth of colonies on the plate, it was verified by using primers pdu-s1 and test778 (test 778: AGAATCTCGCTCTCTCCAGGGGAAG) (SEQ ID NO. 12). If no recombination occurs, no gene fragment is amplified. If the recombination is successful, a gene fragment of about 1.0kb is amplified. The strain successfully recombined by PCR verification is inoculated in a streptomycin resistant LB test tube culture medium to be cultured, and a plasmid is extracted and named as pMD 19T-delta pdu778.

The constructed pMD 19T-delta pdu778 is used as a template, and the homologous recombination fragment of the knocked-out pdu gene is amplified by using primers pdu-s1 and pdu-a1 under the action of a high fidelity enzyme KOD, so that the obtained fragment is abbreviated as 'A'. The size of the fragment A is 2700bp, both ends carry homologous arms of about 500bp respectively, and the middle is a streptomycin resistance gene.

2) Homologous recombination knockout coding gene of Klebsiella diol dehydratase

A. Coding gene for knocking out Klebsiella pneumoniae diol dehydratase

Klebsiella pneumoniae CGMCC 1.6366 strain (this strain is also called TUAC01, AC 01), CGMCC 1.6366 strain has been disclosed in literature (Journal of Industrial Microbiology & Biotechnology.2012 39. The strain is used for producing 1, 3-propylene glycol. The strain was isolated from soil, and the isolation process and properties were described (World Journal of Microbiology Biotechnology 2008, 24.

Competent cells of Klebsiella pneumoniae CGMCC 1.6366 were prepared and the plasmid pDK6-red was transformed (see Wei Dong, wang Min, shi Jiping, hao Jian. Red restriction enzyme associated gene replacement in Klebsiella pneumoniae. Journal of Industrial Microbiology & Biotechnology.201239:1219-1226 for the procedure of plasmid construction) to obtain the strain K.p/red.

And (3) preparing an electrotransformation competent cell of the strain K.p/Red, adding IPTG (isopropyl-beta-D-thiogalactoside) to induce the expression of Red recombinase when culturing competence, and adding EDTA (ethylene diamine tetraacetic acid) to improve the electric shock transformation efficiency of the Klebsiella. K.p/red competent cells were transformed with the homologous recombination fragment "A" by electric shock and, after recovery, all plated on streptomycin resistant plates and cultured overnight at 37 ℃. After single colonies grew on the plate, primers pdu test-s and pdu test-a were used to verify [ pdu test-s: CGGCGATGTTTACGGCAAATGAAG (SEQ ID NO. 13), pdu test-a: CTGGGCCAGCAGCTCAAGGTTAC) (SEQ ID No. 14) ]. If the recombination is successful, a band of 3.0kb can be amplified, and if the recombination is not successful, the size of the amplified fragment is 4.0kb, and the PCR verification result is shown in FIG. 1. Verifying that the correct PCR product is sequenced by Shanghai Biotechnology Limited, and further determining whether the coding gene of the diol dehydratase is successfully knocked out. The sequencing result verifies that the correct strain is subcultured to eliminate the plasmid pDK6-red, and the finally obtained engineering bacterium is recorded as K.p delta pdu778.

B. Knock out coding gene of Klebsiella oxytoca diol dehydratase

The acid producing bacterium klebsiella pneumoniae M5a1 is a widely used acid producing bacterium klebsiella pneumoniae and is considered to be klebsiella pneumoniae for a long time, so that some documents are also called the klebsiella pneumoniae M5a1.

Competent cells of acidogenic bacterium klebsiella pneumoniae M5a1 were prepared, and the plasmid pDK6-red was transformed to obtain a strain K.o/red.

And (3) preparing an electrotransformation competent cell of the strain K.o/Red, adding IPTG (isopropyl-beta-thiogalactoside) to induce the expression of Red recombinase when culturing competence, and adding EDTA (ethylene diamine tetraacetic acid) to improve the electric shock transformation efficiency of the Klebsiella. K.o/red competent cells were transformed with the homologous recombination fragment "A" by electric shock, and after recovery, all were plated on streptomycin-resistant plates and cultured overnight at 37 ℃. After single colonies grow on the plate, the primers pdu test-s and pdu test-a are used to verify that a band of 3.0kb is amplified if the recombination is successful, and a fragment of 4.0kb is amplified if the recombination is not successful. The PCR product with correct PCR verification is sequenced by Shanghai Biotechnology Limited to further determine whether the coding gene of the diol dehydratase is knocked out successfully. The sequencing result verifies that the correct strain is subcultured to eliminate the plasmid pDK6-red, and the finally obtained engineering bacterium is marked as K.o delta. Pdu778.

3) Elimination of resistance marker genes

A. Eliminating resistance gene carried by engineering bacteria K.p delta pdu778

Competent cells of the engineered Klebsiella pneumoniae K.p.DELTA.pdu 778 were prepared and the plasmid pDK6-flp was transformed (see Wei Dong, wang Min, shi Jiping, hao Jian. Red recombined expressed gene replacement in Klebsiella pneumoniae. Journal of Industrial Microbiology & Biotechnology.201239:1219-1226 for the plasmid construction process) to obtain the strain K.p.DELTA.pdu 778/flp.

K.p.DELTA.pdu 778/FLP was subcultured and IPTG was added to induce plasmid pDK6-FLP to express FLP recombinase to eliminate the resistance marker. After subculture, diluting and spreading on an LB plate without resistance, selecting certain colony marker serial numbers and sequentially inoculating on a streptomycin resistant plate. Single colonies that did not grow on streptomycin resistant plates were further verified with primers, pdu test-s and pdu test-a. If the elimination of the carried resistance gene fragment is successful, the amplified size is 1.1kb, and if not eliminated, the amplified size is 3.0kb. The PCR product of 1.1kb in size was verified by sequencing by Shanghai Biotech, inc. And (4) carrying out subculture on the strains with correct sequencing verification to eliminate the plasmid pDK6-flp, and finally obtaining the engineering strain K.p delta pdu.

B. Eliminating resistance gene carried by engineering bacteria K.o delta pdu778

Competent cells of the acid-producing bacterium Klebsiella oxytoca K.o.DELTA.pdu 778 were prepared, and the plasmid pDK6-flp was transformed to obtain the strain K.o.DELTA.pdu 778/flp.

K.o.DELTA.pdu 778/FLP was subcultured and IPTG was added to induce plasmid pDK6-FLP to express FLP recombinase to eliminate the resistance marker. After subculture, diluting and spreading on an anti-LB plate, selecting a certain colony marker serial number and sequentially inoculating on a streptomycin resistant plate. Single colonies that did not grow on streptomycin resistant plates were further verified with primers, pdu test-s and pdu test-a. If the elimination of the carried resistance gene fragment was successful, the amplified size was 1.1kb, and if not eliminated, the amplified size was 3.0kb. The PCR product of 1.1kb in size was verified by sequencing by Shanghai Biotech, inc. And (4) carrying out subculture on the bacteria with correct sequencing verification to eliminate the plasmid pDK6-flp, and finally obtaining the engineering bacteria K.o delta pdu.

Example 2: construction of Klebsiella engineering bacteria with inactivated diol dehydratase activating factor

The technical scheme of knocking out the gene coding the diol dehydratase activating factor in the part is consistent with the method for knocking out the diol dehydratase in the embodiment 1, and the specific steps are as follows:

1) Construction of homologous recombination fragment for knocking out diol dehydratase activating factor coding gene

According to the gene sequence of the Klebsiella pneumoniae CGMCC 1.6366 coding diol dehydratase activating factor, the upstream and downstream primers are designed as follows:

an upstream primer pduGH-s1: GCTGCCGATTGTTGACGAAGTGC (SEQ ID NO. 15)

The downstream primer pduGH-a1: CAGGATTTCACTTCGCTCTACGAC (SEQ ID NO. 16)

By using designed primers pduGH-s1 and pduGH-a1 and using genome DNA of Klebsiella pneumoniae CGMCC 1.6366 as a template, a part of genes (containing pduG and pduH) for coding the diol dehydratase activating factor is obtained by PCR amplification and is connected to a pMD-19T simple plasmid by a TA cloning method, and the obtained recombinant plasmid is named as pMD19T-pduGH and is sequenced and verified by Shanghai Biotech company Limited.

The successfully constructed plasmid pMD19T-pduGH is transformed into a strain DH5 alpha-pIJ 790 to obtain a strain DH5 alpha-pIJ 790-pMD19T-pduGH carrying double plasmids.

Based on the gene sequence of plasmid pIJ773 (NTCC type culture Collection) carrying the apramycin resistance gene cassette, upstream and downstream primers were designed:

an upstream primer pduGH-FRT-s1:

GGACCTGCTGGCCGTCGATACCTCGGTGCCGGTGAGCGGATTCCGGGGATCCGTCGACC(SEQ ID NO.17)

the downstream primer pduGH-FRT-a1:

GGAGCAGGAAAGGAATGCCTTCCTCTTCGATACCCAGCTGTAGGCTGGAGCTGCTTC(SEQ ID NO.18)

the designed primers pduGH-FRT-s1 and pduGH-FRT-a1 are used, and the plasmid pIJ773 is used as a template to obtain a fragment of the apramycin resistance gene cassette through PCR amplification.

Competent cells of the strain DH5 alpha-pIJ 790-pMD19T-pduGH were prepared, then the competent cells of DH5 alpha-pIJ 790-pMD19T-pduGH were electrically transformed with the fragment of the apramycin resistance gene cassette obtained by PCR and recovered by cleaning, recovered at 37 ℃ for 1 hour, and then centrifuged and spread on an apramycin resistance plate (the apramycin concentration used was 50 mg/L), and a positive strain carrying pMD 19T-delta pduGH773 was selected. After growth on the plate, the plate was verified by using primers pduGH-s1 and test773 (test 773: GCAAATACGGCATCAGTTACC) (SEQ ID NO. 19). If no recombination occurs, no gene fragment is amplified. If the recombination is successful, a gene fragment of about 1.0kb is amplified. The strain successfully recombined through PCR verification is inoculated in an LB test tube culture medium with apramycin resistance to be cultured, and a plasmid is extracted and named as pMD 19T-delta pduGH778.

The constructed pMD 19T-delta pduGH773 is taken as a template, primers pduGH-s1 and pduGH-a1 are used for amplifying and knocking out a homologous recombination fragment of pduGH gene under the action of high fidelity enzyme KOD, and the obtained fragment is abbreviated as 'B'. The size of the fragment B is 2700bp, both ends carry homologous arms of about 500bp respectively, and the middle part is an apramycin resistance gene.

2) Homologous recombination knockout coding gene of Klebsiella diol dehydratase activator

A. Coding gene for knocking out Klebsiella pneumoniae diol dehydratase activator out

Competent cells of Klebsiella pneumoniae CGMCC 1.6366 are prepared, and the plasmid pDK6-red is transformed to obtain a strain K.p/red.

And (3) preparing an electrotransformation competent cell of the strain K.p/Red, adding IPTG (isopropyl-beta-D-thiogalactoside) to induce the expression of Red recombinase when culturing competence, and adding EDTA (ethylene diamine tetraacetic acid) to improve the electric shock transformation efficiency of the Klebsiella. K.p/red competent cells were transformed with homologous recombination fragment "B" by electric shock, and after recovery, all were plated on apramycin-resistant plates and cultured overnight at 37 ℃. After the single colony grows on the plate, the primers pduGH test-s and pduGH test-a are used for verifying [ pduGH test-s: TGCGTAACGTGTTCGGTATTCA (SEQ ID NO. 20), pduGH test-a: GCGGTGCTCCTTATTCGCCATCA) (SEQ ID NO. 21) ]. If the recombination is successful, a band with the size of 3.0kb can be amplified, if the recombination is not successful, the size of the amplified fragment is 2.5kb, and the PCR verification result is shown in FIG. 2. And (3) verifying that the correct PCR product is sequenced by Shanghai Biotechnology Co., ltd, and further determining whether the coding gene of the diol dehydratase activating factor is successfully knocked out. The sequencing result verifies that the correct strain is subcultured to eliminate the plasmid pDK6-red, and the finally obtained engineering bacterium is recorded as K.p delta pduGH773.

B. Coding gene for knocking out Klebsiella oxytoca diol dehydratase activating factor

Competent cells of acidogenic bacillus klebsiella M5a1 were prepared, and the plasmid pDK6-red was transformed to obtain the strain k.o/red.

And (3) preparing an electrotransformation competent cell of the strain K.o/Red, adding IPTG (isopropyl-beta-thiogalactoside) to induce the expression of Red recombinase when culturing competence, and adding EDTA (ethylene diamine tetraacetic acid) to improve the electric shock transformation efficiency of the Klebsiella. The homologous recombination fragment "B" was used to transform K.o/red competent cells by electric shock, and after recovery, all were plated on apramycin-resistant plates and cultured overnight at 37 ℃. After the single colony grows on the plate, the primers pduGH test-s and pduGH test-a are used for verification, if the recombination is successful, a band with the size of 3.0kb can be amplified, and if the recombination is not successful, the size of the amplified fragment is 2.5kb. The PCR product with correct PCR verification is sequenced by Shanghai Biotechnology Limited company, and whether the coding gene of the diol dehydratase activating factor is successfully knocked out is further determined. The sequencing result verifies that the correct strain is subcultured to eliminate the plasmid pDK6-red, and the finally obtained engineering bacterium is recorded as K.o. delta. PduGH773.

3) Elimination of resistance marker genes

A. Eliminating resistance gene carried by engineering bacteria K.p delta pduGH773

Competent cells of Klebsiella pneumoniae engineering strain K.p.DELTA.pduGH 773 were prepared, and the plasmid pDK6-flp was transformed to obtain a strain K.p.DELTA.pduGH 773/flp.

K.p.DELTA.pduGH 773/FLP was subcultured, and IPTG was added to induce plasmid pDK6-FLP to express FLP recombinase to eliminate the resistance marker. After subculture, diluting and spreading on an LB plate without resistance, selecting a certain colony marker number and sequentially inoculating on an apramycin resistance plate. Single colonies that did not grow on apramycin resistant plates were further verified with primers pduGH test-s and pduGH test-a. If the elimination of the carried resistance gene fragment is successful, the amplified size is 1.1kb, and if not eliminated, the amplified size is 3.0kb. The PCR product of 1.1kb in size was verified by sequencing by Shanghai Biotech, inc. And (4) carrying out subculture on the bacteria with correct sequencing verification to eliminate the plasmid pDK6-flp, and finally obtaining the engineering bacteria K.p delta pduGH.

B. Eliminating resistance gene carried by engineering bacteria K.o delta pduGH773

Competent cells of the acid-producing bacterium Klebsiella oxytoca K.o.DELTA.pduGH 773 were prepared, and the plasmid pDK6-flp was transformed to obtain the strain K.o.DELTA.pduGH 773/flp.

Subculturing K.o.DELTA.pduGH 773/FLP, and adding IPTG to induce plasmid pDK6-FLP to express FLP recombinase to eliminate the resistance marker. After subculture, diluting and spreading on an anti-LB plate, selecting a certain colony marker serial number and sequentially inoculating on a streptomycin resistant plate. Single colonies that did not grow on apramycin resistant plates were further verified with primers pduGH test-s and pduGH test-a. If the elimination of the carried resistance gene fragment was successful, the amplified size was 1.1kb, and if not eliminated, the amplified size was 3.0kb. The PCR product of 1.1kb in size was verified by sequencing by Shanghai Biotech, inc. And (4) carrying out subculture on the bacteria with correct sequencing verification to eliminate the plasmid pDK6-flp, and finally obtaining the engineering bacteria K.o delta pduGH.

Example 3: construction of lactate dehydrogenase inactivated Klebsiella engineering bacteria

The technical scheme of knocking out the lactate dehydrogenase is consistent with the method for knocking out the diol dehydratase in the embodiment 1, and the specific steps are as follows:

1) Construction of homologous recombination fragment for knocking out lactate dehydrogenase encoding gene

Designing upstream and downstream primers according to the gene sequence of Klebsiella pneumoniae CGMCC 1.6366 coding lactate dehydrogenase

An upstream primer ldh-s1: AGAGCGCACACAGGACCACTATCCA (SEQ ID NO. 22)

The downstream primer ldh-a1: TCGGCGAGCTTATAGACCAGCGT (SEQ ID NO. 23)

The gene for coding lactate dehydrogenase is obtained by PCR amplification by using designed primers ldh-s1 and ldh-a1 and Klebsiella pneumoniae CGMCC 1.6366 genome DNA as a template, and is connected to a pMD-19T simple plasmid by a TA cloning method, and the obtained recombinant plasmid is named pMD19T-ldh and is sequenced and verified by Shanghai Biotech Limited.

Successfully constructed plasmid pMD19T-ldh is transformed into a strain DH5 alpha-pIJ 790 to obtain a strain DH5 alpha-pIJ 790-pMD19T-ldh carrying double plasmids.

Designing an upstream primer ldh-FRT-s1 of an upstream primer and a downstream primer according to a gene sequence of a plasmid pIJ773 carrying an apramycin resistance gene box:

CCAGCTGCCTAGGGGCCTTACTACGTATGGCGAAGCGTTGGCACCCGCCAAAACCGCCA(SEQ ID NO.24)

the downstream primer ldh-FRT-a1:

CTTCGTCGAGGTCGGATGTCAAGTGGCCGGTAGTCCGCAAGGAGTGGCGGCTCCGCGAC(SEQ ID NO.25)

the designed primers ldh-FRT-s1 and ldh-FRT-a1 are used, and the plasmid pIJ773 is used as a template to obtain the fragment of the apramycin resistance gene box through PCR amplification.

Preparing competent cells of a strain DH5 alpha-pIJ 790-pMD19T-ldh, then electrically transforming the DH5 alpha-pIJ 790-pMD19T-ldh competent cells by using a fragment of an apramycin resistance gene cassette obtained by PCR and recovered by cleaning, recovering the competent cells at 37 ℃ for 1h, centrifugally coating the competent cells on an apramycin resistance plate, and screening a positive strain carrying the pMD 19T-delta ldh773. After growth of colonies on the plate, the plate was verified by using the primers ldh-s1 and test 773. If no recombination occurs, no gene fragment is amplified. If the recombination is successful, a gene fragment of about 1.3kb is amplified. The strains which are successfully recombined through PCR verification are inoculated in an LB test tube culture medium with apramycin resistance for culture, plasmids are extracted, and the plasmids are named as pMD 19T-delta ldh773.

The constructed plasmid pMD 19T-delta ldh773 is used as a template, and a homologous recombination fragment of the ldh gene is amplified and knocked out by using primers ldh-s1 and ldh-a1 under the action of high fidelity enzyme KOD, so that the obtained fragment is abbreviated as 'C'. The size of the fragment of 'C' is 2810bp, both ends respectively carry homologous arms of about 800bp and 700bp, and the middle part is an apramycin resistance gene.

2) Homologous recombination knockout coding gene of Klebsiella engineering bacterium lactate dehydrogenase

A. Knock-out coding gene of K.p delta pdu lactate dehydrogenase

Competent cells of K.p.DELTA.pdu were prepared, and the plasmid pDK6-red was transformed to obtain the strain K.p.DELTA.pdu/red.

Preparing an electric transformation competent cell of the strain K.p delta pdu/Red, adding IPTG to induce the expression of Red recombinase when culturing competence, and adding EDTA to improve the electric shock transformation efficiency of the Klebsiella. K.p.DELTA.pdu/red competent cells were transformed with the homologous recombinant fragment "C" by electric shock and, after recovery, all plated on apramycin-resistant plates and cultured overnight at 37 ℃. After the growth of a single colony on the plate, the plate was verified by using primers ldh test-s and ldh test-a [ ldh test-s: CCTGTTAAAGCAGTTGCCAGCCGGAC (SEQ ID NO. 26), ldh test-a: TCGTCAGCTCGATGGTTCGGCGATTGG (SEQ ID NO. 27) ]. If the recombination is successful, a band with the size of 3.1kb can be amplified, if the recombination is not successful, the size of the amplified fragment is 2.4kb, and the PCR verification result is shown in FIG. 3. And (3) verifying that a correct PCR product is sequenced by Shanghai Biotechnology Co., ltd, and further determining whether the coding gene of the lactate dehydrogenase is successfully knocked out. Sequencing results prove that the correct strain is subcultured to eliminate the plasmid pDK6-red, and the finally obtained engineering bacterium is recorded as K.p delta pdu delta ldh773.

B. Knock-out coding gene of K.o.DELTA.pdu diol dehydratase

Competent cells of K.o.DELTA.pdu were prepared, and the plasmid pDK6-red was transformed to obtain the strain K.p.DELTA.pdu/red.

Preparing an electric transformation competent cell of the strain K.o delta pdu/Red, adding IPTG (isopropyl-beta-thiogalactoside) to induce the expression of Red recombinase when the strain is cultured to be competent, and adding EDTA (ethylene diamine tetraacetic acid) to improve the electric shock transformation efficiency of the Klebsiella. K.o.DELTA.pdu/red competent cells were transformed with the homologous recombinant fragment "C" by electric shock and, after recovery, all plated on apramycin-resistant plates and cultured overnight at 37 ℃. After a single colony grows on the plate, the plate is verified by primers ldh test-s and ldh test-a. If the recombination is successful, a band of 3.1kb in size can be amplified, and if the recombination is not successful, a fragment of 2.4kb in size can be amplified. And (3) verifying that a correct PCR product is sequenced by Shanghai Biotechnology Co., ltd, and further determining whether the coding gene of the lactate dehydrogenase is successfully knocked out. The sequencing result verifies that the correct strain is subcultured to eliminate the plasmid pDK6-red, and the finally obtained engineering bacterium is recorded as K.o delta pdu delta ldh773.

3) Elimination of resistance marker genes

A. Eliminating resistance gene carried by engineering bacteria K.p delta pdu delta ldh773

Competent cells of Klebsiella pneumoniae engineering strain K.p.DELTA.pdu.DELTA.ldh 773 were prepared, and the plasmid pDK6-flp was transformed to obtain strain K.p.DELTA.pdu.DELTA.ldh 773/flp.

K.p.DELTA.pdu.DELTA.ldh 773/FLP was subcultured, and the plasmid pDK6-FLP was induced to express FLP recombinase by addition of IPTG to eliminate the resistance marker. After subculture, diluting and spreading on an anti-LB plate, selecting a certain colony marker serial number and sequentially inoculating on an apramycin resistant plate. Single colonies that did not grow on apramycin resistant plates were further verified using primers ldh test-s and ldh test-a. If the elimination of the carried resistance gene fragment was successful, the amplified size was 1.5kb, and if not eliminated, the amplified size was 3.1kb. The PCR product of 1.5kb in size was verified by sequencing by Shanghai Biotechnology Ltd. And (4) subculturing the bacteria with correct sequencing verification to eliminate the plasmid pDK6-flp, and finally obtaining the engineering bacteria K.p delta pdu delta ldh.

B. Eliminating resistance gene carried by engineering bacteria K.o delta pdu delta ldh773

Competent cells of K.o.DELTA.pdu.DELTA.ldh 773 were prepared, and the plasmid pDK6-flp was transformed to obtain the strain K.o.DELTA.pdu.DELTA.ldh 773/flp.

Subculturing K.o.DELTA.pdu.DELTA.ldh 773/FLP, and adding IPTG to induce expression of plasmid pDK6-FLP to eliminate the resistance marker by FLP recombinase. After subculture, diluting and spreading on an anti-LB plate, selecting a certain colony marker serial number and sequentially inoculating on an apramycin resistant plate. Single colonies that did not grow on apramycin resistant plates were further verified using primers ldh test-s and ldh test-a. If the elimination of the carried resistance gene fragment was successful, the amplified size was 1.5kb, and if not eliminated, the amplified size was 3.1kb. The PCR product of 1.5kb in size was verified by sequencing by Shanghai Biotechnology Ltd. And (4) carrying out subculture on the bacteria with correct sequencing verification to eliminate the plasmid pDK6-flp, and finally obtaining the engineering bacteria K.o delta pdu delta ldh.

Example 4: construction of Klebsiella engineering bacteria inactivated by alcohol dehydrogenase

The technical scheme of knocking out the alcohol dehydrogenase is consistent with the method for knocking out the diol dehydratase in the embodiment 1, and the specific steps are as follows:

1) Construction of homologous recombination fragment for knocking out alcohol dehydrogenase encoding gene

Designing an upstream primer and a downstream primer according to a gene sequence of Klebsiella pneumoniae CGMCC 1.6366 for coding alcohol dehydrogenase:

an upstream primer adh-s1: GCAGCATCATCAAATTGGCGTTGAC (SEQ ID NO. 28)

The downstream primer adh-a1: GTGCTTTGCTATGGCTTGCGGACAGAC (SEQ ID NO. 29)

The gene for coding the alcohol dehydrogenase is obtained by utilizing the designed primers adh-s1 and adh-a1 and taking Klebsiella pneumoniae CGMCC 1.6366 genome DNA as a template through PCR amplification, the gene is connected to a pMD-19T simple plasmid through a TA cloning method, the obtained recombinant plasmid is named pMD19T-adh, and the sequencing verification is carried out by Shanghai Biotechnology limited company.

And transforming the successfully constructed plasmid pMD19T-adh into a strain DH5 alpha-pIJ 790 to obtain the strain DH5 alpha-pIJ 790-pMD19T-adh carrying the double plasmids.

Designing upstream and downstream primers according to the gene sequence of plasmid pIJ778 carrying streptomycin resistance gene cassette

An upstream primer adh-FRT-s1:

CAGTTTCACTCAAGAACAAGTCGACAAAATTCCGGGGATCCGTCGACC(SEQ ID NO.30)

the downstream primer adh-FRT-a1:

CGACCGTAGTAGGTATCCAGCAGGATCTGTAGGCTGGAGCTGCTTC(SEQ ID NO.31)

the designed primers adh-FRT-s1 and adh-FRT-a1 are used as a template, and PCR amplification is carried out to obtain the fragment of the streptomycin resistance gene cassette by using the plasmid pIJ778 as a template.

Preparing competent cells of a strain DH5 alpha-pIJ 790-pMD19T-adh, then electrically transforming the DH5 alpha-pIJ 790-pMD19T-adh competent cells by using a fragment of a streptomycin resistance gene cassette obtained by PCR and subjected to clean recovery, recovering the competent cells at 37 ℃ for 1h, centrifugally coating the competent cells on a streptomycin resistance plate, and screening a positive strain carrying the pMD 19T-delta adh778. After the colonies grow on the plate, they were verified by using primers adh-s1 and test 778. If no recombination occurs, no gene fragment is amplified. If the recombination is successful, a gene fragment of about 1.3kb is amplified. The bacterial strain successfully recombined through PCR verification is inoculated in a streptomycin resistant LB test tube culture medium for culture, and a plasmid is extracted and named as pMD 19T-delta adh778.

The constructed plasmid pMD 19T-delta adh778 is used as a template, and a homologous recombination fragment of the adh gene is amplified and knocked out by using primers adh-s1 and adh-a1 under the action of high fidelity enzyme KOD, so that the obtained fragment is abbreviated as 'D'. The size of the fragment is 2.5kb, both ends carry homologous arms of about 600bp and 500bp respectively, and the middle is a streptomycin resistance gene.

2) Homologous recombination knockout coding gene of Klebsiella engineering bacterium alcohol dehydrogenase

A. Knock out coding gene of K.p delta pdu delta ldh alcohol dehydrogenase

Competent cells of K.p.DELTA.pdu.ldh were prepared, and the plasmid pDK6-red was transformed to obtain the strain K.p.DELTA.pdu.ldh/red.

And (3) preparing an electrotransformation competent cell of the strain K.p delta pdu delta ldh/Red, adding IPTG (isopropyl-beta-thiogalactoside) to induce the expression of Red recombinase when the strain is cultured to be competent, and adding EDTA (ethylene diamine tetraacetic acid) to improve the electrotransformation efficiency of the Klebsiella. K.p.DELTA.pdu.DELTA.ldh/red competent cells were transformed with the homologous recombination fragment "D" shock and all plated on streptomycin resistant plates after recovery and cultured overnight at 37 ℃. After the growth of a single colony on the plate, the primers adh test-s and adh test-a are used for verification [ adh test-s: GTTAACCAGGGGCAAATAAGCCGATG (SEQ ID NO. 32), adh test-a: CGATTCACTGCGTGCTGGTGGATGA (SEQ ID NO. 33) ]. If the recombination is successful, a band of 2.9kb in size can be amplified, if the recombination is not successful, the size of the amplified fragment is 1.8kb, and the results of PCR verification are shown in FIG. 4. And (3) verifying that a correct PCR product is sequenced by Shanghai Biotechnology Co., ltd, and further determining whether the coding gene of the alcohol dehydrogenase is successfully knocked out. The sequencing result verifies that the correct strain is subcultured to eliminate the plasmid pDK6-red, and the finally obtained engineering bacterium is recorded as K.p delta pdu delta ldh delta adh778.

B. Knock out coding gene of K.o.DELTA.pdu.DELTA.ldh alcohol dehydrogenase

Competent cells of K.o.DELTA.pdu.ldh were prepared, and the plasmid pDK6-red was transformed to obtain the strain K.o.DELTA.pdu.ldh/red.

And (3) preparing an electric transformation competent cell of the strain K.o delta pdu delta ldh/Red, adding IPTG (isopropyl-beta-thiogalactoside) to induce the expression of Red recombinase when the strain is cultured to be competent, and adding EDTA (ethylene diamine tetraacetic acid) to improve the electric shock transformation efficiency of the Klebsiella. K.o.DELTA.pdu. DELTA.ldh/red competent cells were transformed with the homologous recombination fragment "D" shock and all plated on streptomycin resistant plates after recovery and cultured overnight at 37 ℃. After the single strain grows on the plate, the primers adh test-s and adh test-a are used for verification. If the recombination is successful, a band of 2.9kb in size can be amplified, and if the recombination is not successful, a fragment of 1.8kb in size can be amplified. And (3) verifying that a correct PCR product is sequenced by Shanghai Biotechnology Co., ltd, and further determining whether the coding gene of the alcohol dehydrogenase is successfully knocked out. The sequencing result verifies that the correct strain is subcultured to eliminate the plasmid pDK6-red, and the finally obtained engineering bacterium is recorded as K.o delta pdu delta ldh delta adh778.

3) Elimination of resistance marker genes

A. Eliminating resistance gene carried by engineering bacteria K.p delta pdu delta ldh delta adh778

Competent cells of Klebsiella pneumoniae engineered K.p.DELTA.pdu.DELTA.ldh. DELTA.adh 778 were prepared, and the plasmid pDK6-flp was transformed to obtain the strain K.p.DELTA.pdu.DELTA.ldh. DELTA.adh 778/flp.

K.p.DELTA.pdu.DELTA.ldh. DELTA.adh 778/FLP was subcultured, and the resistance marker was eliminated by adding IPTG to induce expression of FLP recombinase from plasmid pDK 6-FLP. After subculture, diluting and spreading on an anti-LB plate, selecting a certain colony marker serial number and sequentially inoculating on a streptomycin resistant plate. Single colonies that did not grow on streptomycin resistant plates were further verified with primers adh test-s and adh test-a. If the elimination of the carried resistance gene fragment is successful, the amplified size is 1.4kb, and if not eliminated, the amplified size is 2.9kb. The PCR size of 1.4kb product was verified by sequencing by Shanghai Biotechnology Ltd. And (4) subculturing the bacteria with correct sequencing verification to eliminate the plasmid pDK6-flp, and finally obtaining the engineering bacteria K.p delta pdu delta ldh delta adh.

B. Eliminating resistance gene carried by engineering bacteria K.o delta pdu delta ldh delta adh778

Competent cells of Klebsiella pneumoniae engineered K.o.DELTA.pdu.DELTA.ldh. DELTA.adh 778 were prepared, and the plasmid pDK6-flp was transformed to obtain the strain K.o.DELTA.pdu.DELTA.ldh. DELTA.adh 778/flp.

K.o.DELTA.pdu.DELTA.ldh. DELTA.adh 778/FLP was subcultured, and the resistance marker was eliminated by adding IPTG to induce expression of FLP recombinase from plasmid pDK 6-FLP. After subculture, diluting and spreading on an anti-LB plate, selecting a certain colony marker serial number and sequentially inoculating on a streptomycin resistant plate. Single colonies that did not grow on streptomycin resistant plates were further verified with primers adh test-s and adh test-a. If the elimination of the carried resistance gene fragment is successful, the amplified size is 1.4kb, and if not eliminated, the amplified size is 2.9kb. The PCR size of 1.4kb product was verified by sequencing by Shanghai Biotechnology Ltd. And (4) carrying out subculture on the bacteria with correct sequencing verification to eliminate the plasmid pDK6-flp, and finally obtaining the engineering bacteria K.o delta pdu delta ldh delta adh.

Example 5: fermentation experiment of Klebsiella and constructed engineering bacteria

Starting strains of Klebsiella pneumoniae CGMCC 1.6366 (abbreviated as K.p), klebsiella acidogenic bacillus M5a1 (abbreviated as K.o) and engineering bacteria obtained in examples 1-4 are: K.p.DELTA.pdu, K.p.DELTA.pduGH, K.p.DELTA.pdu.DELTA.ldh, K.o.DELTA.pdu, K.o.DELTA.pduGH, K.o.DELTA.pdu.DELTA.ldh, and K.o.DELTA.pdu.DELTA.ldh.adh were subjected to continuous feed fermentation in a 5L fermentor, and the ability of the strain to synthesize 1, 3-propanediol was examined. Each strain was repeated for 3 batches of fermentation.

The above strains were inoculated into 250mL Erlenmeyer flasks containing 50mL of seed medium, respectively, and inoculated at a ratio of 1% (by volume), cultured on a shaker at 37 ℃ and 200rpm for 12 hours, and the resulting seeds were inoculated into a fermentor.

The seed culture medium comprises the following components: 10g/L of peptone, 5g/L of yeast extract and 5g/L of sodium chloride.

The cultured seeds were inoculated into a 5L fermentor for 1, 3-propanediol fermentation. 3L of fermentation medium was placed in the fermenter, and 50mL of seed solution was inoculated. Controlling the temperature of the fermentation tank at 37 deg.C, introducing air at 2L/min, rotating at 200rpm, and adjusting pH to 6.8 with 30% NaOH solution during fermentation. A certain amount of fermentation liquor is taken at intervals in the fermentation process for analysis. Measuring the growth of the bacteria by a spectrophotometer, and measuring the consumption of the substrate glycerol and the generation of the 1, 3-propanediol, the byproducts lactic acid and ethanol in the fermentation liquor by high performance liquid chromatography. Meanwhile, after the glycerol in the fermentation tank is consumed, sterilized glycerol aqueous solution with the concentration of 75% (g/g) is used for feeding. The feeding is not easy to be too fast, the glycerol residue in the tank body needs to be controlled, and the concentration of the glycerol in the fermentation liquor is controlled to be 10g/L in the initial stage of the feeding. The results of 30h fermentation were completed and the yield of 1, 3-propanediol, lactic acid, ethanol and conversion are shown in Table 1.

The fermentation medium comprises the following components: dipotassium phosphate 0.69g/L, monopotassium phosphate 0.25g/L, yeast powder 1.5g/L, ammonium sulfate 4.0g/L, magnesium sulfate 0.2g/L, and glycerol 30.0g/L.

TABLE 1 fermentation results of Klebsiella and engineering bacteria

Conversion (%) = concentration g/L of 1, 3-propanediol in fermentation broth for 30h fermentation:/(concentration g/L of initial glycerol in fermentation medium:. Volume L of medium + concentration g/L of feed:. Volume of residual glycerol in fermentation broth for 30h fermentation). 100

As can be seen from table 1:

compared with the initial strain K.p, the yield of 1, 3-propanediol after the engineering bacteria K.p delta pdu of which the diol dehydratase is knocked out is fermented for 30 hours reaches 63.65g/L, which is 14.19 percent higher than the yield of 1, 3-propanediol synthesized by K.p; the yield of the by-product lactic acid is 15.84g/L, which is 45.99 percent less than that of the K.p synthetic lactic acid; the yield of the byproduct ethanol is 3.09g/L, which is reduced by 56.11 percent compared with the yield of K.p synthetic ethanol; the conversion rate of synthesizing 1, 3-propylene glycol by metabolizing glycerol by K.p.DELTA.pdu is 46.16 percent, which is 6.9 percent higher than that of K.p; the fermentation result of K.p. delta. Pdu shows that the knockout of the gene coding for the diol dehydratase in Klebsiella pneumoniae can obviously improve the performance of the strain for synthesizing 1, 3-propanediol and simultaneously reduce the generation of byproducts of lactic acid and ethanol.

Similarly, compared with the original strain K.p, the yield of the 1, 3-propanediol after the engineering bacteria K.p delta pduGH of which the diol dehydratase activating factors are knocked out are fermented for 30 hours reaches 58.82g/L, and is increased by 5.52 percent compared with the yield of the 1, 3-propanediol synthesized by the K.p; the yield of the byproduct lactic acid is 24.56g/L, which is reduced by 16.26 percent compared with the yield of the K.p synthetic lactic acid; the yield of the byproduct ethanol is 5.61g/L, which is reduced by 20.31 percent compared with the yield of K.p synthetic ethanol; the conversion rate of the K.p.DELTA.pduGH for metabolizing the glycerol to synthesize the 1, 3-propanediol is 42.13 percent, which is 2.87 percent higher than that of the K.p; the fermentation result of K.p.DELTA.pduGH shows that the knockout of the gene coding for the activating factor of the diol dehydratase in Klebsiella pneumoniae can also improve the performance of the strain for synthesizing 1, 3-propanediol, but the yield of the strain for synthesizing 1, 3-propanediol is lower than that of K.p.DELTA.pdu.

Further knocking out a lactate dehydrogenase encoding gene on the engineering bacteria K.p delta pdu, wherein after the obtained engineering bacteria K.p delta pdu delta ldh is fermented for 30 hours, the yield of the 1, 3-propanediol reaches 68.07g/L, which is 22.12 percent higher than the yield of the 1, 3-propanediol synthesized by K.p; the by-product lactic acid is not synthesized any more; the yield of the byproduct ethanol is 3.18g/L, which is 54.82 percent lower than that of the K.p synthetic ethanol; the conversion rate of the K.p.DELTA.pdu.DELTA.ldh metabolizing glycerol to synthesize 1, 3-propanediol was 48.14%, which was 8.88% higher than the conversion rate of K.p. The fermentation result of K.p.DELTA.pdu.ldh shows that the further knockout of the coding gene of Klebsiella pneumoniae lactate dehydrogenase can continuously improve the performance of the strain in metabolizing glycerol to synthesize 1, 3-propanediol, and the synthesis of the byproduct lactic acid is completely blocked because the knockout of the ldh gene is completely blocked.

Further knocking out an alcohol dehydrogenase encoding gene on the engineering bacteria K.p delta pdu delta ldh, and fermenting the obtained engineering bacteria K.p delta pdu delta ldh delta adh for 30h to ensure that the yield of the 1, 3-propanediol reaches 70.12g/L and is increased by 25.80 percent compared with the yield of the 1, 3-propanediol synthesized by K.p; the by-products lactic acid and ethanol are not synthesized any more; the conversion rate of the P.DELTA.pdu.DELTA.ldh. DELTA.adh metabolizing glycerol to synthesize 1, 3-propanediol was 49.56%, which was 10.3% higher than the conversion rate of K.p. The fermentation result of K.p.DELTA.pdu.DELTA.ldh. DELTA.adh shows that further knocking out the encoding gene of Klebsiella pneumoniae alcohol dehydrogenase can continuously improve the performance of the strain in metabolizing glycerol to synthesize 1, 3-propanediol, and the synthesis of byproduct ethanol is completely blocked because the knocking out adh gene is completely blocked.

Compared with the initial strain K.o, after the engineering strain K.o delta pdu with the diol dehydratase knocked out is fermented for 30 hours, the yield of the 1, 3-propanediol reaches 54.76g/L, which is 13.80 percent higher than the amount of the 1, 3-propanediol synthesized by the K.o; the yield of the byproduct lactic acid is 14.12g/L, which is reduced by 47.35 percent compared with the yield of the K.o synthetic lactic acid; the yield of the byproduct ethanol is 4.1g/L, which is reduced by 46.05 percent compared with the yield of K.o synthetic ethanol; the conversion rate of the K.o delta pdu for metabolizing the glycerol to synthesize the 1, 3-propanediol is 40.6 percent and is improved by 5.37 percent compared with the conversion rate of the K.p; the fermentation result of K.o.DELTA.pdu shows that the performance of the strains for synthesizing 1, 3-propanediol can be obviously improved by knocking out the diol dehydratase gene in the acidobacter klebsiella and the generation of byproducts of lactic acid and ethanol can be reduced.

Compared with the original strain K.o, after the engineering strain K.o delta pduGH with the activation factor of the glycol dehydratase knocked out is fermented for 30 hours, the yield of the 1, 3-propanediol reaches 50.21g/L, which is 4.34 percent higher than the yield of the 1, 3-propanediol synthesized by the K.o; the yield of the byproduct lactic acid is 22.32g/L, which is reduced by 16.77 percent compared with the yield of the K.o synthetic lactic acid; the yield of the byproduct ethanol is 6.41g/L, which is 15.66 percent lower than that of the K.o synthetic ethanol; the conversion rate of synthesizing 1, 3-propylene glycol by metabolizing glycerol by K.o delta pdu is 37.22 percent and is improved by 1.99 percent compared with the conversion rate of K.p; the fermentation result of K.o.DELTA.pdu shows that the gene of the activating factor of the diol dehydratase knocked out in the acid producing bacillus klebsiellae can obviously improve the performance of the strain for synthesizing 1, 3-propanediol and simultaneously reduce the generation of byproducts of lactic acid and ethanol. Further knocking out a lactate dehydrogenase encoding gene on the engineering bacteria K.o delta pdu, wherein after the obtained engineering bacteria K.o delta pdu delta ldh is fermented for 30 hours, the yield of the 1, 3-propylene glycol reaches 58.11g/L, which is 20.76% higher than the yield of the 1, 3-propylene glycol synthesized by K.o; the by-product lactic acid is not synthesized any more; the yield of the byproduct ethanol is 4.6g/L, which is 39.47 percent less than that of the K.p synthetic ethanol; the conversion rate of the K.o.DELTA.pdu.DELTA.ldh metabolizing glycerol to synthesize 1, 3-propanediol is 42.1 percent, which is 6.87 percent higher than the conversion rate of the K.o. The fermentation results of K.o.DELTA.pdu.oldh also show that the further knock-out of the lactate dehydrogenase encoding gene can continue to improve the ability of Klebsiella oxytoca to metabolize glycerol to synthesize 1, 3-propanediol, and the synthesis of the byproduct lactic acid is also completely blocked because the knock-out ldh gene is completely blocked.

Further knocking out an alcohol dehydrogenase encoding gene on the engineering bacteria K.o delta pdu delta ldh, and fermenting the obtained engineering bacteria K.o delta pdu delta ldh delta adh for 30h to ensure that the yield of the 1, 3-propanediol reaches 58.76g/L and is increased by 22.11 percent compared with the yield of the 1, 3-propanediol synthesized by K.o; the by-products lactic acid and ethanol are not synthesized any more; the conversion rate of synthesizing 1, 3-propylene glycol by metabolizing glycerol by K.o.DELTA.pdu.ldh.DELTA.adh is 43.2 percent and is improved by 7.97 percent compared with the conversion rate of K.o. The fermentation result of K.o.DELTA.pdu.DELTA.ldh. DELTA. Adh shows that the further knockout of the encoding gene of the Klebsiella oxytoca alcohol dehydrogenase can continuously improve the performance of the strain in metabolizing glycerol to synthesize 1, 3-propanediol, and the synthesis of the byproduct ethanol is also completely blocked because the knockout of the ahd gene.

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions set forth herein, as well as variations of the methods and compositions of the present invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Sequence listing

<110> Shanghai higher research institute of Chinese academy of sciences

<120> construction method and application of Klebsiella engineering bacteria for improving yield of 1, 3-propylene glycol

<160> 33

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1665

<212> DNA

<213> Klebsiella pneumoniae

<400> 1

atgagatcga aaagatttga agcactggcg aaacgccctg tgaatcagga cggcttcgtt 60

aaggagtgga tcgaagaagg ctttatcgcg atggaaagcc cgaacgatcc gaaaccgtcg 120

ataaaaatcg ttaacggcgc ggtgaccgag ctggacggga aaccggtgag cgattttgac 180

ctgatcgacc actttatcgc ccgctacggt atcaacctga atcgcgccga agaagtgatg 240

gcgatggatt cggttaagct ggccaacatg ctgtgcgatc cgaacgttaa acgcagcgaa 300

atcgtcccgc tgaccaccgc gatgacgccg gcaaaaattg tcgaagtggt ttcgcatatg 360

aacgtcgttg agatgatgat ggcgatgcag aaaatgcgcg cccgccgcac cccatcccag 420

caggcgcacg tcaccaacgt caaagataac ccggtacaga ttgccgccga cgccgccgaa 480

ggcgcatggc gcggatttga cgaacaggaa accaccgttg cggtagcgcg ctacgcgccg 540

ttcaacgcca tcgcgctgct ggtcggctcg caggtaggcc gtccgggcgt actgactcag 600

tgctcgctgg aagaagccac cgagctgaag ctcggcatgc tgggccacac ctgctacgcc 660

gaaaccatct ccgtctacgg taccgaaccg gtctttaccg acggcgacga cacgccgtgg 720

tcgaagggtt tcttagcctc ctcctacgcc tctcgcggtc tgaaaatgcg cttcacctcc 780

ggctccggct ccgaagtgca gatgggctac gccgaaggca aatccatgct ttacctggaa 840

gcgcgctgca tctacatcac caaagccgcg ggcgtacagg gcctgcaaaa cggttccgtt 900

agctgcatcg gcgtgccgtc tgcggtgcct tccggcattc gcgcggtgct ggcggaaaac 960

ctgatctgtt cgtcgctgga tctggagtgc gcctccagta acgaccagac cttcacccac 1020

tccgatatgc gtcgtaccgc gcgcctgctg atgcagtttc tgccggggac cgactttatc 1080

tcttccggtt attccgcggt gccgaactac gacaacatgt tcgccggttc caacgaagat 1140

gccgaagact ttgacgacta caacgtcatc cagcgcgacc tgaaggtgga cggcggtctg 1200

cgtccggttc gcgaagaaga tgttatcgcc atccgtaata aggctgcccg cgcgctgcag 1260

gccgtttttg ccggaatggg gctgccgccg attaccgatg aagaagttga agccgcgacc 1320

tacgcccacg gttcgaaaga tatgccggag cgcaacatcg tcgaagacat caagttcgcc 1380

caggaaatca tcaataaaaa ccgcaacggc ctggaagtag tgaaagcgct ggcgcagggc 1440

gggttcaccg acgttgccca ggacatgctc aacatccaga aagccaagct gaccggagac 1500

tatctgcata cctccgcaat tatcgtcggc gatgggcagg tgctgtcagc cgtcaacgac 1560

gttaacgact atgccggtcc ggcaacgggc tatcgcctgc agggcgaacg ctgggaagag 1620

attaaaaaca tccctggcgc tcttgatccc aacgagattg attaa 1665

<210> 2

<211> 675

<212> DNA

<213> Klebsiella pneumoniae

<400> 2

atggaaatta atgaaaaatt gctgcgccag ataattgaag aagtgctcag cgagatgaag 60

ggcagcgata aacccgtctc gtttactgcg ccagcggcct ccgcggcgcc ccagcccacg 120

ccgcccgccg gcgacggctt cctgacggaa gtgggcgaag cgcgtcaggg aacccagcag 180

gacgaagtga ttatcgccgt cggcccggct ttcggcctgg cgcagaccgt caatatcgtc 240

ggcataccgc ataagagcat tttgcgcgaa gtcattgccg gtattgaaga agaaggcatt 300

aaggcgcgcg tgattcgctg ctttaaatcc tccgacgtgg ccttcgtcgc cgttgaaggc 360

aatcgcctga gcggttccgg catctctatc ggcatccagt caaaaggcac cacggtgatt 420

caccagcagg ggctgccgcc gctctctaac ctggagctgt tcccccaggc gccgctgctg 480

accctggaaa cctatcgcca gattggtaaa aacgccgccc gctatgcgaa acgcgaatcg 540

ccgcagccgg tcccgacgct gaacgaccag atggcgcggc caaaatacca ggcgaaatcg 600

gccattttgc acattaaaga gaccaagtac gtggtgacgg gcaaaaaccc gcaggaactg 660

cgcgtggcgc tttga 675

<210> 3

<211> 522

<212> DNA

<213> Klebsiella pneumoniae

<400> 3

atgaataccg acgcaattga atcaatggtg cgcgacgtat taagccgcat gaacagcctg 60

cagggcgagg cgccgacggc ggctccggcg gcagacggcg cgtcccgtag cgcaaaggtc 120

agcgactacc cgctggcgaa caaacacccg gaatgggtga aaaccgccac caataaaacg 180

ctggacgact ttacgctgga aaacgtgctg agcaacaaag ttaccgccca ggatatgcgt 240

attaccccgg aaacgctgcg cttacaggct tctatcgcca gggacgcggg ccgcgaccgg 300

ctggcgatga acttcgaacg cgccgccgaa ctgaccgcgg taccggacga tcgcattctt 360

gaaatctaca acgccctccg cccctatcgc tcgacgaaag aggagctgct ggcgatcgcc 420

gacgatctcg aaagccgcta tcaggcgaag atttgcgccg ctttcgttcg cgaagcggca 480

acgctgtacg tcgagcgtaa aaaactcaaa ggcgacgatt aa 522

<210> 4

<211> 1833

<212> DNA

<213> Klebsiella pneumoniae

<400> 4

atgcgatata tagctggcat tgatatcggc aactcatcga cggaagtcgc cctggcgact 60

ctgaatgagg ctggcacgct gacaatcacc cacagcgcgc tggcggaaac caccgggatc 120

aaaggcacgt tgcgtaacgt gttcggtatt caggaggcgc tcgccctcgt cgccagaggc 180

gccgggatcg ctgtcagcga tatttcgctc atccgcatta atgaagctac gccggtgatt 240

ggcgatgtgg cgatggaaac cattaccgag accatcatca ccgaatcgac catgatcggc 300

cataacccga aaacgcccgg cggcgcgggg cttggcgtgg gcatcaccat tacgccgcag 360

gagctgttaa cccgcccggc ggacgcgccc tatatcctgg tggtgtcgtc ggcgttcgat 420

tttgccgata tcgccagcgt gattaacgct tccctgcgcg ccggatatca gattaccggc 480

gtcattttgc aacgtgacga tggcgtactg gtcagcaacc ggctggaaaa accgctgccg 540

attgttgacg aagtgctgta catcgaccgc attcctctgg gaatgctggc ggcaattgag 600

gtcgccgtcc cggggaaggt catcgaaacg ctctctaacc cctacggcat cgccaccgta 660

ttccacctca acgccgagga gacgaaaaac atcgtcccga tggctcgcgc gctgattggc 720

aaccgttccg ccgtggtggt caaaacgcca tccggtgacg tcaaagcgcg cgcgataccc 780

gccggtaacc ttgagctgct ggcccagggc cggagcgtac gcgtagacgt tgccgctggc 840

gccgaagcca tcatgaaagc ggtcgacggc tgcggcaagc tcgataacgt caccggcgag 900

tcggggacca atatcggcgg catgctggaa cacgtgcgcc agaccatggc cgagctgacc 960

aacaagccca gcagcgaaat attcattcag gacctgctgg ccgtcgatac ctcggtgccg 1020

gtgagcgtca ccggcggtct tgccggggag ttctcgctgg agcaggccgt gggcatcgcc 1080

tcaatggtga aatcggatcg tttgcagatg gcgatgattg cccgcgaaat cgagcagaag 1140

ctcaatatcg acgtgcagat cggcggcgcc gaggccgaag ccgccattct gggcgcgctg 1200

accacgccgg gtaccacccg accgctggcg atcctcgacc tcggcgcagg ctccaccgat 1260

gcctccatca tcaaccccaa aggcgacatc atcgccactc acctcgccgg agctggcgat 1320

atggtgacga tgattattgc ccgcgagctg gggctggaag accgctatct ggcggaagag 1380

atcaagaagt atccgctggc caaggtggaa agtctgttcc atttacgcca cgaggacggc 1440

agcgtgcagt tcttctccac gccgctgccc cccgccgtat tcgcccgcgt ctgcgtggtg 1500

aaaccggacg aactggtgcc gctacccggc gacttagcgc tggaaaaagt acgcgccatt 1560

cgccgcagcg ccaaagagcg ggtctttgtc accaacgccc tgcgcgcact gcgtcaggtc 1620

agccccaccg gcaacattcg cgatattccg ttcgtggtgc tggtcggcgg ttcgtcgctg 1680

gatttcgagg tcccgcagct ggtcaccgat gcgctggcgc actaccgcct ggttgccggg 1740

cggggaaata ttcgcggcag cgagggcccc agaaacgcgg tggccaccgg cctgattctc 1800

tcctggcata aggagttcgc gcatggacag taa 1833

<210> 5

<211> 378

<212> DNA

<213> Klebsiella pneumoniae

<400> 5

atggacagta atcacagcgc cccggctatt gtgatcgccg ccatcgacgg ctgcgacggc 60

ctgtggcgcg acgtgctgct gggtatcgaa gaggaaggca ttcctttcct gctccagcat 120

cacccggccg gggatgtcgt ggacagcgcc tggcaggcgg cgcgcagctc gccgctactg 180

gtgggcatcg cctgcgaccg ccatacgctg gtcgtgcact acaagaattt acccgcatcg 240

gcgccgcttt ttacgctgat gcatcatcag gacagtcagg cccaacgtaa caccggtaat 300

aacgcggcac ggctggtcaa agggatcccg ttccgggatc tgaatagcga agcaacagga 360

gaacagcagt atgaataa 378

<210> 6

<211> 990

<212> DNA

<213> Klebsiella pneumoniae

<400> 6

atgaaaatcg cggtttacag tacgaagcag tacgataaaa agtacctgca gcacgttaat 60

gatacttacg gctttgaact ggaattcttc gacttcctgc tgacagagaa aaccgccaaa 120

accgcccacg gttgcgaagc ggtatgcatc ttcgtcaatg acgacggcag ccgtccggtg 180

ctggaggagc tgaaggccca cggcgtgaag tatatcgccc tgcgctgcgc cgggtttaac 240

aacgtcgacc tcgaggcggc gaaagcgctt ggcctgcgcg tcgtgcgcgt cccggcctac 300

tcgccggaag cggtcgctga acatgcgatc ggcatgatga tgtcgcttaa ccgccgcatc 360

caccgcgcct accagcgtac ccgtgatgcc aatttctccc tcgaaggcct caccggtttc 420

accatgtacg gcaaaaccgc cggggtgatc ggcaccggga aaattggcgt ggcgatgcta 480

cggatcctta aaggcttcgg catgcgtctg ctggcttttg acccgtaccc aagcgccgcc 540

gcgctggagc tgggggtgga atatgttgac ctggccacgc tgtacaagga gtcggacgtg 600

atctccctgc actgcccgct caccgacgaa aactaccatc tgctcaatcg cgaggccttc 660

gatcagatga aggacggggt gatggtgatt aacaccagcc gcggcgcgct gatcgattcc 720

caggcggcca tcgatgccct gaagcaccag aaaatcggcg cgctggggct ggacgtttat 780

gagaacgaac gcgatctgtt cttcgaagac aaatctaacg acgtgatcca ggacgacgtc 840

ttccgtcgcc tctccgcctg ccacaacgtg ctgttcaccg gccatcaggc gttcctcacc 900

gccgaggcgc tgatcagcat ttcggagacc accctgggca atctgcagca ggtcgccaac 960

ggtgaaacct gcccgaacgc tatcgtctga 990

<210> 7

<211> 2676

<212> DNA

<213> Klebsiella pneumoniae

<400> 7

atggctgtta ctaatatcgc tgaactgaac gcgcttgttg agcgtgtcaa gaaagcccag 60

cgtgaatatg ccagtttcac tcaagaacaa gtcgacaaaa tcttccgcgc cgccgcgctg 120

gccgctgcag atgctcgaat ccctctcgcc aaaatggccg ttgccgaatc cggcatgggc 180

atcgttgaag acaaagtgat caaaaaccac ttcgcttccg aatacattta caacgcttat 240

aaagacgaaa aaacctgtgg cgtcctgtca gaagacgaca cctttggtac catcactatc 300

gctgaaccaa tcggcatcat ctgcggtatc gtaccgacca ctaacccgac ttcaacagcc 360

atcttcaaat cgctcatcag cctgaagacg cgtaacgcca tcattttctc tccgcacccg 420

cgtgctaaag aagccaccaa caaagcggct gacatcgtcc tgcaggctgc catcgctgcc 480

ggcgcgccga aagacctgat tggctggatc gatcagccgt ctgttgaact gtctaacgcc 540

ctgatgcacc acccggacat caacctgatc cttgcgaccg gtggtccagg catggtgaaa 600

gcagcataca gctccggtaa acctgctatc ggcgtaggtg ccggtaacac cccggtggtg 660

attgatgaaa cggctgacat caaacgcgcc gttgcttccg ttctgatgtc taaaaccttc 720

gataacggcg ttatctgtgc ttctgagcag tccgttgtgg tggttgattc cgtttatgac 780

gcggttcgcg aacgtttcgc cagccacggc ggctacctgc tgcagggtaa agagctgaaa 840

gccgttcagg acattatcct gaaaaatggc gcgctgaacg ccgctatcgt tggtcagcct 900

gcggcgaaaa tcgctgaact ggcaggcttc accgtaccgg ccacgactaa aattctgatt 960

ggcgaagtca ccgacgttga cgaaagcgag ccgtttgctc acgaaaaact gtctccgacg 1020

ctggcgatgt accgtgcgaa agatttcgaa gacgccgtga ccaaagctga aaaactggtc 1080

gccatgggcg gtatcggtca tacctcttgc ctgtacaccg accaggataa ccagccggct 1140

cgcgtggctt acttcggcca gatgatgaaa actgcgcgta tcctgatcaa caccccggct 1200

tctcagggtg gtatcggtga cctgtacaac ttcaaactcg ctccttccct gactctgggt 1260

tgtggttcct ggggtggtaa ctccatctct gaaaacgttg gtccgaaaca cctgatcaac 1320

aagaaaaccg ttgctaagcg agctgaaaac atgttgtggc acaaacttcc gaaatctatc 1380

tacttccgtc gtggctccct gcctatcgca ctggatgaag tgattactga tggtcacaaa 1440

cgcgcgctga tcgtgactga ccgcttcctg ttcaacaacg gctatgccga tcagatcacc 1500

tccgtactga aagcagcggg tgttgaaact gaagtcttct tcgaagttga agctgacccg 1560

acgctgacca tcgtacgtaa aggcgccgac ctggcgaact cctttaaacc agacgtgatc 1620

atcgcgctgg gcggcggttc cccgatggat gcggcaaaaa tcatgtgggt catgtacgaa 1680

catccggaaa cccacttcga agaactggcg ctgcgcttta tggacatccg taaacgtatc 1740

tacaagttcc cgaaaatggg tgttaaagcc aagatggtgg cgatcactac cacctccggt 1800

accggttctg aagttacgcc gttcgccgtt gtgaccgatg atgcgacagg tcagaaatat 1860

ccgctggcgg actacgcgct gaccccggat atggccatcg tcgatgccaa cctggtgatg 1920

gatatgccga aatcgctgtg tgcgttcggt ggtctggatg ccgtgaccca cgccctggaa 1980

gcttacgttt ccgtgctggc ttctgagttc tctgacggcc aggctctgca ggcgctgaaa 2040

ctgctgaaag agtacctgcc ggcttcctac cacgaaggtt ccaagaaccc ggttgcccgc 2100

gagcgcgtac acagtgccgc caccatcgcc ggtatcgcgt ttgctaacgc cttcctcggc 2160

gtgtgtcact ccatggcgca caaactgggt tcccagttcc atattccgca cggtctggcc 2220

aacgccctgc tgatctgcaa cgttatccgc tacaacgcga atgacaaccc gaccaagcag 2280

accgcgttca gccagtacga ccgtccgcag gctcgtcgtc gctacgctga aatcgccgat 2340

cacctgggtc tctccgcacc gggcgaccgt accgcagcga aaatcgagaa gttgctggca 2400

tggctggaaa gcgtgaaagc tgagctgggt attccgaaat ctatccgcga agctggcgtt 2460

caggaagctg acttcctggc ccacgttgat aagctgtctg aagatgcatt cgatgaccag 2520

tgcaccggcg ctaacccgcg ctacccgctg atctccgagc tgaaacagat cctgctggat 2580

acctactacg gtcgcgagtt cgtcgaaggt gaagcagccg cgaaagccga agcagctccg 2640

gtgaaagctg agaaaaaagc gaaaaaatcc gcttaa 2676

<210> 8

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caacgtggaa gtcgtggcgt atagct 26

<210> 9

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcgttgaggt ggaatacggt ggc 23

<210> 10

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

caggcgcacg tcaccaacgt caaagataac ccggtacaga ttccggggat ccgtcgacc 59

<210> 11

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aatcgtcgcc tttgagtttt ttacgctcga cgtacagcgt tgtaggctgg agctgcttc 59

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

agaatctcgc tctctccagg ggaag 25

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cggcgatgtt tacggcaatg aag 23

<210> 14

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ctgggccagc agctcaaggt tac 23

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gctgccgatt gttgacgaag tgc 23

<210> 16

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

caggatttca cttcgcctac gac 23

<210> 17

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ggacctgctg gccgtcgata cctcggtgcc ggtgagcgga ttccggggat ccgtcgacc 59

<210> 18

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ggagcaggaa aggaatgcct tcctcttcga tacccagctg taggctggag ctgcttc 57

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gcaaatacgg catcagttac c 21

<210> 20

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tgcgtaacgt gttcggtatt ca 22

<210> 21

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gcggtgctcc ttattcgcca tca 23

<210> 22

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

agagcgcaca ggaccactat cca 23

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

tcggcgagct tatagaccag cgt 23

<210> 24

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ccagctgcct aggggcctta ctacgtatgg cgaagcgttg gcacccgcca aaaccgcca 59

<210> 25

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cttcgtcgag gtcggatgtc aagtggccgg tagtccgcaa ggagtggcgg ctccgcgac 59

<210> 26

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

cctgttaaag catagttgcc agccggac 28

<210> 27

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tcgtcagctc gatggttcgg cgattgg 27

<210> 28

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

gcagcatcat caaaattggc ggttgac 27

<210> 29

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

gtgctttgct atggcttgcg gacagac 27

<210> 30

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

cagtttcact caagaacaag tcgacaaaat tccggggatc cgtcgacc 48

<210> 31

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

cgaccgtagt aggtatccag caggatctgt aggctggagc tgcttc 46

<210> 32

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

gttaaccagg gcaaataagc cgatg 25

<210> 33

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

cgattcactg cgtgctggtg gatga 25

Claims

1. The Klebsiella engineered bacterium is characterized in that a diol dehydratase gene is knocked out, and the diol dehydratase gene is pduC, pduD and pduE.

2. The Klebsiella engineered bacterium of claim 1, wherein the lactate dehydrogenase gene and/or the alcohol dehydrogenase gene are also deleted.

3. The Klebsiella engineering bacterium according to claim 2, wherein the lactate dehydrogenase gene is an ldhA gene, and the alcohol dehydrogenase gene is an adhE gene.

4. A method for constructing Klebsiella engineering bacteria is characterized by comprising the following steps: knocking out a diol dehydratase gene of a wild type Klebsiella, wherein the diol dehydratase gene is pduC, pduD and pduE.

5. The method of claim 4, further comprising knocking out a lactate dehydrogenase gene and/or an alcohol dehydrogenase gene.

6. The method of claim 5, further comprising one or more of:

1) The lactate dehydrogenase gene is an ldhA gene;

2) The lactate dehydrogenase gene is an adhE gene;

3) Knocking out genes by adopting a homologous recombination method.

7. Use of the engineered Klebsiella as claimed in any of claims 1 to 3 for the production of 1, 3-propanediol.